Mercurial > repos > idot > fastx_toolkit2
view fastx_trimmer_from_end.xml @ 1:e7c65e398bdd draft default tip
Deleted selected files
author | idot |
---|---|
date | Wed, 10 Jul 2013 06:16:21 -0400 |
parents | 78a7d28f2a15 |
children |
line wrap: on
line source
<tool id="cshl_fastx_end_trimmer" name="Trim End"> <description>of sequences</description> <command> cat '$input' | fastx_trimmer #if $input.ext == "fastqsanger": -Q 33 #elif $input.ext == "fastq": -Q 64 #end if -v -t $trimnum -m $minlen -o '$output' </command> <inputs> <param format="fasta,fastq,fastqsanger" name="input" type="data" label="Library to clip" /> <param name="trimnum" size="4" type="integer" value="5"> <label>Number of nucleotides to be trimmed</label> <help>This will trim from the end of the sequences</help> </param> <param name="minlen" size="4" type="integer" value="10"> <label>Minimum sequence length</label> <help>Sequences shorter than this length will be discarded</help> </param> </inputs> <tests> <test> <param name="input" value="fastx_trimmer_from_end1.fasta" /> <param name="trimnum" value="2"/> <param name="minlen" value="16"/> <output name="output" file="fastx_trimmer_from_end1.out" /> </test> </tests> <outputs> <data format="input" name="output" metadata_source="input" /> </outputs> <help> **What it does** This tool trims (cut nucleotides from) sequences in a FASTQ/FASTA file from the 3' end. .. class:: infomark When trimming a FASTQ file, the quality scores will be trimmed appropriately (to the same length of the corresponding sequence). -------- **Example** Input Fasta file:: >1-1 TATGGTCAGAAACCATATGCAGAGCCTGTAGGCACC >2-1 CAGCGAGGCTTTAATGCCATT Trimming 5 nucleotides from the end, and discarding sequences shorter than 10 , we get the following FASTA file:: >1-1 TATGGTCAGAAACCATATGCAGAGCCTGTAG >2-1 CAGCGAGGCTTTAATG Trimming 10 nucleotides from the end, and discarding sequences shorter than 15 , we get the following FASTA file:: >1-1 TATGGTCAGAAACCATATGCAGAGCC ------ This tool is based on `FASTX-toolkit`__ by Assaf Gordon. .. __: http://hannonlab.cshl.edu/fastx_toolkit/ </help> </tool> <!-- FASTX-Trimmer-End is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->