Mercurial > repos > iuc > maker
changeset 0:16e44ec438c4 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/maker commit 2896dcfd180800d00ea413a59264ef8b11788b8e
| author | iuc |
|---|---|
| date | Thu, 19 Oct 2017 15:58:39 -0400 |
| parents | |
| children | 73a79dec987b |
| files | macros.xml maker.xml test-data/annot.gff3 test-data/annot_human.gff3 test-data/annot_mapped.gff3 test-data/annot_model.gff3 test-data/annot_norm.gff3 test-data/annot_proc.gff3 test-data/annot_reuse.gff3 test-data/est.fasta test-data/evidences.gff3 test-data/evidences_human.gff3 test-data/evidences_model.gff3 test-data/evidences_norm.gff3 test-data/evidences_proc.gff3 test-data/evidences_reuse.gff3 test-data/genome.fasta test-data/id_map.tsv test-data/local.tar.gz test-data/snap.hmm |
| diffstat | 20 files changed, 2924 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Thu Oct 19 15:58:39 2017 -0400 @@ -0,0 +1,17 @@ +<?xml version="1.0"?> +<macros> + <xml name="requirements"> + <requirements> + <requirement type="package" version="@VERSION@">maker</requirement> + <yield /> + </requirements> + </xml> + <token name="@VERSION@">2.31.9</token> + + <xml name="citations"> + <citations> + <citation type="doi">10.1002/0471250953.bi0411s48</citation> + </citations> + </xml> + +</macros>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/maker.xml Thu Oct 19 15:58:39 2017 -0400 @@ -0,0 +1,486 @@ +<?xml version="1.0"?> +<tool id="maker" name="Maker" profile="16.04" version="@VERSION@"> + <description>genome annotation pipeline</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <command><![CDATA[ + maker -CTL + + && + + sed "s/cpus=/cpus=\${GALAXY_SLOTS:-4}/g" '$ctl' > maker_opts.ctl + + && + + #if $abinitio_gene_prediction.aug_prediction.augustus_mode == 'history' + + ## Using an augustus model from history, we need to unzip it and let augustus find it + + cp -r "\$AUGUSTUS_CONFIG_PATH/" augustus_dir/ && + + mkdir -p 'augustus_dir/species/' && + + tar -C 'augustus_dir/species/' -xzvf '${abinitio_gene_prediction.aug_prediction.augustus_model}' > /dev/null && + + export AUGUSTUS_CONFIG_PATH=`pwd`/augustus_dir/ && + #end if + + maker maker_opts.ctl maker_bopts.ctl maker_exe.ctl + + && + + gff3_merge -d *.maker.output/*_master_datastore_index.log -o '${output_full}' + + && + + awk '{if ($2 == "maker" || $1 ~ /^\#/) {print}}' '${output_full}' | sed -n '/^\#\#FASTA\$/q;p' > '${output_gff}' + + && + + awk '{if ($2 != "maker") {print}}' '${output_full}' | sed -n '/^\#\#FASTA\$/q;p' > '${output_evidences}' + ]]></command> + <configfiles> + <!-- Maker doesn't like indentation in its config file... --> + <configfile name="ctl"><![CDATA[ +#-----Genome (these are always required) +genome=${genome} # genome sequence (fasta file or fasta embeded in GFF3 file) +organism_type=${organism_type} # eukaryotic or prokaryotic. Default is eukaryotic + +#-----Re-annotation Using MAKER Derived GFF3 +#if $reannotation.reannotate == 'no' +maker_gff= # MAKER derived GFF3 file +est_pass=0 # use ESTs in maker_gff: 1 = yes, 0 = no +altest_pass=0 # use alternate organism ESTs in maker_gff: 1 = yes, 0 = no +protein_pass=0 # use protein alignments in maker_gff: 1 = yes, 0 = no +rm_pass=0 # use repeats in maker_gff: 1 = yes, 0 = no +model_pass=0 # use gene models in maker_gff: 1 = yes, 0 = no +pred_pass=0 # use ab-initio predictions in maker_gff: 1 = yes, 0 = no +other_pass=0 # passthrough anything else in maker_gff: 1 = yes, 0 = no +#else +maker_gff=${reannotation.maker_gff} # MAKER derived GFF3 file +est_pass=${reannotation.est_pass} # use ESTs in maker_gff: 1 = yes, 0 = no +altest_pass=${reannotation.altest_pass} # use alternate organism ESTs in maker_gff: 1 = yes, 0 = no +protein_pass=${reannotation.protein_pass} # use protein alignments in maker_gff: 1 = yes, 0 = no +rm_pass=${reannotation.rm_pass} # use repeats in maker_gff: 1 = yes, 0 = no +model_pass=${reannotation.model_pass} # use gene models in maker_gff: 1 = yes, 0 = no +pred_pass=${reannotation.pred_pass} # use ab-initio predictions in