changeset 3:b03487ad64c8 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
author iuc
date Sat, 07 Apr 2018 03:52:10 -0400
parents 26e5bc72833f
children f92edeb5e4c4
files hmmconvert.xml macros.xml test-data/MADE1.nhmmscan_out test-data/MADE1.nhmmscan_out.aliscoresout test-data/MADE1.nhmmscan_out.dfamtblout test-data/MADE1.nhmmscan_out.tblout test-data/nhmmer.out.dfamtblout test-data/nhmmer.out.tblout
diffstat 8 files changed, 302 insertions(+), 116 deletions(-) [+]
line wrap: on
line diff
--- a/hmmconvert.xml	Wed Apr 04 14:02:29 2018 -0400
+++ b/hmmconvert.xml	Sat Apr 07 03:52:10 2018 -0400
@@ -1,5 +1,5 @@
 <?xml version="1.0"?>
-<tool id="hmmer_hmmconvert" name="hmmconvert" version="@WRAPPER_VERSION@.0">
+<tool id="hmmer_hmmconvert" name="hmmconvert" version="@TOOL_VERSION@">
   <description>convert profile file to a HMMER format</description>
   <macros>
     <import>macros.xml</import>
@@ -9,20 +9,20 @@
   <command><![CDATA[
 hmmconvert
 $format
-$hmmfile > $output
-      ]]></command>
+'$hmmfile'
+> '$output'
+  ]]></command>
   <inputs>
     <expand macro="input_hmm" />
-    <param type="select" label="Output Format" name="format">
+    <param name="format" type="select" label="Output Format">
       <option value="-a" selected="true">output models in HMMER3 ASCII format</option>
       <!--<option value="-b">output models in HMMER3 binary format</option>-->
       <option value="-2">backward compatible HMMER2 ASCII format</option>
     </param>
   </inputs>
   <outputs>
-    <data format="hmm3" name="output" label="$hmmfile.name">
+    <data name="output" format="hmm3" label="$hmmfile.name">
       <change_format>
-        <when input="format" value="-a" format="hmm3"/>
         <when input="format" value="-2" format="hmm2"/>
       </change_format>
     </data>
@@ -44,6 +44,6 @@
 current HMMER3 ASCII format.
 
 @ATTRIBUTION@
-]]></help>
+  ]]></help>
   <expand macro="citation"/>
 </tool>
--- a/macros.xml	Wed Apr 04 14:02:29 2018 -0400
+++ b/macros.xml	Sat Apr 07 03:52:10 2018 -0400
@@ -2,11 +2,11 @@
 <macros>
   <xml name="requirements">
     <requirements>
-      <requirement type="package" version="3.1b2">hmmer</requirement>
+      <requirement type="package" version="@TOOL_VERSION@">hmmer</requirement>
       <yield/>
     </requirements>
   </xml>
-  <token name="@WRAPPER_VERSION@">0.1</token>
+  <token name="@TOOL_VERSION@">3.1b2</token>
   <xml name="stdio">
     <stdio>
       <!-- Anything other than zero is an error -->
@@ -21,64 +21,64 @@
 -E $E
 --domE $domE
 
-#if $T:
--T $T
+#if str($T):
+    -T $T
 #end if
 
-#if $domT:
---domT $domT
+#if str($domT):
+    --domT $domT
 #end if
 
-#if $incE:
---incE $incE
+#if str($incE):
+    --incE $incE
 #end if
 
-#if $incT:
---incT $incT
+#if str($incdomE):
+    --incdomE $incdomE
 #end if
 
-#if $incdomE:
---incdomE $incdomE
+#if str($incT):
+    --incT $incT
 #end if
 
-#if $incdomT:
---incdomT $incdomT
+#if str($incdomT):
+    --incdomT $incdomT
 #end if
   </token>
   <xml name="thresholds_xml">
     <!-- Options controlling reporting thresholds -->
-    <param name="E" label="report sequences &lt;= this E-Value threshold in output" help="(-E)" value="10.0" type="float" min="0"/>
-    <param name="domE" label="report domains &lt;= this E-Value threshold in output" help="(--domE)" value="10.0" type="float" min="0"/>
-    <param name="T" label="report sequences &gt;= this score threshold in output" help="(-T)" type="float" optional="True"/>
-    <param name="domT" label="report domains &gt;= this score threshold in output" help="(--domT)" type="float" optional="True"/>
+    <param argument="-E" type="float" min="0" value="10.0" label="report sequences &lt;= this E-Value threshold in output" />
+    <param argument="--domE" type="float" min="0" value="10.0" label="report domains &lt;= this E-Value threshold in output" />
+    <param argument="-T" type="float" optional="true" label="report sequences &gt;= this score threshold in output" />
+    <param argument="--domT" type="float" optional="true" label="report domains &gt;= this score threshold in output" />
     <!-- Options controlling inclusion (significance) thresholds -->
-    <param name="incE" label="consider sequences &lt;= this E-Value threshold as significant" help="(--incE)" type="float" optional="True"/>
-    <param name="incdomE" label="consider domains &lt;= this E-Value threshold as significant" help="(--incdomE)" type="float" optional="True"/>
-    <param name="incT" label="consider sequences &gt;= this score threshold as significant" help="(--incT)" type="float" optional="True"/>
-    <param name="incdomT" label="consider domains &gt;= this score threshold as significant" help="(--incdomT)" type="float" optional="True"/>
+    <param argument="--incE" type="float" optional="true" label="consider sequences &lt;= this E-Value threshold as significant" />
+    <param argument="--incdomE" type="float" optional="true" label="consider domains &lt;= this E-Value threshold as significant" />
+    <param argument="--incT" type="float" optional="true" label="consider sequences &gt;= this score threshold as significant" />
+    <param argument="--incdomT" type="float" optional="true" label="consider domains &gt;= this score threshold as significant" />
   </xml>
   <token name="@THRESHOLDS_NODOM@">
 -E $E
 
