--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_small_RNA_profiling_of_contigs.ga	Thu Nov 17 07:27:04 2016 -0500
@@ -0,0 +1,471 @@
+{
+    "a_galaxy_workflow": "true", 
+    "annotation": "", 
+    "format-version": "0.1", 
+    "name": "Metavisitor: Workflow for small RNA profiling of contigs", 
+    "steps": {
+        "0": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 0, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "Input Dataset Collection of fastq reads"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset collection", 
+            "outputs": [], 
+            "position": {
+                "left": 136, 
+                "top": 213
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"collection_type\": \"list\", \"name\": \"Input Dataset Collection of fastq reads\"}", 
+            "tool_version": null, 
+            "type": "data_collection_input", 
+            "uuid": "95c42be8-325b-48dc-b325-c8e8f9bf8720", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "b0b38a3f-6467-4a79-8e6c-616befcfae74"
+                }
+            ]
+        }, 
+        "1": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 1, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "de novo assembled Oases contigs"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset", 
+            "outputs": [], 
+            "position": {
+                "left": 134.5, 
+                "top": 401
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"name\": \"de novo assembled Oases contigs\"}", 
+            "tool_version": null, 
+            "type": "data_input", 
+            "uuid": "654820a8-188a-4b01-8e7f-4483c8df585f", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "4918a4f9-037a-41c8-9881-3f91784b7666"
+                }
+            ]
+        }, 
+        "2": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", 
+            "id": 2, 
+            "input_connections": {
+                "input": {
+                    "id": 0, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [
+                {
+                    "description": "runtime parameter for tool Clip adapter", 
+                    "name": "input"
+                }
+            ], 
+            "label": null, 
+            "name": "Clip adapter", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 407.5, 
+                "top": 239
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "action_arguments": {
+                        "newname": "Clipped reads"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", 
+            "tool_shed_repository": {
+                "changeset_revision": "a18edcf9c7ed", 
+                "name": "yac_clipper", 
+                "owner": "drosofff", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"TGGAATTCTCGGGTGCCAAG\\\", \\\"__current_case__\\\": 0}\", \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"Nmode\": \"\\\"reject\\\"\"}", 
+            "tool_version": "1.3.6", 
+            "type": "tool", 
+            "uuid": "98bb84f7-1199-4755-80e8-47e4cd8d7229", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "69ef3522-aeb9-4145-a95b-74154c090d35"
+                }
+            ]
+        }, 
+        "3": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1", 
+            "id": 3, 
+            "input_connections": {
+                "input": {
+                    "id": 1, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [
+                {
+                    "description": "runtime parameter for tool Filter sequences by length", 
+                    "name": "input"
+                }
+            ], 
+            "label": null, 
+            "name": "Filter sequences by length", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 364, 
+                "top": 387
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "action_arguments": {
+                        "newname": "Contig (>300 nt)"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1", 
+            "tool_shed_repository": {
+                "changeset_revision": "c8cd0a03db49", 
+                "name": "fasta_filter_by_length", 
+                "owner": "devteam", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "tool_state": "{\"__page__\": 0, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"max_length\": \"\\\"0\\\"\", \"min_length\": \"\\\"300\\\"\"}", 
+            "tool_version": "1.1", 
+            "type": "tool", 
+            "uuid": "a66d2ce5-bb0a-433c-b8ea-ea612128ee09", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "cfc01174-02dc-457e-a178-493cef1813ea"
+                }
+            ]
+        }, 
+        "4": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "id": 4, 
+            "input_connections": {
+                "input": {
+                    "id": 2, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [
+                {
+                    "description": "runtime parameter for tool Concatenate multiple datasets", 
+                    "name": "input"
+                }
+            ], 
+            "label": null, 
+            "name": "Concatenate multiple datasets", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 627, 
+                "top": 247
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "Merged Clipped Reads"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "tool_shed_repository": {
+                "changeset_revision": "201c568972c3", 
+                "name": "concatenate_multiple_datasets", 
+                "owner": "mvdbeek", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
+            "tool_version": "0.2", 
+            "type": "tool", 
+            "uuid": "c54ed9da-2b31-413b-94fc-3ebf21295d50", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "out_file1", 
+                    "uuid": "308b80b9-5d82-4d46-865b-233498602a8a"
+                }
+            ]
+        }, 
+        "5": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", 
+            "id": 5, 
+            "input_connections": {
+                "input": {
+                    "id": 3, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [
+                {
+                    "description": "runtime parameter for tool Regex Find And Replace", 
+                    "name": "input"
+                }
+            ], 
+            "label": null, 