maker_gff: 1 = yes, 0 = no +other_pass=${reannotation.other_pass} # passthrough anything else in maker_gff: 1 = yes, 0 = no +#end if + +#-----EST Evidence (for best results provide a file for at least one) +#if $est_evidences.est +est=${est_evidences.est} # set of ESTs or assembled mRNA-seq in fasta format +#else +est= # set of ESTs or assembled mRNA-seq in fasta format +#end if +#if $est_evidences.altest +altest=${est_evidences.altest} # EST/cDNA sequence file in fasta format from an alternate organism +#else +altest= # EST/cDNA sequence file in fasta format from an alternate organism +#end if +#if $est_evidences.est_gff +est_gff=${est_evidences.est_gff} # aligned ESTs or mRNA-seq from an external GFF3 file +#else +est_gff= # aligned ESTs or mRNA-seq from an external GFF3 file +#end if +#if $est_evidences.altest_gff +altest_gff=${est_evidences.altest_gff} # aligned ESTs from a closly relate species in GFF3 format +#else +altest_gff= # aligned ESTs from a closly relate species in GFF3 format +#end if + +#-----Protein Homology Evidence (for best results provide a file for at least one) +#if $protein_evidences.protein +protein=${protein_evidences.protein} # protein sequence file in fasta format (i.e. from mutiple oransisms) +#else +protein= # protein sequence file in fasta format (i.e. from mutiple oransisms) +#end if +#if $protein_evidences.protein_gff +protein_gff=${protein_evidences.protein_gff} # aligned protein homology evidence from an external GFF3 file +#else +protein_gff= # aligned protein homology evidence from an external GFF3 file +#end if + +#-----Repeat Masking (leave values blank to skip repeat masking) +#if $repeat_masking.repeatmasker.do_rm == 'simple' +model_org=simple # select a model organism for RepBase masking in RepeatMasker +rmlib= # provide an organism specific repeat library in fasta format for RepeatMasker +#else if $repeat_masking.repeatmasker.do_rm == 'lib' +model_org= # select a model organism for RepBase masking in RepeatMasker +rmlib=${repeat_masking.repeatmasker.rmlib} # provide an organism specific repeat library in fasta format for RepeatMasker +#else +model_org= # select a model organism for RepBase masking in RepeatMasker +rmlib= # provide an organism specific repeat library in fasta format for RepeatMasker +#end if +#if $repeat_masking.repeat_protein +repeat_protein=${repeat_masking.repeat_protein} # provide a fasta file of transposable element proteins for RepeatRunner +#else +repeat_protein= # provide a fasta file of transposable element proteins for RepeatRunner +#end if +#if $repeat_masking.rm_gff +rm_gff=${repeat_masking.rm_gff} # pre-identified repeat elements from an external GFF3 file +#else +rm_gff= # pre-identified repeat elements from an external GFF3 file +#end if +prok_rm=0 # forces MAKER to repeatmask prokaryotes (no reason to change this), 1 = yes, 0 = no +softmask=${repeat_masking.softmask} # use soft-masking rather than hard-masking in BLAST (i.e. seg and dust filtering) + +#-----Gene Prediction +#if $abinitio_gene_prediction.snaphmm +snaphmm=${abinitio_gene_prediction.snaphmm} # SNAP HMM file +#else +snaphmm= # SNAP HMM file +#end if +gmhmm= # GeneMark HMM file, disabled in galaxy as not free +#if $abinitio_gene_prediction.aug_prediction.augustus_mode == 'builtin' +augustus_species=${abinitio_gene_prediction.aug_prediction.augustus_species} # Augustus gene prediction species model +#else if $abinitio_gene_prediction.aug_prediction.augustus_mode == 'history' +augustus_species=local # Augustus gene prediction species model +#else +augustus_species= # Augustus gene prediction species model +#end if +fgenesh_par_file= # FGENESH parameter file disabled in galaxy as not free +#if $gene_prediction.pred_gff +pred_gff=${gene_prediction.pred_gff} # ab-initio predictions from an external GFF3 file +#else +pred_gff= # ab-initio predictions from an external GFF3 file +#end if +#if $gene_prediction.model_gff +model_gff=${gene_prediction.model_gff} # annotated gene models from an external GFF3 file (annotation pass-through) +#else +model_gff= # annotated gene models from an external GFF3 file (annotation pass-through) +#end if +est2genome=${est_evidences.est2genome} # infer gene predictions directly from ESTs, 1 = yes, 0 = no +protein2genome=${protein_evidences.protein2genome} # infer predictions from protein homology, 1 = yes, 0 = no +trna=${gene_prediction.trna} # find tRNAs with tRNAscan, 1 = yes, 0 = no +#if $gene_prediction.snoscan_rrna +snoscan_rrna=${gene_prediction.snoscan_rrna} # rRNA file to have Snoscan find snoRNAs +#else +snoscan_rrna= # rRNA file to have Snoscan find snoRNAs +#end if +unmask=${abinitio_gene_prediction.unmask} # also run ab-initio prediction programs on unmasked sequence, 1 = yes, 0 = no + +#-----Other Annotation Feature Types (features MAKER doesn't recognize) +#if $advanced.other_gff +other_gff=${advanced.other_gff} # extra features to pass-through to final MAKER generated GFF3 file +#else +other_gff= # extra features to pass-through to final MAKER generated GFF3 file +#end if + +#-----External Application Behavior Options +alt_peptide=${advanced.alt_peptide} # amino acid used to replace non-standard amino acids in BLAST databases +cpus= # max number of cpus to use in BLAST and RepeatMasker (not for MPI, leave 1 when using MPI) + +#-----MAKER Behavior Options +max_dna_len=${advanced.max_dna_len} # length for dividing up contigs into chunks (increases/decreases memory usage) +min_contig=${advanced.min_contig} # skip genome contigs below this length (under 10kb are often useless) + +pred_flank=${advanced.pred_flank} # flank for extending evidence clusters sent to gene predictors +pred_stats=${advanced.pred_stats} # report AED and QI statistics for all predictions as well as models +AED_threshold=${advanced.AED_threshold} # Maximum Annotation Edit Distance allowed (bound by 0 and 1) +min_protein=${advanced.min_protein} # require at least this many amino acids in predicted proteins +alt_splice=${advanced.alt_splice} # Take extra steps to try and find alternative splicing, 1 = yes, 0 = no +always_complete=${advanced.always_complete} # extra steps to force start and stop codons, 1 = yes, 0 = no +map_forward=${advanced.map_forward} # map names and attributes forward from old GFF3 genes, 1 = yes, 0 = no +keep_preds=${advanced.keep_preds} # Concordance threshold to add unsupported gene prediction (bound by 0 and 1) + +split_hit=${advanced.split_hit} # length for the splitting of hits (expected max intron size for evidence alignments) +single_exon=${advanced.single_exon.single_exon} # consider single exon EST evidence when generating annotations, 1 = yes, 0 = no +#if $advanced.single_exon.single_exon == '1' +single_length=${advanced.single_length} # min length required for single exon ESTs if 'single_exon is enabled' +#else +single_length=250 # min length required for single exon ESTs if 'single_exon is enabled' +#end if +correct_est_fusion=${advanced.correct_est_fusion} # limits use of ESTs in annotation to avoid fusion genes + +tries=2 # number of times to try a contig if there is a failure for some reason +clean_try=0 # remove all data from previous run before retrying, 1 = yes, 0 = no +clean_up=0 # removes theVoid directory with individual analysis files, 1 = yes, 0 = no +TMP= # specify a directory other than the system default temporary directory for temporary files + ]]></configfile> + </configfiles> + + <inputs> + <param name="genome" type="data" format="fasta" label="Genome to annotate"/> + <param name="organism_type" type="select" label="Organism type"> + <option value="eukaryotic">Eukaryotic</option> + <option value="prokaryotic">Prokaryotic</option> + </param> + + <conditional name="reannotation"> + <param name="reannotate" type="select" label="Re-annotate using an existing Maker annotation"> + <option value="no" selected="true">No</option> + <option value="yes">Yes</option> + </param> + <when value="no"/> + <when value="yes"> + <param name="maker_gff" type="data" format="gff" label="Previous Maker