-#if $T:
--T $T
+#if str($T):
+    -T $T
 #end if
 
-#if $incE:
---incE $incE
+#if str($incE):
+    --incE $incE
 #end if
 
-#if $incT:
---incT $incT
+#if str($incT):
+    --incT $incT
 #end if
   </token>
   <xml name="thresholds_nodom">
     <!-- Options controlling reporting thresholds -->
-    <param name="E" label="report sequences &lt;= this E-Value threshold in output" help="(-E)" value="10.0" type="float" min="0"/>
-    <param name="T" label="report sequences &gt;= this score threshold in output" help="(-T)" type="float" optional="True"/>
+    <param argument="-E" type="float" min="0" value="10.0" label="report sequences &lt;= this E-Value threshold in output" />
+    <param argument="-T" type="float" optional="true" label="report sequences &gt;= this score threshold in output" />
     <!-- Options controlling inclusion (significance) thresholds -->
-    <param name="incE" label="consider sequences &lt;= this E-Value threshold as significant" help="(--incE)" type="float" optional="True"/>
-    <param name="incT" label="consider sequences &gt;= this score threshold as significant" help="(--incT)" type="float" optional="True"/>
+    <param argument="--incE" type="float" optional="true" label="consider sequences &lt;= this E-Value threshold as significant" />
+    <param argument="--incT" type="float" optional="true" label="consider sequences &gt;= this score threshold as significant" />
   </xml>
   <token name="@ACCEL_HEUR@">
 $max
@@ -86,15 +86,14 @@
 --F2 $F2
 --F3 $F3
 $nobias
-
   </token>
   <xml name="accel_heur_xml">
     <!-- Options controlling acceleration heuristics -->
-    <param name="max" type="boolean" truevalue="--max" label="Turn all heuristic filters off (less speed, more power)" help="(--max)" falsevalue=""/>
-    <param name="F1" type="float" label="Stage 1 (MSV) threshold: promote hits w/ P &lt;= F1" help="(--F1)" value="0.02"/>
-    <param name="F2" type="float" label="Stage 2 (Vit) threshold: promote hits w/ P &lt;= F2" help="(--F2)" value="1e-3"/>
-    <param name="F3" type="float" label="Stage 3 (Fwd) threshold: promote hits w/ P &lt;= F3" help="(--F3)" value="1e-5"/>
-    <param name="nobias" type="boolean" truevalue="--nobias" label="Turn off composition bias filter" help="(--nobias)" falsevalue=""/>
+    <param argument="--max" type="boolean" truevalue="--max" falsevalue="" label="Turn all heuristic filters off (less speed, more power)" />
+    <param argument="--F1" type="float" value="0.02" label="Stage 1 (MSV) threshold: promote hits w/ P &lt;= F1" />
+    <param argument="--F2" type="float" value="1e-3" label="Stage 2 (Vit) threshold: promote hits w/ P &lt;= F2" />
+    <param argument="--F3" type="float" value="1e-5" label="Stage 3 (Fwd) threshold: promote hits w/ P &lt;= F3" />
+    <param argument="--nobias" type="boolean" truevalue="--nobias" falsevalue="" label="Turn off composition bias filter" />
   </xml>
   <token name="@EVAL_CALIB@">
 --EmL $EmL
@@ -107,90 +106,90 @@
   </token>
   <xml name="eval_calib_xml">
     <!-- Control of E-value calibration -->
-    <param name="EmL" type="integer" value="200" min="1" help="(--EmL)" label="Length of sequences for MSV Gumbel mu fit"/>
-    <param name="EmN" type="integer" value="200" min="1" help="(--EmN)" label="Number of sequences for MSV Gumbel mu fit"/>
-    <param name="EvL" type="integer" value="200" min="1" help="(--EvL)" label="Length of sequences for Viterbi Gumbel mu fit"/>
-    <param name="EvN" type="integer" value="200" min="1" help="(--EvN)" label="Number of sequences for Viterbi Gumbel mu fit"/>
-    <param name="EfL" type="integer" value="100" min="1" help="(--EfL)" label="Length of sequences for Forward exp tail tau fit"/>
-    <param name="EfN" type="integer" value="200" min="1" help="(--EfN)" label="Number of sequences for Forward exp tail tau fit"/>
-    <param name="Eft" type="float" value="0.04" min="0" max="1" help="(--Eft)" label="tail mass for Forward exponential tail tau fit"/>
+    <param argument="--EmL" type="integer" min="1" value="200" label="Length of sequences for MSV Gumbel mu fit" />
+    <param argument="--EmN" type="integer" min="1" value="200" label="Number of sequences for MSV Gumbel mu fit" />
+    <param argument="--EvL" type="integer" min="1" value="200" label="Length of sequences for Viterbi Gumbel mu fit" />
+    <param argument="--EvN" type="integer" min="1" value="200" label="Number of sequences for Viterbi Gumbel mu fit" />
+    <param argument="--EfL" type="integer" min="1" value="100" label="Length of sequences for Forward exp tail tau fit" />
+    <param argument="--EfN" type="integer" min="1" value="200" label="Number of sequences for Forward exp tail tau fit" />
+    <param argument="--Eft" type="float" min="0" max="1" value="0.04" label="tail mass for Forward exponential tail tau fit" />
   </xml>
   <token name="@OFORMAT_WITH_OPTS_NOPFAM@">
 #if 'tblout' in str($oformat):
-    --tblout $tblout
+    --tblout '$tblout'
 #end if
 
