Mercurial > repos > fubar > clustalw

changeset 0:8888e4e3f169

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Migrated tool version 0.1 from old tool shed archive to new tool shed repository
author fubar
date Tue, 07 Jun 2011 17:05:43 -0400
parents
children cf59a9ae0efe
files rgclustal/README rgclustal/rgClustal_testin.fasta rgclustal/rgClustal_testout.fasta rgclustal/rgClustal_testout.log rgclustal/rgClustalw.xml
diffstat 5 files changed, 359 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/rgclustal/README	Tue Jun 07 17:05:43 2011 -0400
@@ -0,0 +1,49 @@
+This is a wrapper for ClustalW.
+
+This tool allows you to align multiple sequences in Galaxy, using ClustalW2_ with mostly default options which should work reasonably well for many alignments.
+DNA or protein sequences can be aligned. The input file must be a fasta file in your current history.
+
+The alignments will appear as a clustal format file or optionally, as phylip or fasta format files in your history and a text log will be output to your history 
+showing the output Clustalw would normally write to standard output.
+
+If Clustal format is chosen, you have the option of adding basepair counts to the output
+
+A subsequence of the alignment can be output by setting the Output complete parameter to "Partial" and defining the offset and end of the subsequence to be output 
+
+**Installation**
+
+Make sure clustalw2 is available on the path for all your nodes
+
+Move the test data files to your galaxy root test-data
+Move the xml file to a subdirectory of your tools folder (eg rgenetics/) and then add a line in your tool_conf.xml to point there.
+Run
+sh run_functional_tests.sh -id clustalw
+to make sure the tests work
+
+then restart Galaxy and you should be good to go.
+
+**Attribution**
+
+Clustal attribution and associated documentation are available at http://www.clustal.org
+
+An implementation of a Galaxy Clustal wrapper was written by Hans-Rudolf Hotz in an email on the developer list - 
+http://lists.bx.psu.edu/pipermail/galaxy-dev/2010-November/003732.html
+
+This version by Ross Lazarus for the rgenetics project, builds on Hans-Rudolf's code, adding some additional controls and a log file. It also
+deals with stderr so Cluastalw2 writing there doesn't cause the job to error out. That's encoded in the tail of the command line. 
+
+**License**
+
+Assuming Hans-Rudolf is ok with a new license for this derived work, this version of his wrapper is LGPL like other rgenetics artefacts
+
+Written by Ross Lazarus for the Rgenetics project
+
+Copyright Ross Lazarus at gmail com 2011
+
+All rights reserved.
+
+Released under the LGPL - see http://www.gnu.org/copyleft/lesser.html
+
+
+
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/rgclustal/rgClustal_testin.fasta	Tue Jun 07 17:05:43 2011 -0400
@@ -0,0 +1,25 @@
+>c_briggsae-chrII(+)/43862-46313
+ATGAGCTTCCACAAAAGCATGAGCTTTCTCAGCTTCTGCCACATCAGCATTCAAATGATC
+>c_remanei-Crem_Contig172(-)/123228-124941
+ATGAGCCTCTACAACCGCATGATTCTTTTCAGCCTCTGCCACGTCCGCATTCAAATGCTC
+>c_brenneri-Cbre_Contig60(+)/627772-630087
+ATGAGCCTCCACAACAGCATGATTTTTCTCGGCTTCCGCCACATCCGCATTCAAATGATC
+>c_elegans-II(+)/9706834-9708803
+ATGAGCCTCTACTACAGCATGATTCTTCTCAGCTTCTGCAACGTCAGCATTCAGATGATC
