Mercurial > repos > iuc > chira_quantify

changeset 10:e0f08a05b24c draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/chira commit 51f68a6d51d9e87f8e54021ce760b1506a3589b8"
author iuc
date Sun, 14 Jun 2020 17:36:19 -0400
parents 96ed25eb39f0
children aee9afe5de77
files chira_quantify.xml macros.xml test-data/chimeras test-data/interactions test-data/singletons
diffstat 5 files changed, 7 insertions(+), 10 deletions(-) [+]
line wrap: on
line diff
--- a/chira_quantify.xml	Sat Jun 06 08:12:49 2020 -0400
+++ b/chira_quantify.xml	Sun Jun 14 17:36:19 2020 -0400
@@ -25,7 +25,7 @@
                  Always set this value relative to your sequencing depth. Setting this to lower leads
                  CRLs of random multimappings Also consider setting the --crl_share option
                  along with this"/>
-       <param name="em_threshold" type="float" value="1" label="EM threshold"
+       <param name="em_threshold" type="float" value="0.1" label="EM threshold"
               help="The maximum difference of transcripts expression between two consecutive iterations of EM algorithm to converge."/>
        <param name="crl" type="boolean" truevalue="-crl" falsevalue="" checked="true"
               label="Create CRLs" help="Create CRLs and qunatify them or use the loci further without creating the CRLs" />
@@ -37,6 +37,7 @@
     <tests>
         <test expect_num_outputs="1">
             <param name="segments" value="segments.bed"/>
+            <param name="em_threshold" value="1"/>
             <param name="merged" value="merged.bed"/>
             <param name="min_locus_size" value="5"/>
             <output name="loci" file="loci.counts"/>
--- a/macros.xml	Sat Jun 06 08:12:49 2020 -0400
+++ b/macros.xml	Sun Jun 14 17:36:19 2020 -0400
@@ -1,6 +1,6 @@
 <macros>
     <token name="@WRAPPER_VERSION@">@TOOL_VERSION@+galaxy</token>
-    <token name="@TOOL_VERSION@">1.3.3</token>
+    <token name="@TOOL_VERSION@">1.3.4</token>
     <xml name="requirements">
         <requirements>
             <requirement type="package" version="@TOOL_VERSION@">chira</requirement>
--- a/test-data/chimeras	Sat Jun 06 08:12:49 2020 -0400
+++ b/test-data/chimeras	Sun Jun 14 17:36:19 2020 -0400
@@ -1,3 +1,3 @@
 tagid	txid1	txid2	geneid1	geneid2	symbol1	symbol2	region1	region2	tx_pos_start1	tx_pos_end1	tx_pos_strand1	length1	tx_pos_start2	tx_pos_end2	tx_pos_strand2	length2	read_info	genomic_pos1	genomic_pos2	locus1	locus2	groupid1	groupid2	tpm1	tpm2	score1	score2	score	sequences	hybrid	hybrid_pos	mfe
