changeset 20:7944301895cb draft

Uploaded 20180223
author fabio
date Fri, 23 Feb 2018 15:45:14 -0500 (2018-02-23)
parents 604e373b3b45
children feab8fd2f0a7
files ._.shed.yml ._example.tsv ._query.py ._query.xml query.xml
diffstat 5 files changed, 1 insertions(+), 1 deletions(-) [+]
line wrap: on
line diff
Binary file ._.shed.yml has changed
Binary file ._example.tsv has changed
Binary file ._query.py has changed
Binary file ._query.xml has changed
--- a/query.xml	Fri Feb 23 13:21:20 2018 -0500
+++ b/query.xml	Fri Feb 23 15:45:14 2018 -0500
@@ -64,7 +64,7 @@
     idn  CAATTAATGATAAATATTTTATAAGGTGCGGAAATAAAGTGAGGAATATCTTTTAAATTCAAGTTCAATTCTGAAAGC
 
 The ID can contain alphanumeric characters in addition to spaces, dots, dashes, and round and square brackets.
-Any additional characters will be trimmed out.
+Any additional character will be trimmed out.
 
 The output of the tool is a collection that contains a file for each ID with a list of
 accession numbers representing the samples that express one particular transcript.