Mercurial > repos > drosofff > metavisitor_workflows

comparison Galaxy-Workflow-Metavisitor__Workflow_for_small_RNA_profiling_of_contigs.ga @ 3:ba15c770fd40 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows commit 9e3f79e20670526453bbed9f5b028aabb1bb7ae4
author drosofff
date Thu, 17 Nov 2016 07:27:04 -0500
parents
children
comparison
equal deleted inserted replaced
2:48b020a0d2f7 3:ba15c770fd40
1 {
2 "a_galaxy_workflow": "true",
3 "annotation": "",
4 "format-version": "0.1",
5 "name": "Metavisitor: Workflow for small RNA profiling of contigs",
6 "steps": {
7 "0": {
8 "annotation": "",
9 "content_id": null,
10 "id": 0,
11 "input_connections": {},
12 "inputs": [
13 {
14 "description": "",
15 "name": "Input Dataset Collection of fastq reads"
16 }
17 ],
18 "label": null,
19 "name": "Input dataset collection",
20 "outputs": [],
21 "position": {
22 "left": 136,
23 "top": 213
24 },
25 "tool_errors": null,
26 "tool_id": null,
27 "tool_state": "{\"collection_type\": \"list\", \"name\": \"Input Dataset Collection of fastq reads\"}",
28 "tool_version": null,
29 "type": "data_collection_input",
30 "uuid": "95c42be8-325b-48dc-b325-c8e8f9bf8720",
31 "workflow_outputs": [
32 {
33 "label": null,
34 "output_name": "output",
35 "uuid": "b0b38a3f-6467-4a79-8e6c-616befcfae74"
36 }
37 ]
38 },
39 "1": {
40 "annotation": "",
41 "content_id": null,
42 "id": 1,
43 "input_connections": {},
44 "inputs": [
45 {
46 "description": "",
47 "name": "de novo assembled Oases contigs"
48 }
49 ],
50 "label": null,
51 "name": "Input dataset",
52 "outputs": [],
53 "position": {
54 "left": 134.5,
55 "top": 401
56 },
57 "tool_errors": null,
58 "tool_id": null,
59 "tool_state": "{\"name\": \"de novo assembled Oases contigs\"}",
60 "tool_version": null,
61 "type": "data_input",
62 "uuid": "654820a8-188a-4b01-8e7f-4483c8df585f",
63 "workflow_outputs": [
64 {
65 "label": null,
66 "output_name": "output",
67 "uuid": "4918a4f9-037a-41c8-9881-3f91784b7666"
68 }
69 ]
70 },
71 "2": {
72 "annotation": "",
73 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6",
74 "id": 2,
75 "input_connections": {
76 "input": {
77 "id": 0,
78 "output_name": "output"
79 }
80 },
81 "inputs": [
82 {
83 "description": "runtime parameter for tool Clip adapter",
84 "name": "input"
85 }
86 ],
87 "label": null,
88 "name": "Clip adapter",
89 "outputs": [
90 {
91 "name": "output",
92 "type": "fasta"
93 }
94 ],
95 "position": {
96 "left": 407.5,
97 "top": 239
98 },
99 "post_job_actions": {
100 "RenameDatasetActionoutput": {
101 "action_arguments": {
102 "newname": "Clipped reads"
103 },
104 "action_type": "RenameDatasetAction",
105 "output_name": "output"
106 }
107 },
108 "tool_errors": null,
109 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6",
110 "tool_shed_repository": {
111 "changeset_revision": "a18edcf9c7ed",
112 "name": "yac_clipper",
113 "owner": "drosofff",
114 "tool_shed": "toolshed.g2.bx.psu.edu"
115 },
116 "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"TGGAATTCTCGGGTGCCAAG\\\", \\\"__current_case__\\\": 0}\", \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"Nmode\": \"\\\"reject\\\"\"}",
117 "tool_version": "1.3.6",
118 "type": "tool",
119 "uuid": "98bb84f7-1199-4755-80e8-47e4cd8d7229",
120 "workflow_outputs": [
121 {
122 "label": null,
123 "output_name": "output",
124 "uuid": "69ef3522-aeb9-4145-a95b-74154c090d35"
125 }
126 ]
127 },
128 "3": {
129 "annotation": "",
130 "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1",
131 "id": 3,
132 "input_connections": {
133 "input": {
134 "id": 1,
135 "output_name": "output"
136 }
137 },
138 "inputs": [
139 {
140 "description": "runtime parameter for tool Filter sequences by length",
141 "name": "input"
142 }
143 ],
144 "label": null,
145 "name": "Filter sequences by length",
146 "outputs": [
147 {
148 "name": "output",
149 "type": "fasta"
150 }
151 ],
152 "position": {
153 "left": 364,
154 "top": 387
155 },
156 "post_job_actions": {
157 "RenameDatasetActionoutput": {
158 "action_arguments": {
159 "newname": "Contig (>300 nt)"
160 },
161 "action_type": "RenameDatasetAction",
162 "output_name": "output"