annotation"/> + <param name="est_pass" type="boolean" truevalue="1" falsevalue="0" label="Re-use ESTs"/> + <param name="altest_pass" type="boolean" truevalue="1" falsevalue="0" label="Re-use alternate organism ESTs"/> + <param name="protein_pass" type="boolean" truevalue="1" falsevalue="0" label="Re-use protein alignments"/> + <param name="rm_pass" type="boolean" truevalue="1" falsevalue="0" label="Re-use repeats"/> + <param name="model_pass" type="boolean" truevalue="1" falsevalue="0" label="Re-use gene models"/> + <param name="pred_pass" type="boolean" truevalue="1" falsevalue="0" label="Re-use ab-initio predictions"/> + <param name="other_pass" type="boolean" truevalue="1" falsevalue="0" label="Passthrough anything else"/> + </when> + </conditional> + + <section name="est_evidences" title="EST evidences (for best results provide at least one of these)" expanded="True"> + <param name="est2genome" type="boolean" truevalue="1" falsevalue="0" checked="false" label="Infer gene predictions directly from all ESTs" help="Maker will blindly trust EST alignments to create gene models. Use this only before training ab-initio predictors."/> + <param name="est" type="data" format="fasta" label="ESTs or assembled cDNA" optional="True"/> + <param name="altest" type="data" format="fasta" label="EST/cDNA from an alternate organism" optional="True"/> + <param name="est_gff" type="data" format="gff" label="Aligned ESTs or cDNA" optional="True"/> + <param name="altest_gff" type="data" format="gff" label="Aligned EST/cDNA from an alternate organism" optional="True"/> + </section> + + <section name="protein_evidences" title="Protein evidences (for best results provide at least one of these)" expanded="True"> + <param name="protein2genome" type="boolean" truevalue="1" falsevalue="0" checked="false" label="Infer gene predictions directly from all protein alignments" help="Maker will blindly trust protein alignments to create gene models. Use this only before training ab-initio predictors."/> + <param name="protein" type="data" format="fasta" label="Protein sequences" help="From mutiple organisms" optional="True"/> + <param name="protein_gff" type="data" format="gff" label="Aligned proteins" help="From mutiple organisms" optional="True"/> + </section> + + <section name="abinitio_gene_prediction" title="Ab-initio gene prediction" expanded="True"> + <param name="snaphmm" type="data" format="snaphmm" label="SNAP model" optional="True" help="Leave empty to disable gene prediction by SNAP"/> + + <conditional name="aug_prediction"> + <param name="augustus_mode" type="select" label="Prediction with Augustus"> + <option value="no" selected="true">Don't use Augustus to predict genes</option> + <option value="builtin">Run Augustus with a predefined prediction model</option> + <option value="history">Run Augustus with a custom prediction model</option> + </param> + <when value="no"/> + <when value="history"> + <param name="augustus_model" type="data" format="augustus" label="Augustus model"/> + </when> + <when value="builtin"> + <param name="augustus_species" type="select" label="Augustus species model"> + <!-- If you update this list, please also update it in augustus and busco tools (../augustus/augustus.xml and ../busco/busco.xml) --> + <option value="human">Homo sapiens</option> + <option value="fly">Drosophila melanogaster</option> + <option value="arabidopsis">Arabidopsis thaliana</option> + <option value="brugia ">Brugia malayi</option> + <option value="aedes">Aedes aegypti</option> + <option value="tribolium2012">Tribolium castaneum</option> + <option value="schistosoma">Schistosoma mansoni</option> + <option value="tetrahymena">Tetrahymena thermophila</option> + <option value="galdieria">Galdieria sulphuraria</option> + <option value="maize">Zea mays</option> + <option value="toxoplasma">Toxoplasma gondii</option> + <option value="caenorhabditis ">Caenorhabditis elegans</option> + <option value="aspergillus_fumigatus">Aspergillus fumigatus</option> + <option value="aspergillus_nidulans ">Aspergillus nidulans</option> + <option value="aspergillus_oryzae ">Aspergillus oryzae</option> + <option value="aspergillus_terreus">Aspergillus terreus</option> + <option value="botrytis_cinerea ">Botrytis cinerea</option> + <option value="candida_albicans ">Candida albicans</option> + <option value="candida_guilliermondii ">Candida guilliermondii</option> + <option value="candida_tropicalis ">Candida tropicalis</option> + <option value="chaetomium_globosum">Chaetomium globosum</option> + <option value="coccidioides_immitis">Coccidioides immitis</option> + <option value="coprinus">Coprinus cinereus</option> + <option value="coprinus_cinereus">Coprinus cinereus</option> + <option value="cryptococcus_neoformans_gattii">Cryptococcus neoformans gattii</option> + <option value="cryptococcus_neoformans_neoformans_B">Cryptococcus neoformans neoformans</option> + <option value="cryptococcus_neoformans_neoformans_JEC21">Cryptococcus neoformans neoformans</option> + <option value="cryptococcus">Cryptococcus neoformans</option> + <option value="debaryomyces_hansenii">Debaryomyces hansenii</option> + <option value="encephalitozoon_cuniculi_GB">Encephalitozoon cuniculi</option> + <option value="eremothecium_gossypii">Eremothecium gossypii</option> + <option value="fusarium_graminearum ">Fusarium graminearum</option> + <option value="histoplasma_capsulatum ">Histoplasma capsulatum</option> + <option value="histoplasma">Histoplasma capsulatum</option> + <option value="kluyveromyces_lactis ">Kluyveromyces lactis</option> + <option value="laccaria_bicolor ">Laccaria bicolor</option> + <option value="lamprey">Petromyzon marinus</option> + <option value="leishmania_tarentolae">Leishmania tarentolae</option> + <option value="lodderomyces_elongisporus">Lodderomyces elongisporus</option> + <option value="magnaporthe_grisea ">Magnaporthe grisea</option> + <option value="neurospora_crassa">Neurospora crassa</option> + <option value="phanerochaete_chrysosporium">Phanerochaete chrysosporium</option> + <option value="pichia_stipitis">Pichia stipitis</option> + <option value="rhizopus_oryzae">Rhizopus oryzae</option> + <option value="saccharomyces_cerevisiae_S288C">Saccharomyces cerevisiae</option> + <option value="saccharomyces_cerevisiae_rm11-1a_1">Saccharomyces cerevisiae</option> + <option value="saccharomyces">Saccharomyces cerevisiae</option> + <option value="schizosaccharomyces_pombe">Schizosaccharomyces pombe</option> + <option value="trichinella">Trichinella spiralis</option> + <option value="ustilago_maydis">Ustilago maydis</option> + <option value="yarrowia_lipolytica">Yarrowia lipolytica</option> + <option value="nasonia">Nasonia vitripennis</option> + <option value="tomato">Solanum lycopersicum</option> + <option value="chlamydomonas">Chlamydomonas reinhardtii</option> + <option value="amphimedon">Amphimedon queenslandica</option> + <option value="pneumocystis">Pneumocystis jirovecii</option> + <option value="chicken">Gallus gallus domesticus (chicken)</option> + <option value="cacao">Theobroma cacao (cacao)</option> + <option value="heliconius_melpomene1">Heliconius melpomene</option> + <option value="xenoturbella">Xenoturbella</option> + <option value="E_coli_K12">E coli K12</option> + <option value="c_elegans_trsk">c elegans trsk</option> + <option value="camponotus_floridanus">Camponotus floridanus</option> + <option value="coyote_tobacco">Coyote tobacco</option> + <option value="s_aureus">Staphylococcus aureus</option> + <option value="thermoanaerobacter_tengcongensis">Thermoanaerobacter tengcongensis</option> + <option value="wheat">wheat</option> + <option value="zebrafish">Danio rerio</option> + <option value="anidulans">Aspergillus nidulans</option> + <option value="bombus_impatiens1">Bombus impatiens1</option> + <option value="bombus_terrestris2">Bombus terrestris2</option> + <option value="botrytis_cinerea">Botrytis cinerea</option> + <option value="brugia_malayi">Brugia malayi</option> + <option value="conidiobolus_coronatus">Conidiobolus