+            "name": "Regex Find And Replace", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 649, 
+                "top": 381
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "contig (>300t, simplified names)"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", 
+            "tool_shed_repository": {
+                "changeset_revision": "9ea374bb0350", 
+                "name": "regex_find_replace", 
+                "owner": "jjohnson", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"replacement\\\": \\\"\\\", \\\"pattern\\\": \\\"_Confidence_.+\\\"}]\", \"__page__\": 0}", 
+            "tool_version": "0.1.0", 
+            "type": "tool", 
+            "uuid": "4fd98d0b-2ffc-4636-b0dc-c52882a0bb70", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "out_file1", 
+                    "uuid": "1d62f8d5-96b9-437b-96ef-51c809eeec5c"
+                }
+            ]
+        }, 
+        "6": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2.1", 
+            "id": 6, 
+            "input_connections": {
+                "input": {
+                    "id": 4, 
+                    "output_name": "out_file1"
+                }, 
+                "refGenomeSource|ownFile": {
+                    "id": 5, 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "inputs": [
+                {
+                    "description": "runtime parameter for tool sRbowtie", 
+                    "name": "input"
+                }, 
+                {
+                    "description": "runtime parameter for tool sRbowtie", 
+                    "name": "refGenomeSource"
+                }
+            ], 
+            "label": null, 
+            "name": "sRbowtie", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "aligned", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "unaligned", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 942.5, 
+                "top": 287
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionaligned": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "aligned"
+                }, 
+                "HideDatasetActionunaligned": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "unaligned"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2.1", 
+            "tool_shed_repository": {
+                "changeset_revision": "615d2550977f", 
+                "name": "msp_sr_bowtie", 
+                "owner": "drosofff", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"__current_case__\\\": 1}\", \"method\": \"\\\"a_option\\\"\"}", 
+            "tool_version": "1.1.2.1", 
+            "type": "tool", 
+            "uuid": "b4d59da2-94c7-4607-8c51-6287b9dd6e6c", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "400d7592-b9b5-4c70-ba7f-058c656bd305"
+                }
+            ]
+        }, 
+        "7": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.2.0", 
+            "id": 7, 
+            "input_connections": {
+                "refGenomeSource|ownFile": {
+                    "id": 5, 
+                    "output_name": "out_file1"
+                }, 
+                "refGenomeSource|series_0|input": {
+                    "id": 6, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [
+                {
+                    "description": "runtime parameter for tool Generate readmap and histograms from alignment files", 
+                    "name": "gff"
+                }, 
+                {
+                    "description": "runtime parameter for tool Generate readmap and histograms from alignment files", 
+                    "name": "refGenomeSource"
+                }
+            ], 
+            "label": null, 
+            "name": "Generate readmap and histograms from alignment files", 
+            "outputs": [
+                {
+                    "name": "readmap_dataframe", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "size_distribution_dataframe", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "readmap_PDF", 
+                    "type": "pdf"
+                }, 
+                {
+                    "name": "size_PDF", 
+                    "type": "pdf"
+                }, 
+                {
+                    "name": "combi_PDF", 
+                    "type": "pdf"
+                }
+            ], 
+            "position": {
+                "left": 1243.5, 
+                "top": 273
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionreadmap_dataframe": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "readmap_dataframe"
+                }, 
+                "HideDatasetActionsize_distribution_dataframe": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "size_distribution_dataframe"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.2.0", 
+            "tool_shed_repository": {
+                "changeset_revision": "92898cc3ea19", 
+                "name": "msp_sr_readmap_and_size_histograms", 
+                "owner": "drosofff", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
+            "tool_state": "{\"minquery\": \"\\\"18\\\"\", \"__page__\": 0, \"rows_per_page\": \"\\\"8\\\"\", \"yrange\": \"\\\"0\\\"\", \"title\": \"\\\"Readmaps and size distributions\\\"\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"series\\\": [{\\\"__index__\\\": 0, \\\"norm\\\": \\\"1.0\\\", \\\"input\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}], \\\"ownFile\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"maxquery\": \"\\\"30\\\"\", \"xlabel\": \"\\\"Coordinates/read size\\\"\", \"ylabel\": \"\\\"Number of reads\\\"\", \"gff\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", 
+            "tool_version": "1.2.0", 
+            "type": "tool", 
+            "uuid": "87f9f9b5-5c71-465b-9422-c0696a3048a5", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "size_PDF", 
+                    "uuid": "91fa9c78-72dd-41e8-9937-c4b44682f79b"
+                }, 
+                {
+                    "label": null, 
+                    "output_name": "combi_PDF", 
+                    "uuid": "68f021f3-087b-4f77-813f-74fa61877a0e"
+                }, 
+                {
+                    "label": null, 
+                    "output_name": "readmap_PDF", 
+                    "uuid": "70966192-62e8-4dff-99b1-3f5dc8de8c28"
+                }
+            ]
+        }
+    }, 
+    "uuid": "c3853e65-8d66-47fc-aad9-6a40f5517622"
+}
\ No newline at end of file