163 }
164 },
165 "tool_errors": null,
166 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1",
167 "tool_shed_repository": {
168 "changeset_revision": "c8cd0a03db49",
169 "name": "fasta_filter_by_length",
170 "owner": "devteam",
171 "tool_shed": "toolshed.g2.bx.psu.edu"
172 },
173 "tool_state": "{\"__page__\": 0, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"max_length\": \"\\\"0\\\"\", \"min_length\": \"\\\"300\\\"\"}",
174 "tool_version": "1.1",
175 "type": "tool",
176 "uuid": "a66d2ce5-bb0a-433c-b8ea-ea612128ee09",
177 "workflow_outputs": [
178 {
179 "label": null,
180 "output_name": "output",
181 "uuid": "cfc01174-02dc-457e-a178-493cef1813ea"
182 }
183 ]
184 },
185 "4": {
186 "annotation": "",
187 "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2",
188 "id": 4,
189 "input_connections": {
190 "input": {
191 "id": 2,
192 "output_name": "output"
193 }
194 },
195 "inputs": [
196 {
197 "description": "runtime parameter for tool Concatenate multiple datasets",
198 "name": "input"
199 }
200 ],
201 "label": null,
202 "name": "Concatenate multiple datasets",
203 "outputs": [
204 {
205 "name": "out_file1",
206 "type": "input"
207 }
208 ],
209 "position": {
210 "left": 627,
211 "top": 247
212 },
213 "post_job_actions": {
214 "RenameDatasetActionout_file1": {
215 "action_arguments": {
216 "newname": "Merged Clipped Reads"
217 },
218 "action_type": "RenameDatasetAction",
219 "output_name": "out_file1"
220 }
221 },
222 "tool_errors": null,
223 "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2",
224 "tool_shed_repository": {
225 "changeset_revision": "201c568972c3",
226 "name": "concatenate_multiple_datasets",
227 "owner": "mvdbeek",
228 "tool_shed": "toolshed.g2.bx.psu.edu"
229 },
230 "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}",
231 "tool_version": "0.2",
232 "type": "tool",
233 "uuid": "c54ed9da-2b31-413b-94fc-3ebf21295d50",
234 "workflow_outputs": [
235 {
236 "label": null,
237 "output_name": "out_file1",
238 "uuid": "308b80b9-5d82-4d46-865b-233498602a8a"
239 }
240 ]
241 },
242 "5": {
243 "annotation": "",
244 "content_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0",
245 "id": 5,
246 "input_connections": {
247 "input": {
248 "id": 3,
249 "output_name": "output"
250 }
251 },
252 "inputs": [
253 {
254 "description": "runtime parameter for tool Regex Find And Replace",
255 "name": "input"
256 }
257 ],
258 "label": null,
259 "name": "Regex Find And Replace",
260 "outputs": [
261 {
262 "name": "out_file1",
263 "type": "input"
264 }
265 ],
266 "position": {
267 "left": 649,
268 "top": 381
269 },
270 "post_job_actions": {
271 "RenameDatasetActionout_file1": {
272 "action_arguments": {
273 "newname": "contig (>300t, simplified names)"
274 },
275 "action_type": "RenameDatasetAction",
276 "output_name": "out_file1"
277 }
278 },
279 "tool_errors": null,
280 "tool_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0",
281 "tool_shed_repository": {
282 "changeset_revision": "9ea374bb0350",
283 "name": "regex_find_replace",
284 "owner": "jjohnson",
285 "tool_shed": "toolshed.g2.bx.psu.edu"
286 },
287 "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"replacement\\\": \\\"\\\", \\\"pattern\\\": \\\"_Confidence_.+\\\"}]\", \"__page__\": 0}",
288 "tool_version": "0.1.0",
289 "type": "tool",
290 "uuid": "4fd98d0b-2ffc-4636-b0dc-c52882a0bb70",
291 "workflow_outputs": [
292 {
293 "label": null,
294 "output_name": "out_file1",
295 "uuid": "1d62f8d5-96b9-437b-96ef-51c809eeec5c"
296 }
297 ]
298 },
299 "6": {
300 "annotation": "",
301 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2.1",
302 "id": 6,
303 "input_connections": {
304 "input": {
305 "id": 4,
306 "output_name": "out_file1"
307 },
308 "refGenomeSource|ownFile": {
309 "id": 5,
310 "output_name": "out_file1"
311 }
312 },
313 "inputs": [
314 {
315 "description": "runtime parameter for tool sRbowtie",
316 "name": "input"
317 },
318 {
319 "description": "runtime parameter for tool sRbowtie",
320 "name": "refGenomeSource"
321 }
322 ],
323 "label": null,
324 "name": "sRbowtie",
325 "outputs": [
326 {
327 "name": "output",