coronatus</option> + <option value="cryptococcus_neoformans">Cryptococcus neoformans</option> + <option value="culex_pipiens">Culex pipiens</option> + <option value="elephant_shark">Callorhinchus milii</option> + <option value="honeybee1">Apis mellifera</option> + <option value="phanerochaete_chrysosporium">Phanerochaete chrysosporium</option> + <option value="pea_aphid">Acyrthosiphon pisum</option> + <option value="rhodnius_prolixus">Rhodnius prolixus</option> + <option value="ustilago_maydis">Ustilago maydis</option> + <option value="verticillium_albo_atrum1">Verticillium albo atrum1</option> + <option value="verticillium_longisporum1">Verticillium longisporum1</option> + <option value="Xipophorus_maculatus">Xipophorus_maculatus</option> + <option value="adorsata">adorsata</option> + <option value="ancylostoma_ceylanicum">ancylostoma_ceylanicum</option> + <option value="maker2_athal1">maker2_athal1</option> + <option value="maker2_c_elegans1">maker2_c_elegans1</option> + <option value="maker2_dmel1">maker2_dmel1</option> + <option value="maker2_spomb1">maker2_spomb1</option> + <option value="parasteatoda">parasteatoda</option> + <option value="rice">rice</option> + <option value="schistosoma2">schistosoma2</option> + <option value="sulfolobus_solfataricus">sulfolobus_solfataricus</option> + </param> + </when> + </conditional> + <param name="unmask" type="boolean" truevalue="1" falsevalue="0" checked="false" label="Run ab-initio prediction programs on unmasked sequence" help="Predictors will look for genes in repeated elements (like transposons). Only useful when you believe that transposons might have been integrated into a real gene structure (rare)."/> + </section> + + <section name="repeat_masking" title="Repeat masking" expanded="True"> + <conditional name="repeatmasker"> + <param name="do_rm" type="select" label="Enable repeat masking with RepeatMasker"> + <option value="no">No</option> + <option value="simple" selected="true">Yes, run RepeatMasker with default simple models</option> + <option value="lib">Yes, use an organism specific repeat library (fasta)</option> + </param> + <!-- full repbase cannot be redistributed (for licensing reasons, see https://hpc.nih.gov/apps/repbase_license.html), + using only the default maker base + model_org is ignored and replaced by 'simple' if the full RepBase is not available. + model_org=simple means maker will search using the simple models shipped by default + Installing RepBase requires to replace files in the RepeatMasker installation dir + --> + <when value="no"/> + <when value="simple"/> + <when value="lib"> + <param name="rmlib" type="data" format="fasta" label="Organism specific repeat library for RepeatMasker (fasta)"/> + </when> + </conditional> + <param name="repeat_protein" type="data" format="fasta" label="Transposable element protein sequences for RepeatRunner (fasta)" help="Leave empty to skip" optional="True"/> + <param name="rm_gff" type="data" format="gff" label="Pre-identified repeat elements from an external GFF file" help="Leave empty to skip" optional="True"/> + <param name="softmask" type="boolean" truevalue="1" falsevalue="0" checked="true" label="Use soft-masking rather than hard-masking in BLAST" help="i.e. seg and dust filtering"/> + </section> + + <section name="gene_prediction" title="Other predictions" expanded="True"> + <param name="pred_gff" type="data" format="gff" label="Predictions from an external GFF3 file" optional="True"/> + <param name="model_gff" type="data" format="gff" label="Annotated gene models an external GFF3 file" help="annotation pass-through" optional="True"/> + <param name="trna" type="boolean" truevalue="1" falsevalue="0" checked="false" label="Find tRNAs with tRNAscan"/> + <param name="snoscan_rrna" type="data" format="fasta" label="rRNA file to have Snoscan find snoRNAs" optional="True"/> + </section> + + <section name="advanced" title="Advanced settings" expanded="False"> + <param name="other_gff" type="data" format="gff" label="Extra