Mercurial > repos > iuc > hmmer_hmmsearch

comparison test-data/nhmmer.out @ 5:b774ae8e1609 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
author iuc
date Tue, 16 Jun 2020 05:27:07 -0400
parents 6867ed975e25
children d753d9169482
comparison
equal deleted inserted replaced
4:6867ed975e25 5:b774ae8e1609
1 # nhmmer :: search a DNA model, alignment, or sequence against a DNA database 1 # nhmmer :: search a DNA model, alignment, or sequence against a DNA database
2 # HMMER 3.2 (June 2018); http://hmmer.org/ 2 # HMMER 3.3 (Nov 2019); http://hmmer.org/
3 # Copyright (C) 2018 Howard Hughes Medical Institute. 3 # Copyright (C) 2019 Howard Hughes Medical Institute.
4 # Freely distributed under the BSD open source license. 4 # Freely distributed under the BSD open source license.
5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
6 # query file: /tmp/tmpp4O0Ju/files/000/dataset_36.dat 6 # query file: /tmp/tmpqydies2m/files/c/4/e/dataset_c4e67f40-cb86-438e-8bc0-6020ada9fc86.dat
7 # target sequence database: /tmp/tmpp4O0Ju/files/000/dataset_37.dat 7 # target sequence database: /tmp/tmpqydies2m/files/a/1/b/dataset_a1b4364c-0e9a-4709-b4ef-ab7e5661d9e9.dat
8 # hits tabular output: /tmp/tmpp4O0Ju/files/000/dataset_39.dat 8 # hits tabular output: /tmp/tmpqydies2m/files/b/d/d/dataset_bdd87d82-1ce1-4051-8d5f-f7251bf7fd18.dat
9 # hits output in Dfam format: None 9 # hits output in Dfam format: /tmp/tmpqydies2m/files/d/8/e/dataset_d8ee0d50-d171-4e8a-9c7d-1cbd4394296f.dat
10 # alignment scores output: /tmp/tmpqydies2m/files/5/1/3/dataset_5139892f-c507-40c4-b43d-f73023c634f4.dat
10 # max ASCII text line length: unlimited 11 # max ASCII text line length: unlimited
11 # SSV filter P threshold: <= 0.02 12 # SSV filter P threshold: <= 0.02
12 # Vit filter P threshold: <= 0.001 13 # Vit filter P threshold: <= 0.001
13 # Fwd filter P threshold: <= 1e-05 14 # Fwd filter P threshold: <= 1e-05
14 # input query is asserted as: DNA 15 # input query is asserted as: DNA
20 Accession: DF0000629.2 21 Accession: DF0000629.2
21 Description: MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon 22 Description: MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
22 Scores for complete hits: 23 Scores for complete hits:
23 E-value score bias Sequence start end Description 24 E-value score bias Sequence start end Description
24 ------- ------ ----- -------- ----- ----- ----------- 25 ------- ------ ----- -------- ----- ----- -----------
25 8.7e-11 39.2 7.4 humanchr1/239220001-239550000 302390 302466 26 4e-11 41.3 7.5 humanchr1/239220001-239550000 302390 302466
26 6.4e-08 30.0 8.3 humanchr1/239220001-239550000 174456 174498 27 1.9e-08 32.8 8.3 humanchr1/239220001-239550000 174456 174498
27 9.3e-08 29.5 6.1 humanchr1/239220001-239550000 302466 302390 28 6.3e-08 31.0 6.7 humanchr1/239220001-239550000 302466 302389
28 6.3e-06 23.7 7.0 humanchr1/239220001-239550000 174493 174456 29 4.9e-06 25.0 7.0 humanchr1/239220001-239550000 174493 174456
29 ------ inclusion threshold ------ 30 ------ inclusion threshold ------
30 1.4 6.5 7.0 humanchr1/239220001-239550000 304073 304104 31 2.2 6.9 7.2 humanchr1/239220001-239550000 304073 304103
31 32
32 33
33 Annotation for each hit (and alignments): 34 Annotation for each hit (and alignments):
34 >> humanchr1/239220001-239550000 35 >> humanchr1/239220001-239550000
35 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc 36 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc
36 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- 37 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
37 ! 39.2 7.4 8.7e-11 4 80 .] 302390 302466 .. 302387 302466 .. 330000 0.87 38 ! 41.3 7.5 4e-11 4 80 .] 302390 302466 .. 302387 302466 .. 330000 0.88
38 39
39 Alignment: 40 Alignment:
40 score: 39.2 bits 41 score: 41.3 bits
41 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF 42 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
42 MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80 43 MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80
43 ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc a aaa g a t ctttt caccaa ctaa 44 ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc aaaa g a t ctttt caccaa ctaa
44 humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GT-AATGCTTTTACACCAATCTAA 302466 45 humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttAAAA---GT-AATGCTTTTACACCAATCTAA 302466
45 899******************************************955533.443..33.44689************9986 PP 46 89*******************************************966644554...34.4578**************997 PP
46 47
47 >> humanchr1/239220001-239550000 48 >> humanchr1/239220001-239550000
48 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc 49 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc
49 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- 50 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
50 ! 30.0 8.3 6.4e-08 1 43 [. 174456 174498 .. 174456 174518 .. 330000 0.92 51 ! 32.8 8.3 1.9e-08 1 43 [. 174456 174498 .. 174456 174518 .. 330000 0.91
51 52
52 Alignment: 53 Alignment:
53 score: 30.0 bits 54 score: 32.8 bits
