Mercurial > repos > iuc > idba_ud

changeset 3:1542a2fffe0c draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/idba_ud commit 9c0a7395ca18043ae2dd957f39f47b65c938750a
author iuc
date Thu, 21 Jul 2022 13:34:59 +0000
parents 694b0f55b744
children
files idba_ud.xml macros.xml test-data/out/scaffold.fa
diffstat 3 files changed, 12 insertions(+), 7 deletions(-) [+]
line wrap: on
line diff
--- a/idba_ud.xml	Tue Aug 04 05:50:30 2020 -0400
+++ b/idba_ud.xml	Thu Jul 21 13:34:59 2022 +0000
@@ -2,6 +2,7 @@
     <description>
         Iterative de Bruijn Graph Assembler for data with highly uneven depth
     </description>
+    <expand macro="bio_tools"/>
     <macros>
         <import>macros.xml</import>
     </macros>
@@ -59,7 +60,7 @@
                 <not_has_text text="--no_correct" />
                 <not_has_text text="--pre_correction" />
             </assert_command>
-            <output name="output" file="out/scaffold.fa" ftype="fasta"/>
+            <output name="output" file="out/scaffold.fa" ftype="fasta" compare="re_match"/>
         </test>
         <!-- read levels test -->
         <test>
@@ -74,7 +75,7 @@
                 <has_text text="--read_level_4" />
                 <has_text text="--read_level_5" />
             </assert_command>
-            <output name="output" file="out/scaffold.fa" ftype="fasta" lines_diff="2"/>
+            <output name="output" file="out/scaffold.fa" ftype="fasta" compare="re_match"/>
         </test>
         <!-- k-mer options -->
         <test>
@@ -99,7 +100,7 @@
                 <has_text text="--min_support 2" />
                 <has_text text="--seed_kmer 29" />
             </assert_command>
-            <output name="output" file="out/scaffold.fa" lines_diff="2"/>
+            <output name="output" file="out/scaffold.fa" compare="re_match"/>
         </test>
         <!-- filter options -->
         <test>
@@ -112,7 +113,7 @@
                 <has_text text="--similar 0.96" />
                 <has_text text="--max_mismatch 2" />
             </assert_command>
-            <output name="output" file="out/scaffold.fa" lines_diff="2"/>
+            <output name="output" file="out/scaffold.fa" compare="re_match"/>
         </test>
         <!-- min-pairs and other options -->
         <test>
@@ -127,7 +128,7 @@
                 <has_text text="--no_correct" />
                 <has_text text="--pre_correction" />
             </assert_command>
-            <output name="output" file="out/scaffold.fa" lines_diff="2"/>
+            <output name="output" file="out/scaffold.fa" compare="re_match"/>
         </test>
     </tests>
     <expand macro="help" more_help="IDBA-UD is an extension of IDBA algorithm for Short Reads Sequencing data with Highly Uneven Sequencing Depth. IDBA-UD also iterates from small k to a large k. In each iteration, short and low-depth contigs are removed iteratively with cutoff threshold from low to high to reduce the errors in low-depth and high-depth regions. Paired-end reads are aligned to contigs and assembled locally to generate some missing k-mers in low-depth regions. With these technologies, IDBA-UD can iterate k value of de Bruijn graph to a very large value with less gaps and less branches to form long contigs in both low-depth and high-depth regions."/>
--- a/macros.xml	Tue Aug 04 05:50:30 2020 -0400
+++ b/macros.xml	Thu Jul 21 13:34:59 2022 +0000
@@ -6,7 +6,11 @@
             <yield/>
         </requirements>
     </xml>
-
+    <xml name="bio_tools">
+        <xrefs>
+            <xref type="bio.tools">idba</xref>
+        </xrefs>
+    </xml>
     <xml name="main_input">
         <param argument="--read" type="data" format="fasta" label="Fasta read file. Lower or equal to 600b"/>
         <param argument="--long_read" type="data" format="fasta" optional="true" label="Fasta long read file. More than 600b"/>
--- a/test-data/out/scaffold.fa	Tue Aug 04 05:50:30 2020 -0400
+++ b/test-data/out/scaffold.fa	Thu Jul 21 13:34:59 2022 +0000
@@ -1,2 +1,2 @@
 >scaffold_0
-GAAAAACGCGCTTGCAGATGGGTCGCAGGTTACTTCCTTGCGCACAGGATATAGTTATACCAGCGTTATTGTCGTTAGTGGTGAGTCGTCGGTATATCTGAATGGAGATACGACAATCAGCGGAGAATTCCCTCTGGGGTTTGCCGGGGTTATTCGGGTACAGGATAAAGCTTTGCTGGAAATTGGCAGTGGCGCTACGCTAACAATGCAGGATATTGACAGTTTTGAACATCATGGGACAAGAACCCTGGATTTGCCCCTATATTTCCAGACATCTGTTATCACTTAACCCATTACAAGCCCGCTGCCGCAGATATTCCCGTGGCGAGCGATAACCCAGCGCACTATGCGGATGCCATTCGTTATAATGCTCGAACGCCTCTGCAAGGTTCTTTGCTGCCGTTAACCCGTCTGGTTTGGGCATGATACTGATGTAGTCACGCTTTATCGTTTTCACGAAGCTCTCTGCTATTCCGTTACTCTCCGGACTCCGCACCGCCGTGTTCTTCGGTTCAAGTCCCAACATCCGGGCGAACTGGCGTGTTTCATTAGCCCGGTAGCATGAACCATTATCCGTCAGCCACTCCACTGGAGACGACGGAAGATCGTTGCCGAAGCGGCGTTCCACCGCTCCCAGCATGACGTCCTGTACTGTTTCACTGTTGAAGCCGCCGGTAGTGACCGCCCAGTGCAGTGCCTCACGATCACAGCAGTCCAGCGCGAACGTGACACGCAGTCTCTCTCCGTTA
+[ATCG]+
\ No newline at end of file