features to pass-through to final Maker generated GFF3 file" optional="True"/> + <param name="alt_peptide" type="text" value="C" size="1" label="Amino acid used to replace non-standard amino acids in BLAST databases"> + <validator type="regex" message="This must be a single uppercase letter">^[A-Z]$</validator> + </param> + <param name="max_dna_len" type="integer" value="100000" label="Length for dividing up contigs into chunks" help="Increases/decreases memory usage"/> + <param name="min_contig" type="integer" value="1" label="Skip genome contigs below this length" help="Under 10kb are often useless"/> + <param name="pred_flank" type="integer" value="200" label="Flank for extending evidence clusters sent to gene predictors"/> + <param name="pred_stats" type="boolean" truevalue="1" falsevalue="0" checked="false" label="Report AED and QI statistics for all predictions as well as models"/> + <param name="AED_threshold" type="float" min="0" max="1" value="1" label="Maximum Annotation Edit Distance allowed"/> + <param name="min_protein" type="integer" value="0" label="Require at least this many amino acids in predicted proteins"/> + <param name="alt_splice" type="boolean" truevalue="1" falsevalue="0" checked="false" label="Take extra steps to try and find alternative splicing" help="Will try to output gene isoforms when detected instead of a single consensus isoform.Use this if you have good EST evidences allowing to detect isoforms."/> + <param name="always_complete" type="boolean" truevalue="1" falsevalue="0" checked="false" label="Take extra steps to force the finding of a start and stop codons" help="Only cannonical gene structures will be reported, but it can lead to biologically incorrect seqences."/> + <param name="map_forward" type="boolean" truevalue="1" falsevalue="0" checked="false" label="Map names and attributes forward from old GFF3 genes"/> + <param name="keep_preds" type="float" min="0" max="1" value="0" label="Concordance threshold to add unsupported gene prediction"/> + <param name="split_hit" type="integer" value="10000" label="length for the splitting of hits" help="Expected max intron size for evidence alignments"/> + <param name="correct_est_fusion" type="boolean" truevalue="1" falsevalue="0" checked="false" label="Limit use of ESTs in annotation to avoid fusion genes"/> + <conditional name="single_exon"> + <param name="single_exon" type="select" label="Consider single exon EST evidence when generating annotations"> + <option value="0" selected="true">No</option> + <option value="1">Yes</option> + </param> + <when value="0"/> + <when value="1"> + <param name="single_length" type="integer" value="250" label="min length required for single exon ESTs if"/> + </when> + </conditional> + </section> + </inputs> + <outputs> + <data format="gff3" name="output_gff" label="${tool.name} on ${on_string}: final annotation"/> + <data format="gff3" name="output_evidences" label="${tool.name} on ${on_string}: evidences"/> + <data format="gff3" name="output_full" label="${tool.name} on ${on_string}: full gff (evidences + final annotation)"/> + </outputs> + <tests> + <test> + <param name="genome" value="genome.fasta"/> + <param name="est_evidences|est" value="est.fasta"/> + <param name="est_evidences|est2genome" value="1"/> + <output name="output_gff" file="annot.gff3"/> + <output name="output_evidences" file="evidences.gff3" compare="sim_size"/> + </test> + <test> + <param name="genome" value="genome.fasta"/> + <param name="organism_type" value="prokaryotic"/> + <param name="est_evidences|est" value="est.fasta"/> + <param name="est_evidences|est2genome" value="1"/> + <output name="output_gff" file="annot_proc.gff3"/> + <output name="output_evidences" file="evidences_proc.gff3" compare="sim_size"/> + </test> + <test> + <param name="genome" value="genome.fasta"/> + <param name="reannotation|reannotate" value="yes"/> + <param name="reannotation|maker_gff" value="evidences.gff3"/> + <param name="reannotation|est_pass" value="true"/> + <param