54 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF 55 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
55 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 56 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43
56 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt 57 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt
57 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498 58 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498
58 589************************************9975 PP 59 589************************************9986 PP
59 60
60 >> humanchr1/239220001-239550000 61 >> humanchr1/239220001-239550000
61 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc 62 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc
62 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- 63 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
63 ! 29.5 6.1 9.3e-08 1 77 [. 302466 302390 .. 302466 302387 .. 330000 0.74 64 ! 31.0 6.7 6.3e-08 1 78 [. 302466 302389 .. 302466 302387 .. 330000 0.80
64 65
65 Alignment: 66 Alignment:
66 score: 29.5 bits 67 score: 31.0 bits
67 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF 68 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
68 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77 69 MADE1 1 ttaggttggtgcaaaagtaattgcggttttt....gccattacttttaatggcaaaaaccgcaattacttttgcaccaacct 78
69 ttag ttggtg aaaag cattactttt aatggcaaaaacc caatt ttttgcacc acc 70 ttag ttggtg aaaag a t tttt gc atta +aatggcaaaaacc caatt ttttgcacc acc
70 humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390 71 humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAGCATT-A---CTTTTaaaaGCAATTAAAAGCAATGGCAAAAACCACAATTGATTTTGCACCGACCA 302389
71 68999999999999998................4666777765222222222222222268****************************9998 PP 72 6899************97543.2...23333455566666666666799*****************************9985 PP
72 73
73 >> humanchr1/239220001-239550000 74 >> humanchr1/239220001-239550000
74 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc 75 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc
75 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- 76 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
76 ! 23.7 7.0 6.3e-06 43 80 .] 174493 174456 .. 174513 174456 .. 330000 0.91 77 ! 25.0 7.0 4.9e-06 43 80 .] 174493 174456 .. 174513 174456 .. 330000 0.94
77 78
78 Alignment: 79 Alignment:
79 score: 23.7 bits 80 score: 25.0 bits
80 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF 81 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
81 MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80 82 MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80
82 taatg caaaaacc caattacttttgcac aacctaa 83 taatg caaaaacc caattacttttgcac aacctaa
83 humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456 84 humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456
84 689********************************986 PP 85 5899*******************************986 PP
85 86
86 >> humanchr1/239220001-239550000 87 >> humanchr1/239220001-239550000
87 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc 88 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc
88 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- 89 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
89 ? 6.5 7.0 1.4 41 72 .. 304073 304104 .. 304053 304109 .. 330000 0.85 90 ? 6.9 7.2 2.2 41 71 .. 304073 304103 .. 304053 304109 .. 330000 0.85
90 91
91 Alignment: 92 Alignment:
92 score: 6.5 bits 93 score: 6.9 bits
93 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF 94 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
94 MADE1 41 tttaatggcaaaaaccgcaattacttttgcac 72 95 MADE1 41 tttaatggcaaaaaccgcaattacttttgca 71
95 tt a tgg aaaaa ca tta ttttgca 96 tt a tgg aaaaa ca tta ttttgca
96 humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCAT 304104 97 humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCA 304103
97 455779************************86 PP 98 456789************************8 PP
98 99
99 100
100 101
101 Internal pipeline statistics summary: 102 Internal pipeline statistics summary:
102 ------------------------------------- 103 -------------------------------------
103 Query model(s): 1 (80 nodes) 104 Query model(s): 1 (80 nodes)
104 Target sequences: 1 (660000 residues searched) 105 Target sequences: 1 (660000 residues searched)
105 Residues passing SSV filter: 63737 (0.0966); expected (0.02) 106 Residues passing SSV filter: 60770 (0.0921); expected (0.02)
106 Residues passing bias filter: 44695 (0.0677); expected (0.02) 107 Residues passing bias filter: 35792 (0.0542); expected (0.02)
107 Residues passing Vit filter: 2309 (0.0035); expected (0.001) 108 Residues passing Vit filter: 1612 (0.00244); expected (0.001)
108 Residues passing Fwd filter: 2041 (0.00309); expected (1e-05) 109 Residues passing Fwd filter: 1194 (0.00181); expected (1e-05)
109 Total number of hits: 5 (0.000405) 110 Total number of hits: 5 (0.000405)
110 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02 111 # CPU time: 0.04u 0.00s 00:00:00.04 Elapsed: 00:00:00.05
111 # Mc/sec: 1854.66 112 # Mc/sec: 1031.54
112 // 113 //
113 [ok] 114 [ok]