 #if 'domtblout' in str($oformat):
-    --domtblout $domtblout
+    --domtblout '$domtblout'
 #end if
 
 $acc $noali $notextw
   </token>
   <xml name="oformat_with_opts_nopfam">
     <!-- Options directing output -->
-    <param name="oformat" multiple="True" display="checkboxes" label="Output Formats" type="select">
+    <param name="oformat" multiple="true" display="checkboxes" label="Output Formats" type="select">
       <option value="tblout" selected="true">Table of per-sequence hits (--tblout)</option>
       <option value="domtblout" selected="true">Table of per-domain hits (--domtblout)</option>
     </param>
-    <param name="acc" type="boolean" truevalue="--acc" falsevalue="" label="Prefer accessions over names in output" help="(--acc)"/>
-    <param name="noali" type="boolean" truevalue="--noali" falsevalue="" label="Don't output alignments, so output is smaller" help="(--noali)"/>
-    <param name="notextw" type="boolean" truevalue="--notextw" falsevalue="" label="Unlimited ASCII text output line width" help="(--notextw)"/>
+    <param argument="--acc" type="boolean" truevalue="--acc" falsevalue="" label="Prefer accessions over names in output" />
+    <param argument="--noali" type="boolean" truevalue="--noali" falsevalue="" label="Don't output alignments, so output is smaller" />
+    <param argument="--notextw" type="boolean" truevalue="--notextw" falsevalue="" label="Unlimited ASCII text output line width" />
   </xml>
   <token name="@OFORMAT_WITH_OPTS@">
 #if 'tblout' in str($oformat):
-    --tblout $tblout
+    --tblout '$tblout'
 #end if
 
 #if 'domtblout' in str($oformat):
-    --domtblout $domtblout
+    --domtblout '$domtblout'
 #end if
 
 #if 'pfamtblout' in str($oformat):
-    --pfamtblout $pfamtblout
+    --pfamtblout '$pfamtblout'
 #end if
 
 $acc $noali $notextw
   </token>
   <xml name="oformat_with_opts">
     <!-- Options directing output -->
-    <param name="oformat" multiple="True" display="checkboxes" label="Output Formats" type="select">
+    <param name="oformat" type="select" multiple="true" display="checkboxes" label="Output Formats">
       <option value="tblout" selected="true">Table of per-sequence hits (--tblout)</option>
       <option value="domtblout" selected="true">Table of per-domain hits (--domtblout)</option>
       <option value="pfamtblout" selected="true">Table of hits and domains in Pfam format (--pfamtblout)</option>
     </param>
-    <param name="acc" type="boolean" truevalue="--acc" falsevalue="" label="Prefer accessions over names in output" help="(--acc)"/>
-    <param name="noali" type="boolean" truevalue="--noali" falsevalue="" label="Don't output alignments, so output is smaller" help="(--noali)"/>
-    <param name="notextw" type="boolean" truevalue="--notextw" falsevalue="" label="Unlimited ASCII text output line width" help="(--notextw)"/>
+    <param argument="--acc" type="boolean" truevalue="--acc" falsevalue="" label="Prefer accessions over names in output" />
+    <param argument="--noali" type="boolean" truevalue="--noali" falsevalue="" label="Don't output alignments, so output is smaller" />
+    <param argument="--notextw" type="boolean" truevalue="--notextw" falsevalue="" label="Unlimited ASCII text output line width" />
   </xml>
   <xml name="oformat_test">
-      <param name="notextw" value="True" />
+      <param name="notextw" value="true" />
   </xml>
   <!-- TODO: tblout will match 'pfamtblout,dfamtblout' -->
   <token name="@OFORMAT_WITH_OPTS_N@">
 #if 'tblout' in str($oformat):
-    --tblout $tblout
+    --tblout '$tblout'
 #end if
 
 #if 'dfamtblout' in str($oformat):
-    --dfamtblout $dfamtblout
+    --dfamtblout '$dfamtblout'
 #end if
 
