<tool id="cshl_fastx_trimmer" name="Trim sequences">
	<description>to fixed length</description>
	<command>
cat '$input' |
fastx_trimmer
#if $input.ext == "fastqsanger":
 -Q 33
#elif $input.ext == "fastq":
 -Q 64
#end if
 -v -f $first -l $last -o '$output'
</command>
	<inputs>
		<param format="fasta,fastq,fastqsanger" name="input" type="data" label="Library to clip" />

		<param name="first" size="4" type="integer" value="1">
			<label>First base to keep</label>
		</param>

		<param name="last" size="4" type="integer" value="21">
			<label>Last base to keep</label>
		</param>
	</inputs>

	<tests>
		<test>
			<!-- Trim a FASTA file - remove first four bases (e.g. a barcode) -->
			<param name="input" value="fastx_trimmer1.fasta" />
			<param name="first" value="5"/>
			<param name="last" value="36"/>
			<output name="output" file="fastx_trimmer1.out" />
		</test>
		<test>
			<!-- Trim a FASTQ file - remove last 9 bases (e.g. keep only miRNA length sequences) -->
			<param name="input" value="fastx_trimmer2.fastq" />
			<param name="first" value="1"/>
			<param name="last" value="27"/>
			<output name="output" file="fastx_trimmer2.out" />
		</test>
	</tests>

	<outputs>
		<data format="input" name="output" metadata_source="input"
		/>
	</outputs>
	<help>
**What it does**

This tool trims (cut nucleotides from) sequences in a FASTA/Q file.
  
--------

**Example**

Input Fasta file (with 36 bases in each sequences)::

    >1-1
    TATGGTCAGAAACCATATGCAGAGCCTGTAGGCACC
    >2-1
    CAGCGAGGCTTTAATGCCATTTGGCTGTAGGCACCA
    

Trimming with First=1 and Last=21, we get a FASTA file with 21 bases in each sequences (starting from the first base)::

    >1-1
    TATGGTCAGAAACCATATGCA
    >2-1
    CAGCGAGGCTTTAATGCCATT

Trimming with First=6 and Last=10, will generate a FASTA file with 5 bases (bases 6,7,8,9,10) in each sequences::

    >1-1
    TCAGA
    >2-1
    AGGCT
    
------

This tool is based on `FASTX-toolkit`__ by Assaf Gordon.

 .. __: http://hannonlab.cshl.edu/fastx_toolkit/
    
</help>
</tool>
<!-- FASTX-Trimmer is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->