changeset 12:039e8e1e8b1f draft

Uploaded 20180201
author fabio
date Thu, 01 Feb 2018 16:23:17 -0500
parents 0d0f7080b55c
children b5f070767ed4
files ._.shed.yml ._example.tsv ._query.py ._query.xml query.py query.xml
diffstat 6 files changed, 40 insertions(+), 35 deletions(-) [+]
line wrap: on
line diff
Binary file ._.shed.yml has changed
Binary file ._example.tsv has changed
Binary file ._query.py has changed
Binary file ._query.xml has changed
--- a/query.py	Wed Jan 31 17:29:13 2018 -0500
+++ b/query.py	Thu Feb 01 16:23:17 2018 -0500
@@ -3,7 +3,7 @@
 # https://github.com/ross/requests-futures
 # http://docs.python-requests.org/en/master/user/quickstart/#more-complicated-post-requests
 
-import os, uuid, optparse, requests, json, time
+import sys, os, uuid, optparse, requests, json, time
 #from requests_futures.sessions import FuturesSession
 
 #### NN14 ####
@@ -16,9 +16,17 @@
 QUERY_DELAY = 30;
 ##############
 
+__version__ = "1.0.0";
 VALID_CHARS = '.-()[]0123456789abcdefghijklmnopqrstuvwxyzABCDEFGHIJKLMNOPQRSTUVWXYZ '
 
+# in the case of collections, exitcodes equal to 0 and 1 are not considered errors
+def raiseException( exitcode, message, errorfilepath ):
+    with open(errorfilepath, 'w') as out:
+        out.write(message);
+    sys.exit(exitcode);
+
 def query_request( options, args, payload ):
+    output_dir_path = options.outputdir;
     # add additional parameters to the payload
     #payload["tree_id"] = str(options.treeid);
     payload["search_mode"] = str(options.search);
@@ -32,7 +40,7 @@
     # make a synchronous post request to the query route
     req = session.post(QUERY_URL, headers=headers, json=payload);
     resp_code = req.status_code;
-    print(str(req.content)+"\n\n");
+    #print(str(req.content)+"\n\n");
     if resp_code == requests.codes.ok:
         resp_content = str(req.content);
         # convert out to json
@@ -42,7 +50,6 @@
         task_processed = False;
         # results json content
         json_status_content = None;
-        task_status = None;
         while task_processed is False:
             # create a new session
             session = requests.Session();
@@ -50,7 +57,7 @@
             status_query_url = STATUS_URL.replace("<task_id>", task_id);
             status_req = session.get(status_query_url);
             status_resp_content = str(status_req.content);
-            print(status_resp_content+"\n\n");
+            #print(status_resp_content+"\n\n");
             # convert out to json
             json_status_content = json.loads(status_resp_content);
             # take a look at the state
@@ -59,16 +66,11 @@
                 task_processed = True;
                 break;
             elif json_status_content['state'] in ['FAILURE', 'REVOKED']:
-                return "Task status: "+str(json_status_content['state']);
+                return raiseException( 1, "Task ID: "+str(task_id)+"\nTask status: "+str(json_status_content['state']), str(options.errorfile) );
             else:
                 time.sleep(QUERY_DELAY); # in seconds
         
-        # get output dir (collection) path
-        output_dir_path = options.outputdir;
-        if not os.path.exists(output_dir_path):
-            os.makedirs(output_dir_path);
         out_file_format = "tabular";
-
         for block in json_status_content['results']:
             seq_id = block['sequence_id'];
             accessions = block['accession_numbers'];
@@ -79,10 +81,12 @@
                 accessions_list = accessions_list + accession_number + "\n";
             with open(output_file_path, 'w') as out:
                 out.write(accessions_list.strip());
+        return sys.exit(0);
     else:
-        return "Unable to query the remote server. Please try again in a while.";
+        return raiseException( 1, "Unable to query the remote server. Please try again in a while.", str(options.errorfile) );
 