 #if 'aliscoresout' in str($oformat):
-    --aliscoresout $aliscoresout
+    --aliscoresout '$aliscoresout'
 #end if
 
 $acc $noali $notextw
   </token>
   <xml name="oformat_with_opts_n">
     <!-- Options directing output -->
-    <param name="oformat" multiple="True" display="checkboxes" label="Output Formats" type="select">
+    <param name="oformat" type="select" multiple="true" display="checkboxes" label="Output Formats">
       <option value="tblout" selected="true">Table of hits (--tblout)</option>
       <option value="dfamtblout" selected="true">Table of hits in Dfam format (--dfamtblout)</option>
       <option value="aliscoresout">Scores for each position in each alignment to file (--aliscoresout)</option>
     </param>
-    <param name="acc" type="boolean" truevalue="--acc" falsevalue="" label="Prefer accessions over names in output" help="(--acc)"/>
-    <param name="noali" type="boolean" truevalue="--noali" falsevalue="" label="Don't output alignments, so output is smaller" help="(--noali)"/>
-    <param name="notextw" type="boolean" truevalue="--notextw" falsevalue="" label="Unlimited ASCII text output line width" help="(--notextw)"/>
+    <param argument="--acc" type="boolean" truevalue="--acc" falsevalue="" label="Prefer accessions over names in output" />
+    <param argument="--noali" type="boolean" truevalue="--noali" falsevalue="" label="Don't output alignments, so output is smaller" />
+    <param argument="--notextw" type="boolean" truevalue="--notextw" falsevalue="" label="Unlimited ASCII text output line width" />
   </xml>
   <token name="@HSSI@">
 #if $hssi.hssi_select == "singlemx":
@@ -205,11 +204,10 @@
         <option value="false" selected="true">Disable</option>
         <option value="singlemx">Use substitution score matrix for single-sequence inputs</option>
       </param>
+      <when value="false" />
       <when value="singlemx">
-        <param name="popen" type="float" value="0.02" label="Gap open probability" help="(--popen)" min="0.0" max="0.5"/>
-        <param name="pextend" type="float" value="0.4" label="Gap extend probability" help="(--pextend)" min="0.0" max="1.0"/>
-      </when>
-      <when value="false">
+        <param argument="--popen" type="float" min="0.0" max="0.5" value="0.02" label="Gap open probability" />
+        <param argument="--pextend" type="float" min="0.0" max="1.0" value="0.4" label="Gap extend probability" />
       </when>
       <!-- -mx <s>      : substitution score matrix (built-in matrices, with -singlemx)-->
       <!-- -mxfile <f>  : read substitution score matrix from file <f> (with -singlemx)-->
@@ -222,7 +220,7 @@
       --seed $seed
   </token>
   <xml name="seed">
-    <param name="seed" label="RNG seed, 0 generates a random seed" value="42" type="integer" help="(--seed)" min="0"/>
+    <param argument="--seed" type="integer" min="0" value="42" label="RNG seed, 0 generates a random seed" />
   </xml>
   <xml name="seed_test">
       <param name="seed" value="4" />
@@ -230,19 +228,19 @@
   <token name="@ADV_OPTS@">
 $nonull2
 
-#if $Z:
--Z $Z
+#if str($Z):
+    -Z $Z
 #end if
 
-#if $domZ:
---domZ $domZ
+#if str($domZ):
+    --domZ $domZ
 #end if
   </token>
   <xml name="adv_opts">
     <!-- Other options -->
-    <param name="nonull2" type="boolean" truevalue="--nonull2" label="Turn off biased composition score corrections" help="(--nonull2)" falsevalue=""/>
-    <param name="Z" type="integer" label="# of comparisons done for E-value calculation" help="(-Z)" optional="True"/>
-    <param name="domZ" type="integer" label="# of significant sequences, for domain E-value calculation" help="(--domZ)" optional="True"/>
+    <param argument="--nonull2" type="boolean" truevalue="--nonull2" falsevalue="" label="Turn off biased composition score corrections" />
+    <param argument="-Z" type="integer" optional="true" label="# of comparisons done for E-value calculation" />
+    <param argument="--domZ" type="integer" optional="true" label="# of significant sequences, for domain E-value calculation" />
   </xml>
   <token name="@FORMAT_SELECTOR@">
       $input_format_select
@@ -264,7 +262,7 @@
 $arsws.arsws_select
 