+>c_briggsae-chrIfooI(+)/43862-46313
+CGCACAAATATGATGCACAAATCCACAACCTAAAGCATCTCCGATAACGTTGACCGAAGT
+>c_remanei-Crem_Contig172foo(-)/123228-124941
+AGCACAAATGTAATGAACGAATCCGCATCCCAACGCATCGCCAATCACATTCACAGATGT
+>c_brenneri-Cbre_Contig60gak(+)/627772-630087
+CGCACAAATGTAGTGGACAAATCCGCATCCCAAAGCGTCTCCGATAACATTTACCGAAGT
+>c_elegans-II(+)more/9706834-9708803
+TGCACAAATGTGATGAACGAATCCACATCCCAATGCATCACCGATCACATTGACAGATGT
+>c_briggsae-chrII(+)bar/43862-46313
+CCGGAGTCGATCCCTGAAT-----------------------------------------
+>c_remanei-Crem_Contig172zot(-)/123228-124941
+ACGAAGTCGGTCCCTATAAGGTATGATTTTATATGA----TGTACCATAAGGAAATAGTC
+>c_brenneri-Cbre_Contig60fee(+)/627772-630087
+ACGAAGTCGATCCCTGAAA---------TCAGATGAGCGGTTGACCA---GAGAACAACC
+>c_elegans-II(+)meh/9706834-9708803
+ACGAAGTCGGTCCCTGAAC--AATTATTT----TGA----TATA---GAAAGAAACGGTA
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/rgclustal/rgClustal_testout.fasta	Tue Jun 07 17:05:43 2011 -0400
@@ -0,0 +1,48 @@
+>c_briggsae-chrII_+_
+---ATGAGCTTCCACAAAAGCATGAGCTTT
+CTCAGCTTCTGCCACATCAGCATTCAAATG
+ATC
+>c_brenneri-Cbre_Contig60_+_
+---ATGAGCCTCCACAACAGCATGATTTTT
+CTCGGCTTCCGCCACATCCGCATTCAAATG
+ATC
+>c_remanei-Crem_Contig172_-_
+---ATGAGCCTCTACAACCGCATGATTCTT
+TTCAGCCTCTGCCACGTCCGCATTCAAATG
+CTC
+>c_elegans-II_+_
+---ATGAGCCTCTACTACAGCATGATTCTT
+CTCAGCTTCTGCAACGTCAGCATTCAGATG
+ATC
+>c_briggsae-chrII_+_bar
+---CCGGAGTCGATCCCTGAAT--------
+------------------------------
+---
+>c_brenneri-Cbre_Contig60fee_+_
+---ACGAAGTCGATCCCTGAAA--------
+-TCAGATGAGCGGTTGACCA---GAGAACA
+ACC
+>c_remanei-Crem_Contig172zot_-_
+---ACGAAGTCGGTCCCTATAAGGTATGAT
+TTTATATGA----TGTACCATAAGGAAATA
+GTC
+>c_elegans-II_+_meh
+---ACGAAGTCGGTCCCTGAAC--AATTAT
+TT----TGA----TATA---GAAAGAAACG
+GTA
+>c_briggsae-chrIfooI_+_
+CGCACAAATATGATGCACAAATCCACAACC
+TAAAGCATCTCCGATAACGTTGACCGAAGT
+---
+>c_brenneri-Cbre_Contig60gak_+_
+CGCACAAATGTAGTGGACAAATCCGCATCC
+CAAAGCGTCTCCGATAACATTTACCGAAGT
+---
+>c_remanei-Crem_Contig172foo_-_
+AGCACAAATGTAATGAACGAATCCGCATCC
+CAACGCATCGCCAATCACATTCACAGATGT
+---
+>c_elegans-II_+_more
+TGCACAAATGTGATGAACGAATCCACATCC
+CAATGCATCACCGATCACATTGACAGATGT
+---
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/rgclustal/rgClustal_testout.log	Tue Jun 07 17:05:43 2011 -0400
@@ -0,0 +1,112 @@
+
+
+
+ CLUSTAL 2.1 Multiple Sequence Alignments
+
+
+Sequence type explicitly set to DNA
+Sequence format is Pearson
+Sequence 1: c_briggsae-chrII_+_/43862-46313                 60 bp
+Sequence 2: c_remanei-Crem_Contig172_-_/123228-124941       60 bp
+Sequence 3: c_brenneri-Cbre_Contig60_+_/627772-630087       60 bp
+Sequence 4: c_elegans-II_+_/9706834-9708803                 60 bp
+Sequence 5: c_briggsae-chrIfooI_+_/43862-46313              60 bp
+Sequence 6: c_remanei-Crem_Contig172foo_-_/123228-124941    60 bp
+Sequence 7: c_brenneri-Cbre_Contig60gak_+_/627772-630087    60 bp
+Sequence 8: c_elegans-II_+_more/9706834-9708803             60 bp
+Sequence 9: c_briggsae-chrII_+_bar/43862-46313              60 bp
+Sequence 10: c_remanei-Crem_Contig172zot_-_/123228-124941    60 bp
+Sequence 11: c_brenneri-Cbre_Contig60fee_+_/627772-630087    60 bp
+Sequence 12: c_elegans-II_+_meh/9706834-9708803              60 bp
+Start of Pairwise alignments
+Aligning...
