Mercurial > repos > drosofff > metavisitor_workflows

diff Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_1-1,2,3.ga @ 2:48b020a0d2f7 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows commit d5feabb3309f2da09ba15b5fe818d0a7b30f3266
author drosofff
date Fri, 13 May 2016 05:46:40 -0400
parents 4a47903bb4df
children ba15c770fd40
line wrap: on
line diff
--- a/Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_1-1,2,3.ga	Mon Apr 11 13:14:14 2016 -0400
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_1-1,2,3.ga	Fri May 13 05:46:40 2016 -0400
@@ -27,7 +27,7 @@
             "tool_state": "{\"collection_type\": \"list\", \"name\": \"Read fastq files\"}", 
             "tool_version": null, 
             "type": "data_collection_input", 
-            "uuid": "None", 
+            "uuid": "ca202c6a-46b7-4f3a-a2ab-dbc781f331b7", 
             "workflow_outputs": [
                 {
                     "label": null, 
@@ -59,7 +59,7 @@
             "tool_state": "{\"collection_type\": \"list\", \"name\": \"Nora Virus Genomes\"}", 
             "tool_version": null, 
             "type": "data_collection_input", 
-            "uuid": "None", 
+            "uuid": "e8e196c7-c854-4bd9-ace2-345a0d797090", 
             "workflow_outputs": [
                 {
                     "label": null, 
@@ -100,10 +100,16 @@
             }, 
             "tool_errors": null, 
             "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", 
+            "tool_shed_repository": {
+                "changeset_revision": "91cce7c1436d", 
+                "name": "yac_clipper", 
+                "owner": "drosofff", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
             "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"Nmode\": \"\\\"reject\\\"\"}", 
             "tool_version": "1.3.6", 
             "type": "tool", 
-            "uuid": "None", 
+            "uuid": "afa187ce-544c-4287-8699-a9efe8ce45ab", 
             "workflow_outputs": []
         }, 
         "3": {
@@ -145,10 +151,16 @@
             }, 
             "tool_errors": null, 
             "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "tool_shed_repository": {
+                "changeset_revision": "201c568972c3", 
+                "name": "concatenate_multiple_datasets", 
+                "owner": "mvdbeek", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
             "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
             "tool_version": "0.2", 
             "type": "tool", 
-            "uuid": "None", 
+            "uuid": "73d5e37a-8a61-4bab-8bf5-12b12fc45988", 
             "workflow_outputs": []
         }, 
         "4": {
@@ -197,10 +209,16 @@
             }, 
             "tool_errors": null, 
             "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "tool_shed_repository": {
+                "changeset_revision": "201c568972c3", 
+                "name": "concatenate_multiple_datasets", 
+                "owner": "mvdbeek", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
             "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
             "tool_version": "0.2", 
             "type": "tool", 
-            "uuid": "None", 
+            "uuid": "f15e8add-3a18-4607-b5e2-51448dcdeb77", 
             "workflow_outputs": []
         }, 
         "5": {
@@ -257,10 +275,16 @@
             }, 
             "tool_errors": null, 
             "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "tool_shed_repository": {
+                "changeset_revision": "c1bfa227bbb6", 
+                "name": "msp_sr_bowtie", 
+                "owner": "drosofff", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
             "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"method\": \"\\\"multiple\\\"\"}", 
             "tool_version": "1.1.2", 
             "type": "tool", 
-            "uuid": "None", 
+            "uuid": "a9880e4e-f47f-4a21-ad20-5aefb83b57ad", 
             "workflow_outputs": []
         }, 
         "6": {
@@ -309,10 +333,16 @@
             }, 
             "tool_errors": null, 
             "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "tool_shed_repository": {
+                "changeset_revision": "201c568972c3", 
+                "name": "concatenate_multiple_datasets", 
+                "owner": "mvdbeek", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
             "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
             "tool_version": "0.2", 
             "type": "tool", 
-            "uuid": "None", 
+            "uuid": "afeb8258-2959-4b81-bec4-aaa342dd930d", 
             "workflow_outputs": []
         }, 
         "7": {
@@ -349,10 +379,10 @@
             }, 
             "tool_errors": null, 
             "tool_id": "wc_gnu", 
-            "tool_state": "{\"__page__\": 0, \"include_header\": \"\\\"True\\\"\", \"input1\": \"null\", \"options\": \"[\\\"lines\\\"]\", \"__rerun_remap_job_id__\": null}", 
+            "tool_state": "{\"__page__\": 0, \"include_header\": \"\\\"true\\\"\", \"input1\": \"null\", \"options\": \"[\\\"lines\\\"]\", \"__rerun_remap_job_id__\": null}", 
             "tool_version": "1.0.0", 
             "type": "tool", 
-            "uuid": "None", 
+            "uuid": "98092466-d430-48bd-b285-770aeee41153", 
             "workflow_outputs": [
                 {
                     "label": null, 
@@ -418,6 +448,12 @@
             }, 
             "tool_errors": null, 
             "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.1.5", 
+            "tool_shed_repository": {
+                "changeset_revision": "68f58363f1c6", 
+                "name": "msp_sr_readmap_and_size_histograms", 
+                "owner": "drosofff", 
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            }, 
             "tool_state": "{\"minquery\": \"\\\"18\\\"\", \"__page__\": 0, \"rows_per_page\": \"\\\"8\\\"\", \"yrange\": \"\\\"0\\\"\", \"title\": \"\\\"Readmaps and size distributions\\\"\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"series\\\": [{\\\"__index__\\\": 0, \\\"norm\\\": \\\"1.0\\\", \\\"input\\\": null}], \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"maxquery\": \"\\\"30\\\"\", \"xlabel\": \"\\\"Coordinates/read size\\\"\", \"ylabel\": \"\\\"Number of reads\\\"\", \"gff\": \"null\"}", 
             "tool_version": "1.1.5", 
             "type": "tool",