 #if $arsws.arsws_select == "--wblosum":
---wid $arsws.wid
+    --wid $arsws.wid
 #end if
   </token>
   <xml name="arsws">
@@ -282,7 +280,7 @@
       <when value="--wgsc">
       </when>
       <when value="--wblosum">
-        <param name="wid" label="Set identity cutoff" value="0.62" type="float" help="(--wid)"/>
+        <param argument="--wid" type="float" value="0.62" label="Set identity cutoff" />
       </when>
       <when value="--wnone">
       </when>
@@ -315,13 +313,13 @@
       <when value="">
       </when>
       <when value="eent">
-        <param name="eset" type="float" value="0" label="set eff seq # for all models" help="(--eset)"/>
-        <param name="ere" type="float" value="0" label="set minimum rel entropy/position" help="(--ere)"/>
-        <param name="esigma" type="float" value="45" label="set sigma param" help="(--esigma)"/>
+        <param argument="--eset" type="float" value="0" label="set eff seq # for all models" />
+        <param argument="--ere" type="float" value="0" label="set minimum rel entropy/position" />
+        <param argument="--esigma" type="float" value="45" label="set sigma param" />
       </when>
       <when value="eclust">
-        <param name="eset" type="float" value="0" label="set eff seq # for all models" help="(--eset)"/>
-        <param name="eid" type="float" value="0.62" label="set fractional identity cutoff" min="0" max="1" help="(--eid)"/>
+        <param argument="--eset" type="float" value="0" label="set eff seq # for all models" />
+        <param argument="--eid" type="float" min="0" max="1" value="0.62" label="set fractional identity cutoff" />
       </when>
       <when value="enone">
       </when>
@@ -333,17 +331,19 @@
 $cut_tc
   </token>
   <xml name="cut">
-    <param name="cut_ga" type="boolean" truevalue="--cut_ga" label="use profile's GA gathering cutoffs to set all thresholding" help="(--cut_ga)" falsevalue=""/>
-    <param name="cut_nc" type="boolean" truevalue="--cut_nc" label="use profile's NC gathering cutoffs to set all thresholding" help="(--cut_nc)" falsevalue=""/>
-    <param name="cut_tc" type="boolean" truevalue="--cut_tc" label="use profile's TC gathering cutoffs to set all thresholding" help="(--cut_tc)" falsevalue=""/>
+    <param argument="--cut_ga" type="boolean" truevalue="--cut_ga" falsevalue="" label="use profile's GA gathering cutoffs to set all thresholding" />
+    <param argument="--cut_nc" type="boolean" truevalue="--cut_nc" falsevalue="" label="use profile's NC gathering cutoffs to set all thresholding" />
+    <param argument="--cut_tc" type="boolean" truevalue="--cut_tc" falsevalue="" label="use profile's TC gathering cutoffs to set all thresholding" />
   </xml>
   <token name="@MCSS@">
 --$mcs.model_construction_strategy_select
 
 #if $mcs.model_construction_strategy_select == "fast":
---symfrac $mcs.symfrac
+    --symfrac $mcs.symfrac
 #end if
-
+#if str($fragthresh)
+    --fragthresh $fragthresh
+#end if
   </token>
   <xml name="mcss">
     <!-- Alternative model construction strategies -->
@@ -353,12 +353,11 @@
         <option value="hand">Manual construction (requires reference annotation) (--hand)</option>
       </param>
       <when value="fast">
-        <param name="symfrac" value="0.5" type="float" label="Sets sym fraction controlling --fast construction"/>
+        <param argument="--symfrac" value="0.5" type="float" label="Sets sym fraction controlling --fast construction"/>
       </when>
       <when value="hand"></when>
     </conditional>
-    <param name="fragthresh" label="Fraction of alignment length, under which sequences are excluded" help="HMMER infers fragments if the sequence length L is less than or equal to a fraction x times the alignment length in columns (--fragthresh)" value="0.5" optional="True" type="float" />
-
+    <param argument="--fragthresh" type="float" value="0.5" optional="true" label="Fraction of alignment length, under which sequences are excluded" help="HMMER infers fragments if the sequence length L is less than or equal to a fraction x times the alignment length in columns" />
   </xml>
   <token name="@PRIOR@">
 $aps_select
@@ -376,32 +375,32 @@
     </citations>
   </xml>
   <token name="@LENGTHS@">
-#if $w_beta:
---w_beta $w_beta
+#if str($w_beta):
+    --w_beta $w_beta
 #end if
 