+
+Sequences (1:2) Aligned. Score:  80
+Sequences (1:3) Aligned. Score:  88
+Sequences (1:4) Aligned. Score:  83
+Sequences (1:5) Aligned. Score:  21
+Sequences (1:6) Aligned. Score:  20
+Sequences (1:7) Aligned. Score:  23
+Sequences (1:8) Aligned. Score:  18
+Sequences (1:9) Aligned. Score:  21
+Sequences (1:10) Aligned. Score:  16
+Sequences (1:11) Aligned. Score:  25
+Sequences (1:12) Aligned. Score:  10
+Sequences (2:3) Aligned. Score:  85
+Sequences (2:4) Aligned. Score:  86
+Sequences (2:5) Aligned. Score:  21
+Sequences (2:6) Aligned. Score:  20
+Sequences (2:7) Aligned. Score:  25
+Sequences (2:8) Aligned. Score:  20
+Sequences (2:9) Aligned. Score:  36
+Sequences (2:10) Aligned. Score:  16
+Sequences (2:11) Aligned. Score:  22
+Sequences (2:12) Aligned. Score:  17
+Sequences (3:4) Aligned. Score:  85
+Sequences (3:5) Aligned. Score:  13
+Sequences (3:6) Aligned. Score:  20
+Sequences (3:7) Aligned. Score:  25
+Sequences (3:8) Aligned. Score:  20
+Sequences (3:9) Aligned. Score:  36
+Sequences (3:10) Aligned. Score:  16
+Sequences (3:11) Aligned. Score:  18
+Sequences (3:12) Aligned. Score:  25
+Sequences (4:5) Aligned. Score:  13
+Sequences (4:6) Aligned. Score:  11
+Sequences (4:7) Aligned. Score:  20
+Sequences (4:8) Aligned. Score:  10
+Sequences (4:9) Aligned. Score:  31
+Sequences (4:10) Aligned. Score:  17
+Sequences (4:11) Aligned. Score:  29
+Sequences (4:12) Aligned. Score:  14
+Sequences (5:6) Aligned. Score:  73
+Sequences (5:7) Aligned. Score:  83
+Sequences (5:8) Aligned. Score:  80
+Sequences (5:9) Aligned. Score:  31
+Sequences (5:10) Aligned. Score:  14
+Sequences (5:11) Aligned. Score:  14
+Sequences (5:12) Aligned. Score:  12
+Sequences (6:7) Aligned. Score:  80
+Sequences (6:8) Aligned. Score:  88
+Sequences (6:9) Aligned. Score:  26
+Sequences (6:10) Aligned. Score:  16
+Sequences (6:11) Aligned. Score:  25
+Sequences (6:12) Aligned. Score:  12
+Sequences (7:8) Aligned. Score:  78
+Sequences (7:9) Aligned. Score:  31
+Sequences (7:10) Aligned. Score:  10
+Sequences (7:11) Aligned. Score:  12
+Sequences (7:12) Aligned. Score:  12
+Sequences (8:9) Aligned. Score:  31
+Sequences (8:10) Aligned. Score:  10
+Sequences (8:11) Aligned. Score:  14
+Sequences (8:12) Aligned. Score:  12
+Sequences (9:10) Aligned. Score:  63
+Sequences (9:11) Aligned. Score:  84
+Sequences (9:12) Aligned. Score:  78
+Sequences (10:11) Aligned. Score:  64
+Sequences (10:12) Aligned. Score:  76
+Sequences (11:12) Aligned. Score:  46
+Guide tree file created:   [/share/shared/galaxy/database/files/002/dataset_2705.dnd]
+
+There are 11 groups
+Start of Multiple Alignment
+
+Aligning...
+Group 1: Sequences:   2      Score:1045
+Group 2: Sequences:   2      Score:1016
+Group 3: Sequences:   4      Score:1001
+Group 4: Sequences:   2      Score:313
+Group 5: Sequences:   2      Score:731
+Group 6: Sequences:   4      Score:516
+Group 7: Sequences:   8      Score:344
+Group 8: Sequences:   2      Score:1016
+Group 9: Sequences:   2      Score:1054
+Group 10: Sequences:   4      Score:945
+Group 11: Sequences:  12      Score:380
+Alignment Score 6283
+firstres = 1 lastres = 63
+FASTA file created!