 def query( options, args ):
+    output_dir_path = options.outputdir;
     multiple_data = {};
     comma_sep_file_paths = options.files;
     #print("files: "+str(comma_sep_file_paths)+" - "+str(type(comma_sep_file_paths)));
@@ -106,13 +110,13 @@
                             seq_id = ''.join(e for e in seq_id if e in VALID_CHARS)
                             seq_text = line_split[1];
                             if seq_id in multiple_data:
-                                return "Error: the id '"+seq_id+"' is duplicated";
+                                return raiseException( 1, "Error: the id '"+seq_id+"' is duplicated", str(options.errorfile) );
                             multiple_data[seq_id] = seq_text;
         if len(multiple_data) > 0:
             return query_request( options, args,  multiple_data );
             #return echo( options, args );
         else:
-            return "An error has occurred. Please be sure that your input files are valid.";
+            return raiseException( 1, "An error has occurred. Please be sure that your input files are valid.", str(options.errorfile) );
     else:
         # try with the sequence in --sequence
         text_content = options.sequences;
@@ -132,21 +136,23 @@
                             seq_id = ''.join(e for e in seq_id if e in VALID_CHARS)
                             seq_text = line_split[1];
                             if seq_id in multiple_data:
-                                return "Error: the id '"+seq_id+"' is duplicated";
+                                return raiseException( 1, "Error: the id '"+seq_id+"' is duplicated", str(options.errorfile) );
                             multiple_data[seq_id] = seq_text;
                 if len(multiple_data) > 0:
                     return query_request( options, args, multiple_data );
                     #return echo( options, args );
                 else:
-                    return "An error has occurred. Please be sure that your input files are valid.";
+                    return raiseException( 1, "An error has occurred. Please be sure that your input files are valid.", str(options.errorfile) );
             else:
-                return "You have to insert at least one row formatted as a tab delimited <id, sequence> touple";
-    return -1;
+                return raiseException( 1, "You have to insert at least one row formatted as a tab delimited (ID, SEQUENCE) couple", str(options.errorfile) );
+    return 1;
 
 def __main__():
     # Parse the command line options
     usage = "Usage: query.py --files comma_sep_file_paths --names comma_seq_file_names --sequences sequences_text --search search_mode --exact exact_alg --sthreshold threshold --outputdir output_dir_path";
     parser = optparse.OptionParser(usage = usage);
+    parser.add_option("-v", "--version", action="store_true", dest="version",
+                    default=False, help="display version and exit")
     parser.add_option("-f", "--files", type="string",
                     action="store", dest="files", help="comma separated files path");
     parser.add_option("-n", "--names", type="string",
@@ -161,23 +167,24 @@
                     action="store", dest="exact", help="exact algorithm (required if search is 1 only)");
     parser.add_option("-t", "--sthreshold", type="float",
                     action="store", dest="sthreshold", help="threshold applied to the search algrithm");
-    parser.add_option("-o", "--outputdir", type="string",
+    parser.add_option("-o", "--outputdir", type="string", default="output",
                     action="store", dest="outputdir", help="output directory (collection) path");
+    parser.add_option("-r", "--errorfile", type="string", default="error.log",
+                    action="store", dest="errorfile", help="error file name containing error messages");
 