-#if $w_length:
---w_length $w_length
+#if str($w_length):
+    --w_length $w_length
 #end if
-
   </token>
   <xml name="lengths">
-    <param name="w_beta" label="Tail mass at which window length is determined"
-        help="(--w_beta)" optional="True" type="float"/>
-    <param name="w_length" label="Window Length"
-        help="(--w_length)" optional="True" type="integer" />
+    <param argument="--w_beta" type="float" optional="true" label="Tail mass at which window length is determined" />
+    <param argument="--w_length" type="integer" optional="true" label="Window Length" />
   </xml>
-  <token name="@INPUTHMMCHOICE@">
+  <token name="@INPUTHMMCHOICE@"><![CDATA[
 #if $input_hmm_conditional.input_hmm_source == "history":
-    '$input_hmm_conditional.hmmfile'
+    #set $input_hmm_filename = "localref.hmm"
+    ln -s '${input_hmm_conditional.hmmfile}' '${input_hmm_filename}' &&
+    ## "Press" database
+    hmmpress '${input_hmm_filename}' &&
 #else:
-    '$input_hmm_conditional.index.fields.db_path'
+    #set $input_hmm_filename = str($input_hmm_conditional.index.fields.db_path)
 #end if
-  </token>
+  ]]></token>
   <xml name="input_hmm_choice">
     <conditional name="input_hmm_conditional">
       <param name="input_hmm_source" type="select" label="Use a built-in HMM model database or own from your history" >
-        <option value="indexed" selected="True">Use a built-in HMM model database</option>
+        <option value="indexed" selected="true">Use a built-in HMM model database</option>
         <option value="history">Use a HMM database from history</option>
       </param>
       <when value="indexed">
@@ -413,12 +412,12 @@
         </param>
       </when>
       <when value="history">
-        <param name="hmmfile" type="data" label="HMM model" format="hmm2,hmm3"/>
+        <param name="hmmfile" type="data" format="hmm2,hmm3" label="HMM model" />
       </when>  <!-- history -->
     </conditional>  <!-- input_hmm_conditional -->
   </xml>
   <xml name="input_hmm">
-    <param name="hmmfile" type="data" label="HMM model" format="hmm2,hmm3"/>
+    <param name="hmmfile" type="data" format="hmm2,hmm3" label="HMM model" />
   </xml>
   <xml name="input_msa">
     <param name="msafile" type="data" label="Multiple Sequence Alignment" format="stockholm,clustal,fasta"
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/MADE1.nhmmscan_out	Sat Apr 07 03:52:10 2018 -0400
@@ -0,0 +1,109 @@
+# nhmmscan :: search DNA sequence(s) against a DNA profile database
+# HMMER 3.1b2 (February 2015); http://hmmer.org/
+# Copyright (C) 2015 Howard Hughes Medical Institute.
+# Freely distributed under the GNU General Public License (GPLv3).
+# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+# query sequence file:             /tmp/tmpc_c3amjg/files/000/dataset_2.dat
+# target HMM database:             /tmp/tmpc_c3amjg/files/000/dataset_1.dat
+# per-seq hits tabular output:     /tmp/tmpc_c3amjg/files/000/dataset_4.dat
+# hits output in Dfam format:      /tmp/tmpc_c3amjg/files/000/dataset_5.dat
+# max ASCII text line length:      unlimited
+# Vit filter P threshold:       <= 0.001
+# Fwd filter P threshold:       <= 1e-05
+# random number seed set to:       4
+# number of worker threads:        1
+# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+
+Query:       humanchr1/239220001-239550000  [L=330000]
+Scores for complete hit:
+    E-value  score  bias  Model     start    end  Description
+    ------- ------ -----  --------  -----  -----  -----------
+    1.2e-10   38.6   7.4  MADE1    302390 302466  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    7.8e-08   29.6   8.3  MADE1    174456 174498  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    1.2e-07   28.9   6.0  MADE1    302466 302390  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    7.2e-06   23.3   7.0  MADE1    174493 174456  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+  ------ inclusion threshold ------
+        1.4    6.3   7.0  MADE1    304073 304104  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+
+
+Annotation for each hit  (and alignments):
+>> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to      mod len      acc
+   ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
+ !   38.6   7.4   1.2e-10         4        80 .]    302390    302466 ..    302387    302466 ..        80    0.87
+
+  Alignment:
+  score: 38.6 bits
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1      4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80    
+                                       ggt ggtgcaaaa  aattg ggtttttgccatt cttttaat gc    a aaa  g a  t ctttt caccaa ctaa
+  humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GTA-ATGCTTTTACACCAATCTAA 302466
+                                       899******************************************955533.443..334.4689***********99986 PP
+
+>> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to      mod len      acc
+   ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
+ !   29.6   8.3   7.8e-08         1        43 [.    174456    174498 ..    174456    174518 ..        80    0.92
+
+  Alignment:
+  score: 29.6 bits
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1      1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43    
+                                       ttaggtt gtgcaaaagtaattg ggtttttg cattactttt
+  humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498
+                                       589************************************9975 PP
+
+>> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to      mod len      acc
+   ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
+ !   28.9   6.0   1.2e-07         1        77 [.    302466    302390 ..    302466    302387 ..        80    0.74
+
+  Alignment:
+  score: 28.9 bits
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1      1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77    