+
+Fasta-Alignment file created    [/share/shared/galaxy/database/files/002/dataset_2726.dat]
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/rgclustal/rgClustalw.xml	Tue Jun 07 17:05:43 2011 -0400
@@ -0,0 +1,125 @@
+<tool id="clustalw" name="ClustalW" version="0.1">
+   <description>multiple sequence alignment program for DNA or proteins</description>
+   <command> 
+    #if   ($range.mode=="part")
+    clustalw2 -infile=$input -outfile=$output -OUTORDER=$out_order -RANGE=$range.seq_range_start,$range.seq_range_end
+    #elif ($range.mode=="complete")
+    clustalw2 -infile=$input -outfile=$output -OUTORDER=$out_order 
+    #end if
+    #if ($outcontrol.outform=="clustal")
+    -SEQNOS=$outcontrol.out_seqnos
+    #end if
+    #if ($outcontrol.outform=="phylip")
+    -OUTPUT=PHYLIP
+    #end if
+    #if ($outcontrol.outform=="fasta")
+    -OUTPUT=FASTA
+    #end if
+    -TYPE=$dnarna 1&gt;$outlog  2&gt;&amp;1
+   </command>
+  <inputs>
+   <page>
+    <param format="fasta" name="input" type="data" label="Fasta File" />
+    <param name="outname" label="Name for output files to make it easy to remember what you did" type="text" size="50" value="Clustal_run" />
+    <param name="dnarna" type="select" label="Data Type">
+      <option value="DNA" selected="True">DNA nucleotide sequences</option>
+      <option value="PROTEIN">Protein sequences</option>
+    </param>
+    <conditional name="outcontrol">
+      <param name="outform" type="select" label="Output alignment format">
+        <option value="clustal" selected="True">Native Clustal output format</option>
+        <option value="phylip">Phylip format</option>
+        <option value="fasta">Fasta format</option>
+      </param>
+      <when value="fasta" />
+      <when value="phylip" />
+      <when value="clustal">
+       <param name="out_seqnos" type="select" label="Show residue numbers in clustal format output">
+         <option value="ON">yes</option>
+         <option value="OFF" selected="true">no</option>
+       </param>
+      </when>
+    </conditional>
+    <param name="out_order" type="select" label="Output Order">
+      <option value="ALIGNED">aligned</option>
+      <option value="INPUT">same order as input file</option>
+    </param>
+
+    <conditional name="range">
+        <param name="mode" type="select" label="Output complete alignment (or specify part to output)">
+          <option value="complete">complete alignment</option>
+          <option value="part">only part of the alignment</option>
+        </param>
+        <when value="complete">
+        </when>
+        <when value="part">    
+           <param name="seq_range_start" size="5" type="integer" value="1" label="start point" help="sequence range to write">
+           </param>
+           <param name="seq_range_end" size="5" type="integer" value="99999" label="end point" >
+           </param> 
+        </when>
+    </conditional>
+   </page>
+  </inputs>
+  <outputs>
+    <data format="clustal" name="output"  label="${outname}_output.${outcontrol.outform}">
+       <change_format>
+           <when input="outcontrol.outform" value="phylip" format="phylip" />
+           <when input="outcontrol.outform" value="fasta" format="fasta" />
+       </change_format>
+    </data>
+    <data format="txt" name="outlog"  label="${outname}_clustal_log.txt"/>
+  </outputs>
+  <tests>
+     <test>
+        <param name="input" value="rgClustal_testin.fasta" />
+      <param name = "outname" value="" />
+      <param name = "outform" value="fasta" />
+      <param name = "dnarna" value="DNA" />
+      <param name = "mode" value="complete" />
+      <param name = "out_order" value="ALIGNED" />
+      <output name="output" file="rgClustal_testout.fasta" ftype="fasta" />
+      <output name="output" file="rgClustal_testout.log" ftype="txt" lines_diff="5" />
+     </test>
+  </tests>
+  <help>
+
+**Note**
+
+This tool allows you to run a multiple sequence alignment with ClustalW2 (see Clustsrc_) using the default options.
+ 
+For a tutorial introduction, see ClustalW2_
+
+You can align DNA or protein sequences in the input file which should be multiple sequences to be aligned in a fasta file
+
+A log will be output to your history showing the output Clustal would normally write to standard output.
+
+The alignments will appear as a clustal format file or optionally, as phylip or fasta format files in your history. If you choose fasta as 
+the output format, you can create a 'Logo' image using the Sequence Logo tool.
+
+If Clustal format is chosen, you have the option of adding basepair counts to the output
+
+A subsequence of the alignment can be output by setting the Output complete parameter to "Partial" and defining the offset and end of the subsequence to be output 
+
+----
+
+**Attribution**
+
+Clustal attribution and associated documentation are available at Clustsrc_
+
+The first iteration of this Galaxy wrapper was written by Hans-Rudolf Hotz - see Clustfirst_
+
+It was modified by Ross Lazarus for the rgenetics project
+
+This wrapper is now LGPL
+
+.. _ClustalW2: http://www.ebi.ac.uk/2can/tutorials/protein/clustalw.html  
+
+.. _Clustsrc: http://www.clustal.org
+
+.. _Clustfirst: http://lists.bx.psu.edu/pipermail/galaxy-dev/2010-November/003732.html
+
+  </help>
+
+</tool>
+