-    #parser.add_option("-k", "--outfile", type="string",
-                    #action="store", dest="outfile", help="output file");
-    
     # TEST
-    #--search 'rrr'
-    #--sthreshold 0.5
-    #--exact 0
-    #--sequences 'id0__tc__CAATTAATGATAAATATTTTATAAGGTGCGGAAATAAAGTGAGGAATATCTTTTAAATTCAAGTTCAATTCTGAAAGC'
-    #--outputdir 'collection_content'
     #sequences = 'NM_001169378.2__tc__atttcggatgctttggagggaggaactctagtgctgcattgattggggcgtgtgttaatgatattcccagttcgcatggcgagcatcgattcctggtacgtatgtgggccccttgactcccacttatcgcacttgtcgttcgcaatttgcatgaattccgcttcgtctgaaacgcacttgcgccagacttctccggctggtctgatctggtctgtgatccggtctggtggggcgccagttgcgtttcgagctcatcaccagtcactccgcagtcgcattctgccagaggtctccgatcaagagcgcttctccattcgagattcaaacgcagcgcggtctgacgccgccacatcgagtgaaatccatatcgatggccacattcacacaggacgagatcgacttcctgcgcagccatggcaacgagctgtgtgccaagacctggctgggattgtgggatccgaagcgggctgtgcaccagcaggagcagcgcgaactgatgatggacaagtatgagcggaagcgatactacctggagccggccagtcctcttaagtcgctggccaatgcggtcaacctgaagtcgtctgctccggcgacgaaccacactcagaatggccaccaaaatgggtatgccagcatccatttgacgcctcctgctgcccagcggacctcggccaatggattgcagaaggtggccaactcgtcgagtaactcttctggaaagacctcatcctcgatcagtaggccacactataatcaccagaacaacagccaaaacaacaatcacgatgcctttggcctgggtggcggattgagcagcctgaacagcgccggttccacatccactggagctctttccgacaccagcagttgtgctagcaatggcttcggtgcggactgcgactttgtggctgactttggctcggccaacattttcgacgccacatcggcgcgttccacaggatcgccggcggtgtcgtccgtgtcctcagtgggttccagcaatggctacgccaaggtgcagcccatccgggcagctcatctccagcagcaacagcagttgcagcagcagctgcatcagcagcagctcctcaatggcaatggtcatcagggcactgagaactttgccgacttcgatcacgctcccatctacaatgcagtggctccaccgacttttaacgattggatcagcgactggagcaggcggggcttccacgatcccttcgacgattgcgatgactcgccaccaggtgcccgccctccagcacctgcgccagctcctgctcaagttcccgcagtatcatcaccattgccaaccgtccgagaagaaccagagcttgcgtggaatttttgggaggacgagatgcgaatagaggcgcaggaaaaggagtcccaaactaaacagccggagttgggctactccttttcgattagtactactacgcccctttccccttcgaatcccttcctgccctaccttgtcagtgaggagcagcatcgaaatcatccagagaagccctccttttcgtattcgttgttcagctccatatcaaatagttcgcaagaagatcaggcggatgatcatgagatgaatgttttaaatgccaatttccatgatttctttacgtggagtgctcccttgcagaacggccatacgaccagtccgcccaagggcggaaatgcagcgatggcgcccagtgaggatcgatatgccgctcttaaggatctcgacgagcagctgcgagaactgaaggccagcgaaagcgccacagagacgcccacgcccaccagtggcaatgttcaggccacagatgcctttggtggagccctcaacaacaatccaaatcccttcaagggccagcaacagcagcagctcagcagccatgtggtgaatccattccagcagcagcaacagcagcagcaccagcagaatctctatggccagttgacgctcataccaaatgcctacggcagcagttcccagcagcagatggggcaccatctcctccagcagcagcagcagcaacagcagagcttcttcaacttcaacaacaacgggttcgccatctcgcagggtctgcccaacggctgcggcttcggcagcatgcaacccgctcctgtgatggccaacaatccctttgcagccagcggcgccatgaacaccaacaatccattcttatgagactcaacccgggagaatccgcctcgcgccacctggcagaggcgctgagccagcgaacaaagagcagacgcggaggaaccgaaccgaaattagtccattttactaacaatagcgttaatctatgtatacataatgcacgccggagagcactctttgtgtacatagcccaaatatgtacacccgaaaggctccacgctgacgctagtcctcgcggatggcggaggcggactggggcgttgatatattcttttacatggtaactctactctaacgtttacggatacggatatttgtatttgccgtttgccctagaactctatacttgtactaagcgcccatgaacacttcatccactaacatagctactaatcctcatcctagtggaggatgcagttggtccagacactctgttatttgttttatccatcctcgtacttgtctttgtcccatttagcactttcgttgcggataagaactttgtcagttattgattgtgtggccttaataagattataaaactaaatattataacgtacgactatacatatacggatacagatacagattcagacacagttagtacagatacagatatacatatacgcttttgtacctaatgaattgcttcttgtttccattgctaatcatctgcttttcgtgtgctaattttatacactagtacgtgcgatatcggccgtgcagatagattgctcagctcgcgagtcaagcctcttttggttgcacccacggcagacatttgtacatatactgtctgattgtaagcctcgtgtaatacctccattaacaccactcccccaccacccatccatcgaaccccgaatccatgactcaattcactgctcacatgtccatgcccatgccttaacgtgtcaaacattatcgaagccttaaagttatttaaaactacgaaatttcaataaaaacaaataagaacgctatc';
-    #print(sequences);
     #(options, args) = parser.parse_args(['-x', 'rrr', '-t', 0.5, '-s', sequences, '-o', 'collection_content']);
-    
+
     (options, args) = parser.parse_args();
-    return query( options, args );
+    if options.version:
+        print __version__;
+    else:
+        # create output dir (collection)
+        output_dir_path = options.outputdir;
+        if not os.path.exists(output_dir_path):
+            os.makedirs(output_dir_path);
+
+        return query( options, args );
 