+                                       ttag ttggtg aaaag                cattactttt                aatggcaaaaacc caatt  ttttgcacc acc
+  humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390
+                                       68999999999999998................5666777776222222222222222268****************************9998 PP
+
+>> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to      mod len      acc
+   ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
+ !   23.3   7.0   7.2e-06        43        80 .]    174493    174456 ..    174513    174456 ..        80    0.91
+
+  Alignment:
+  score: 23.3 bits
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1     43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80    
+                                       taatg caaaaacc caattacttttgcac aacctaa
+  humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456
+                                       689********************************985 PP
+
+>> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to      mod len      acc
+   ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
+ ?    6.3   7.0       1.4        41        72 ..    304073    304104 ..    304053    304109 ..        80    0.85
+
+  Alignment:
+  score: 6.3 bits
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1     41 tttaatggcaaaaaccgcaattacttttgcac 72    
+                                       tt a tgg aaaaa   ca tta ttttgca 
+  humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCAT 304104
+                                       455779************************86 PP
+
+
+
+Internal pipeline statistics summary:
+-------------------------------------
+Query sequence(s):                         1  (660000 residues searched)
+Target model(s):                           1  (80 nodes)
+Residues passing SSV filter:             61794  (0.0936); expected (0.02)
+Residues passing bias filter:            46199  (0.07); expected (0.02)
+Residues passing Vit filter:              2752  (0.00417); expected (0.001)
+Residues passing Fwd filter:              2526  (0.00383); expected (1e-05)
+Total number of hits:                        5  (0.000405)
+# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02
+# Mc/sec: 2640.00
+//
+[ok]
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/MADE1.nhmmscan_out.aliscoresout	Sat Apr 07 03:52:10 2018 -0400
@@ -0,0 +1,17 @@
+# target name        accession   query name                    accession  hmmfrom hmm to alifrom  ali to envfrom  env to  modlen strand   E-value  score  bias  description of target
+#-------------------  ----------          -------------------- ---------- ------- ------- ------- ------- ------- ------- ------- ------ --------- ------ ----- ---------------------
+MADE1                DF0000629.2 humanchr1/239220001-239550000 -                4      80  302390  302466  302387  302466      80    +     1.2e-10   38.6   7.4  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                DF0000629.2 humanchr1/239220001-239550000 -                1      43  174456  174498  174456  174518      80    +     7.8e-08   29.6   8.3  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                DF0000629.2 humanchr1/239220001-239550000 -                1      77  302466  302390  302466  302387      80    -     1.2e-07   28.9   6.0  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                DF0000629.2 humanchr1/239220001-239550000 -               43      80  174493  174456  174513  174456      80    -     7.2e-06   23.3   7.0  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                DF0000629.2 humanchr1/239220001-239550000 -               41      72  304073  304104  304053  304109      80    +         1.4    6.3   7.0  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+#
+# Program:         hmmscan
+# Version:         3.1b2 (February 2015)
+# Pipeline mode:   SCAN
+# Query file:      /tmp/tmpc_c3amjg/files/000/dataset_2.dat
+# Target file:     /tmp/tmpc_c3amjg/files/000/dataset_1.dat
+# Option settings: nhmmscan --tblout /tmp/tmpc_c3amjg/files/000/dataset_4.dat --dfamtblout /tmp/tmpc_c3amjg/files/000/dataset_5.dat --notextw -E 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --B1 110 --B2 240 --B3 1000 --cpu 1 /tmp/tmpc_c3amjg/files/000/dataset_1.dat /tmp/tmpc_c3amjg/files/000/dataset_2.dat 
+# Current dir:     /tmp/tmpc_c3amjg/job_working_directory/000/3/working
+# Date:            Wed Apr  4 16:58:45 2018
+# [ok]
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/MADE1.nhmmscan_out.dfamtblout	Sat Apr 07 03:52:10 2018 -0400
@@ -0,0 +1,10 @@
+# hit scores
+# ----------
+#
+# target name         acc                  query name                      bits   e-value  bias  hmm-st  hmm-en strand  ali-st  ali-en  env-st  env-en  modlen   description of target
+# ------------------- -------------------  -------------------           ------ --------- ----- ------- ------- ------ ------- ------- ------- ------- -------   ---------------------
+MADE1                 DF0000629.2          humanchr1/239220001-239550000   38.6   1.2e-10   7.4       4      80    +    302390  302466  302387  302466      80   MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                 DF0000629.2          humanchr1/239220001-239550000   29.6   7.8e-08   8.3       1      43    +    174456  174498  174456  174518      80   MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                 DF0000629.2          humanchr1/239220001-239550000   28.9   1.2e-07   6.0       1      77    -    302466  302390  302466  302387      80   MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                 DF0000629.2          humanchr1/239220001-239550000   23.3   7.2e-06   7.0      43      80    -    174493  174456  174513  174456      80   MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                 DF0000629.2          humanchr1/239220001-239550000    6.3       1.4   7.0      41      72    +    304073  304104  304053  304109      80   MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/MADE1.nhmmscan_out.tblout	Sat Apr 07 03:52:10 2018 -0400