-3|2	mmu-miR-20a-5p	ENSMUST00000136025	NA	NA	NA	NA	NA	NA	0	23	+	23	132	142	+	188	6,28,35,44,55	mmu-miR-20a-5p:0:23:+	ENSMUST00000136025:132:142:+	mmu-miR-20a-5p:0:23:+	ENSMUST00000136025:132:142:+	5	2	75660.00	165100.00	1.0	1.0	2.0	UAAAGUGCUUAUAGUGCAGGUAG&CUGCCUGCCU	((((((((((&)).))))))))	1&13	-13.7
-4|1	mmu-miR-6979-3p	ENSMUST00000136025	NA	NA	NA	NA	NA	NA	2	12	+	21	32	46	+	188	30,39,2,15,54	mmu-miR-6979-3p:2:12:+	ENSMUST00000136025:32:46:+	mmu-miR-6979-3p:2:12:+	ENSMUST00000136025:32:46:+	7	1	165100.00	121100.00	1.0	1.0	2.0	GUGUCUGUCU&CAGGACUCUUGGCU	((((.....((&))....))))	3&1	-4
+3|2	mmu-miR-20a-5p	ENSMUST00000136025	NA	NA	NA	NA	NA	NA	0	23	+	23	132	142	+	188	6,28,35,44,55	mmu-miR-20a-5p:0:23:+	ENSMUST00000136025:132:142:+	mmu-miR-20a-5p:0:23:+	ENSMUST00000136025:132:142:+	5	2	75660.00	165100.00	1.0	1.0	2.0	UAAAGUGCUUAUAGUGCAGGUAG&CUGCCUGCCU	............((.((((((((&))))))))))	13&1	-13.7
+4|1	mmu-miR-6979-3p	ENSMUST00000136025	NA	NA	NA	NA	NA	NA	2	12	+	21	32	46	+	188	30,39,2,15,54	mmu-miR-6979-3p:2:12:+	ENSMUST00000136025:32:46:+	mmu-miR-6979-3p:2:12:+	ENSMUST00000136025:32:46:+	7	1	165100.00	121100.00	1.0	1.0	2.0	GUGUCUGUCU&CAGGACUCUUGGCU	NA	NA	NA
--- a/test-data/interactions	Sat Jun 06 08:12:49 2020 -0400
+++ b/test-data/interactions	Sun Jun 14 17:36:19 2020 -0400
@@ -1,2 +1,2 @@
-mmu-miR-20a-5p:0:23:+	ENSMUST00000136025:132:142:+	1	UAAAGUGCUUAUAGUGCAGGUAG	CUGCCUGCCU	((((((((((&)).))))))))	1&13	-13.7	75660.00	165100.00	240760.0	1.0	1.0	2.0	NA	NA	mmu-miR-20a-5p	ENSMUST00000136025
-mmu-miR-6979-3p:2:12:+	ENSMUST00000136025:32:46:+	1	GUGUCUGUCU	CAGGACUCUUGGCU	((((.....((&))....))))	3&1	-4	165100.00	121100.00	286200.0	1.0	1.0	2.0	NA	NA	mmu-miR-6979-3p	ENSMUST00000136025
+1	mmu-miR-20a-5p	0	23	+	ENSMUST00000136025	132	142	+	UAAAGUGCUUAUAGUGCAGGUAG	CUGCCUGCCU	............((.((((((((&))))))))))	-13.7	AGUGCAGGUAG	CUGCCUGCCU	13&1	mmu-miR-20a-5p	12	23	+	ENSMUST00000136025	132	142	+	75660.00	165100.00	240760.0	1.0	1.0	2.0	NA	NA	mmu-miR-20a-5p	ENSMUST00000136025
+1	mmu-miR-6979-3p	2	12	+	ENSMUST00000136025	32	46	+	GUGUCUGUCU	CAGGACUCUUGGCU	NA	NA	NA	NA	NA	mmu-miR-6979-3p	2	12	+	ENSMUST00000136025	32	46	+	165100.00	121100.00	286200.0	1.0	1.0	2.0	NA	NA	mmu-miR-6979-3p	ENSMUST00000136025
--- a/test-data/singletons	Sat Jun 06 08:12:49 2020 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,4 +0,0 @@
-tagid	txid	geneid	symbol	region	tx_pos_start	tx_pos_end	tx_pos_strand	length	read_info	genomic_pos	locus	groupid	tpm	score
-2|2	mmu-miR-6898-5p	NA	NA	NA	11	21	+	NA	1,10,49	mmu-miR-6898-5p:11:21:+	mmu-miR-6898-5p:11:21:+	6	165100.00	1.00
-6|1	ENSMUST00000160533	NA	NA	NA	69	82	+	NA	43,55,55	ENSMUST00000160533:69:82:+	ENSMUST00000160533:69:82:+	4	129700.00	1.00
-7|9	ENSMUST00000182010	NA	NA	NA	24	74	+	NA	6,55,55	ENSMUST00000182010:24:74:+	ENSMUST00000182010:19:74:+	0	64850.00	1.00