--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/quality_filter.xml	Tue Apr 01 10:52:42 2014 -0400
@@ -0,0 +1,119 @@
+<tool id="qualityFilter" name="Filter nucleotides" version="1.0.1">
+  <description> based on quality scores</description>
+  <requirements>
+    <requirement type="package" version="0.7.1">bx-python</requirement>
+    <requirement type="package" version="1.7.1">numpy</requirement>
+  </requirements>
+  <command interpreter="python">
+  	quality_filter.py 
+  	$input 
+  	$out_file1 
+  	$primary_species 
+  	$mask_species 
+  	$score 
+  	$mask_char 
+  	${mask_region.region} 
+  	#if $mask_region.region == "3"
+  		${mask_region.lengthr},${mask_region.lengthl}
+  	#elif $mask_region.region == "0"
+  		1
+  	#else
+  		${mask_region.length}
+	#end if
+  	${GALAXY_DATA_INDEX_DIR}/quality_scores.loc
+  </command>
+  <inputs>
+    <param format="maf" name="input" type="data" label="Select data"/>
+    <param name="primary_species" type="select" label="Use quality scores of" display="checkboxes" multiple="true">
+      <options>
+        <filter type="data_meta" ref="input" key="species" />
+      </options>  
+    </param>
+	<param name="mask_species" type="select" label="Mask Species" display="checkboxes" multiple="true">
+      <options>
+        <filter type="data_meta" ref="input" key="species" />
+      </options>  
+	</param>
+	<param name="score" size="10" type="integer" value="20" label="Quality score cut-off" help="Cut-off value of 20 means mask all nucleotides having quality score less than or equal to 20"/>
+	<param name="mask_char" size="5" type="select" label="Mask character">
+      <option value="0" selected="true">#</option>
+      <option value="1">$</option>
+      <option value="2">^</option>
+      <option value="3">*</option>
+      <option value="4">?</option>
+      <option value="5">N</option>
+    </param>
+	<conditional name="mask_region">
+      <param name="region" type="select" label="Mask region">
+        <option value="0" selected="true">Only the corresponding nucleotide </option>
+        <option value="1">Corresponding column + right-side neighbors</option>
+        <option value="2">Corresponding column + left-side neighbors</option>
+        <option value="3">Corresponding column + neighbors on both sides</option>
+      </param>
+      <when value="0">
+      </when>
+      <when value="1">
+        <param name="length" size="10" type="integer" value="2" label="Number of right-side neighbors"/>
+      </when>
+      <when value="2">
+        <param name="length" size="10" type="integer" value="2" label="Number of left-side neighbors"/>
+      </when>
+      <when value="3">
+        <param name="lengthr" size="10" type="integer" value="2" label="Number of neighbors on right-side" />
+        <param name="lengthl" size="10" type="integer" value="2" label="Number of neighbors on left-side" />
+      </when>
+    </conditional>
+  </inputs>
+  <outputs>
+    <data format="maf" name="out_file1" metadata_source="input"/>
+  </outputs>
+  <requirements>
+    <requirement type="python-module">numpy</requirement>
+  </requirements>
+  <tests>
+    <test>
+      <param name="input" value="6.maf"/>
+      <param name="primary_species" value="panTro2"/>
+      <param name="mask_species" value="hg18"/>
+      <param name="score" value="50"/>
+      <param name="mask_char" value="0"/>
+      <param name="region" value="0" />
+      <output name="out_file1" file="6_quality_filter.maf"/>
+    </test>
+  </tests>
+ <help> 
+
+.. class:: infomark
+
+**What it does**
+
+This tool takes a MAF file as input and filters nucleotides in every alignment block of the MAF file based on their quality/PHRED scores. 
+
+-----
+
+.. class:: warningmark
+
+**Note**
+
+Any block/s not containing the primary species (species whose quality scores is to be used), will be omitted. 
+Also, any primary species whose quality scores are not available in Galaxy will be considered as a non-primary species. This info will appear as a message in the job history panel. 
+
+-----
+
+**Example**
+
+- For the following alignment block::
+
+   a score=4050.0
+   s hg18.chrX    3719221 48 - 154913754 tattttacatttaaaataaatatgtaaatatatattttatatttaaaa 
+   s panTro2.chrX 3560945 48 - 155361357 tattttatatttaaaataaagatgtaaatatatattttatatttaaaa 
+
+- running this tool with **Primary species as panTro2**, **Mask species as hg18, panTro2**, **Quality cutoff as 20**, **Mask character as #** and **Mask region as only the corresponding position** will return::
+
+   a score=4050.0
+   s hg18.chrX    3719221 48 - 154913754 ###tttac#####a###a#atatgtaaat###tattt#####ttaaaa 
+   s panTro2.chrX 3560945 48 - 155361357 ###tttat#####a###a#agatgtaaat###tattt#####ttaaaa 
+   
+   where, the positions containing # represent panTro2 nucleotides having quality scores less than 20.
+  </help>  
+</tool>