 if __name__ == "__main__": __main__()
--- a/query.xml	Wed Jan 31 17:29:13 2018 -0500
+++ b/query.xml	Thu Feb 01 16:23:17 2018 -0500
@@ -34,17 +34,17 @@
                 <option value="1">By manually inserted text</option>
             </param>
             <when value="0">
-                <param format="tabular" name="txtfiles" type="data" label="Select files" multiple="true" optional="true" help="Select one or more tabular files containing (ID, TRANSCRIPT) touples for each line. The content of these files will be merged and the result will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." />
+                <param format="tabular" name="txtfiles" type="data" label="Select files" multiple="true" optional="false" help="Select one or more tabular files containing (ID, TRANSCRIPT) couples for each line. The content of these files will be merged and the result will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." />
             </when>
             <when value="1">
-                <param name="sequences" type="text" area="True" size="5x25" label="Manually insert sequences" optional="true" help="Insert a list of (ID, TRANSCRIPT) touples in a tab delimited format, one for each line. The content of this text box will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." />
+                <param name="sequences" type="text" area="True" size="5x25" label="Manually insert sequences" optional="false" help="Insert a list of (ID, TRANSCRIPT) couples in a tab delimited format, one for each line. The content of this text box will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." />
             </when>
         </conditional>            
         <param name="sthreshold" size="3" type="float" value="0.5" min="0.0" max="1.0" label="Search threshold" help="This threshold controls the specificity. Lower values will produce more hits to the query. Higher values are more stringent and will produce fewer hits." />
     </inputs>
     <outputs>
         <collection name="output_collect" type="list" label="AllSome Sequence Bloom Tree Search Collection">
-            <discover_datasets pattern="(?P&lt;identifier_0&gt;[^_]+)_(?P&lt;ext&gt;[^_]+)" directory="collection_content" ext="tabular" />
+            <discover_datasets pattern="(?P&lt;identifier_0&gt;[^_]+)_(?P&lt;ext&gt;[^_]+)" directory="collection_content" ext="auto" />
         </collection>
     </outputs>
 
@@ -54,9 +54,7 @@
 
 ----
 
-**Example**
-
-The input for this tool is a list of (ID, TRANSCRIPT) touples, one for each line,
+The input for this tool is a list of (ID, TRANSCRIPT) couples, one for each line,
 in a tab delimited format::
     
     id0  CCAACCAAAGGGAAAACTTTTTTCCGACTTTGGCCTAAAGGGTTTAACGGCCAAGTCAGAAGGGAAAAAGTTGCGCCA