328 "type": "tabular"
329 },
330 {
331 "name": "aligned",
332 "type": "fasta"
333 },
334 {
335 "name": "unaligned",
336 "type": "fasta"
337 }
338 ],
339 "position": {
340 "left": 942.5,
341 "top": 287
342 },
343 "post_job_actions": {
344 "HideDatasetActionaligned": {
345 "action_arguments": {},
346 "action_type": "HideDatasetAction",
347 "output_name": "aligned"
348 },
349 "HideDatasetActionunaligned": {
350 "action_arguments": {},
351 "action_type": "HideDatasetAction",
352 "output_name": "unaligned"
353 }
354 },
355 "tool_errors": null,
356 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2.1",
357 "tool_shed_repository": {
358 "changeset_revision": "615d2550977f",
359 "name": "msp_sr_bowtie",
360 "owner": "drosofff",
361 "tool_shed": "toolshed.g2.bx.psu.edu"
362 },
363 "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"__current_case__\\\": 1}\", \"method\": \"\\\"a_option\\\"\"}",
364 "tool_version": "1.1.2.1",
365 "type": "tool",
366 "uuid": "b4d59da2-94c7-4607-8c51-6287b9dd6e6c",
367 "workflow_outputs": [
368 {
369 "label": null,
370 "output_name": "output",
371 "uuid": "400d7592-b9b5-4c70-ba7f-058c656bd305"
372 }
373 ]
374 },
375 "7": {
376 "annotation": "",
377 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.2.0",
378 "id": 7,
379 "input_connections": {
380 "refGenomeSource|ownFile": {
381 "id": 5,
382 "output_name": "out_file1"
383 },
384 "refGenomeSource|series_0|input": {
385 "id": 6,
386 "output_name": "output"
387 }
388 },
389 "inputs": [
390 {
391 "description": "runtime parameter for tool Generate readmap and histograms from alignment files",
392 "name": "gff"
393 },
394 {
395 "description": "runtime parameter for tool Generate readmap and histograms from alignment files",
396 "name": "refGenomeSource"
397 }
398 ],
399 "label": null,
400 "name": "Generate readmap and histograms from alignment files",
401 "outputs": [
402 {
403 "name": "readmap_dataframe",
404 "type": "tabular"
405 },
406 {
407 "name": "size_distribution_dataframe",
408 "type": "tabular"
409 },
410 {
411 "name": "readmap_PDF",
412 "type": "pdf"
413 },
414 {
415 "name": "size_PDF",
416 "type": "pdf"
417 },
418 {
419 "name": "combi_PDF",
420 "type": "pdf"
421 }
422 ],
423 "position": {
424 "left": 1243.5,
425 "top": 273
426 },
427 "post_job_actions": {
428 "HideDatasetActionreadmap_dataframe": {
429 "action_arguments": {},
430 "action_type": "HideDatasetAction",
431 "output_name": "readmap_dataframe"
432 },
433 "HideDatasetActionsize_distribution_dataframe": {
434 "action_arguments": {},
435 "action_type": "HideDatasetAction",
436 "output_name": "size_distribution_dataframe"
437 }
438 },
439 "tool_errors": null,
440 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.2.0",
441 "tool_shed_repository": {
442 "changeset_revision": "92898cc3ea19",
443 "name": "msp_sr_readmap_and_size_histograms",
444 "owner": "drosofff",
445 "tool_shed": "toolshed.g2.bx.psu.edu"
446 },
447 "tool_state": "{\"minquery\": \"\\\"18\\\"\", \"__page__\": 0, \"rows_per_page\": \"\\\"8\\\"\", \"yrange\": \"\\\"0\\\"\", \"title\": \"\\\"Readmaps and size distributions\\\"\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"series\\\": [{\\\"__index__\\\": 0, \\\"norm\\\": \\\"1.0\\\", \\\"input\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}], \\\"ownFile\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"maxquery\": \"\\\"30\\\"\", \"xlabel\": \"\\\"Coordinates/read size\\\"\", \"ylabel\": \"\\\"Number of reads\\\"\", \"gff\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}",
448 "tool_version": "1.2.0",
449 "type": "tool",
450 "uuid": "87f9f9b5-5c71-465b-9422-c0696a3048a5",
451 "workflow_outputs": [
452 {
453 "label": null,
454 "output_name": "size_PDF",
455 "uuid": "91fa9c78-72dd-41e8-9937-c4b44682f79b"
456 },
457 {
458 "label": null,
459 "output_name": "combi_PDF",
460 "uuid": "68f021f3-087b-4f77-813f-74fa61877a0e"
461 },
462 {
463 "label": null,
464 "output_name": "readmap_PDF",
465 "uuid": "70966192-62e8-4dff-99b1-3f5dc8de8c28"
466 }
467 ]
468 }
469 },
470 "uuid": "c3853e65-8d66-47fc-aad9-6a40f5517622"
471 }