@@ -0,0 +1,17 @@
+# target name        accession   query name                    accession  hmmfrom hmm to alifrom  ali to envfrom  env to  modlen strand   E-value  score  bias  description of target
+#-------------------  ----------          -------------------- ---------- ------- ------- ------- ------- ------- ------- ------- ------ --------- ------ ----- ---------------------
+MADE1                DF0000629.2 humanchr1/239220001-239550000 -                4      80  302390  302466  302387  302466      80    +     1.2e-10   38.6   7.4  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                DF0000629.2 humanchr1/239220001-239550000 -                1      43  174456  174498  174456  174518      80    +     7.8e-08   29.6   8.3  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                DF0000629.2 humanchr1/239220001-239550000 -                1      77  302466  302390  302466  302387      80    -     1.2e-07   28.9   6.0  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                DF0000629.2 humanchr1/239220001-239550000 -               43      80  174493  174456  174513  174456      80    -     7.2e-06   23.3   7.0  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                DF0000629.2 humanchr1/239220001-239550000 -               41      72  304073  304104  304053  304109      80    +         1.4    6.3   7.0  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+#
+# Program:         hmmscan
+# Version:         3.1b2 (February 2015)
+# Pipeline mode:   SCAN
+# Query file:      /tmp/tmpc_c3amjg/files/000/dataset_2.dat
+# Target file:     /tmp/tmpc_c3amjg/files/000/dataset_1.dat
+# Option settings: nhmmscan --tblout /tmp/tmpc_c3amjg/files/000/dataset_4.dat --dfamtblout /tmp/tmpc_c3amjg/files/000/dataset_5.dat --notextw -E 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --B1 110 --B2 240 --B3 1000 --cpu 1 /tmp/tmpc_c3amjg/files/000/dataset_1.dat /tmp/tmpc_c3amjg/files/000/dataset_2.dat 
+# Current dir:     /tmp/tmpc_c3amjg/job_working_directory/000/3/working
+# Date:            Wed Apr  4 16:58:45 2018
+# [ok]
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/nhmmer.out.dfamtblout	Sat Apr 07 03:52:10 2018 -0400
@@ -0,0 +1,17 @@
+# target name                 accession  query name           accession   hmmfrom hmm to alifrom  ali to envfrom  env to  sq len strand   E-value  score  bias  description of target
+#         ------------------- ---------- --------------------  ---------- ------- ------- ------- ------- ------- ------- ------- ------ --------- ------ ----- ---------------------
+humanchr1/239220001-239550000 -          MADE1                DF0000629.2       4      80  302390  302466  302387  302466  330000    +     1.2e-10   38.6   7.4  -
+humanchr1/239220001-239550000 -          MADE1                DF0000629.2       1      43  174456  174498  174456  174518  330000    +     7.8e-08   29.6   8.3  -
+humanchr1/239220001-239550000 -          MADE1                DF0000629.2       1      77  302466  302390  302466  302387  330000    -     1.2e-07   28.9   6.0  -
+humanchr1/239220001-239550000 -          MADE1                DF0000629.2      43      80  174493  174456  174513  174456  330000    -     7.2e-06   23.3   7.0  -
+humanchr1/239220001-239550000 -          MADE1                DF0000629.2      41      72  304073  304104  304053  304109  330000    +         1.4    6.3   7.0  -
+#
+# Program:         nhmmer
+# Version:         3.1b2 (February 2015)
+# Pipeline mode:   SEARCH
+# Query file:      /tmp/tmpnpsbd_6p/files/000/dataset_1.dat
+# Target file:     /tmp/tmpnpsbd_6p/files/000/dataset_2.dat
+# Option settings: nhmmer --tblout /tmp/tmpnpsbd_6p/files/000/dataset_4.dat --dfamtblout None --notextw -E 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --dna --seed 4 --cpu 1 /tmp/tmpnpsbd_6p/files/000/dataset_1.dat /tmp/tmpnpsbd_6p/files/000/dataset_2.dat 
+# Current dir:     /tmp/tmpnpsbd_6p/job_working_directory/000/3/working
+# Date:            Fri Apr  6 16:39:46 2018
+# [ok]
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/nhmmer.out.tblout	Sat Apr 07 03:52:10 2018 -0400
@@ -0,0 +1,17 @@
+# target name                 accession  query name           accession   hmmfrom hmm to alifrom  ali to envfrom  env to  sq len strand   E-value  score  bias  description of target
+#         ------------------- ---------- --------------------  ---------- ------- ------- ------- ------- ------- ------- ------- ------ --------- ------ ----- ---------------------
+humanchr1/239220001-239550000 -          MADE1                DF0000629.2       4      80  302390  302466  302387  302466  330000    +     1.2e-10   38.6   7.4  -
+humanchr1/239220001-239550000 -          MADE1                DF0000629.2       1      43  174456  174498  174456  174518  330000    +     7.8e-08   29.6   8.3  -
+humanchr1/239220001-239550000 -          MADE1                DF0000629.2       1      77  302466  302390  302466  302387  330000    -     1.2e-07   28.9   6.0  -
+humanchr1/239220001-239550000 -          MADE1                DF0000629.2      43      80  174493  174456  174513  174456  330000    -     7.2e-06   23.3   7.0  -
+humanchr1/239220001-239550000 -          MADE1                DF0000629.2      41      72  304073  304104  304053  304109  330000    +         1.4    6.3   7.0  -
+#
+# Program:         nhmmer
+# Version:         3.1b2 (February 2015)
+# Pipeline mode:   SEARCH
+# Query file:      /tmp/tmpnpsbd_6p/files/000/dataset_1.dat
+# Target file:     /tmp/tmpnpsbd_6p/files/000/dataset_2.dat
+# Option settings: nhmmer --tblout /tmp/tmpnpsbd_6p/files/000/dataset_4.dat --dfamtblout None --notextw -E 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --dna --seed 4 --cpu 1 /tmp/tmpnpsbd_6p/files/000/dataset_1.dat /tmp/tmpnpsbd_6p/files/000/dataset_2.dat 
+# Current dir:     /tmp/tmpnpsbd_6p/job_working_directory/000/3/working
+# Date:            Fri Apr  6 16:39:46 2018
+# [ok]