name="est_evidences|est2genome" value="1"/> + <output name="output_gff" file="annot_reuse.gff3"/> + <output name="output_evidences" file="evidences_reuse.gff3" compare="sim_size"/> + </test> + <test> + <param name="genome" value="genome.fasta"/> + <param name="abinitio_gene_prediction|snaphmm" value="snap.hmm"/> + <param name="abinitio_gene_prediction|aug_prediction|augustus_mode" value="builtin"/> + <param name="abinitio_gene_prediction|aug_prediction|augustus_species" value="human"/> + <param name="est_evidences|est" value="est.fasta"/> + <param name="est_evidences|est2genome" value="1"/> + <output name="output_gff" file="annot_human.gff3" compare="sim_size"/> + <output name="output_evidences" file="evidences_human.gff3" compare="sim_size"/> + </test> + <test> + <param name="genome" value="genome.fasta"/> + <param name="abinitio_gene_prediction|snaphmm" value="snap.hmm"/> + <param name="abinitio_gene_prediction|aug_prediction|augustus_mode" value="history"/> + <param name="abinitio_gene_prediction|aug_prediction|augustus_model" value="local.tar.gz" ftype="augustus"/> + <param name="est_evidences|est" value="est.fasta"/> + <param name="est_evidences|est2genome" value="1"/> + <output name="output_gff" file="annot_model.gff3" compare="sim_size"/> + <output name="output_evidences" file="evidences_model.gff3" compare="sim_size"/> + </test> + <test> + <param name="genome" value="genome.fasta"/> + <param name="est_evidences|est" value="est.fasta"/> + <param name="est_evidences|est2genome" value="1"/> + <param name="repeat_masking|repeatmasker|do_rm" value="no"/> + <output name="output_gff" file="annot_norm.gff3"/> + <output name="output_evidences" file="evidences_norm.gff3" compare="sim_size"/> + </test> + </tests> + <help><![CDATA[ + MAKER is a portable and easily configurable genome annotation pipeline. Its purpose is to allow smaller eukaryotic and prokaryotic genome projects to independently annotate their genomes and to create genome databases. MAKER identifies repeats, aligns ESTs and proteins to a genome, produces ab-initio gene predictions and automatically synthesizes these data into gene annotations having evidence-based quality values. MAKER is also easily trainable: outputs of preliminary runs can be used to automatically retrain its gene prediction algorithm, producing higher quality gene-models on seusequent runs. MAKER's inputs are minimal and its ouputs can be directly loaded into a GMOD database. They can also be viewed in the Apollo genome browser; this feature of MAKER provides an easy means to annotate, view and edit individual contigs and BACs without the overhead of a database. MAKER should prove especially useful for emerging model organism projects with minimal bioinformatics expertise and computer resources. + + .. _Maker: http://www.yandell-lab.org/software/maker.html + ]]></help> + <expand macro="citations"/> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/annot.gff3 Thu Oct 19 15:58:39 2017 -0400 @@ -0,0 +1,43 @@ +##gff-version 3 +HS08198 maker gene 352 1848 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0;Name=maker-HS08198-exonerate_est2genome-gene-0.0 +HS08198 maker mRNA 352 1848 2869 + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1;Parent=maker-HS08198-exonerate_est2genome-gene-0.0;Name=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1;_AED=0.00;_eAED=0.00;_QI=70|1|1|1|0|0|7|0|192 +HS08198 maker exon 352 397 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:exon:9;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker exon 421 582 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:exon:10;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker exon 812 894 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:exon:11;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker exon 1053 1123 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:exon:12;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker exon 1208 1315 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:exon:13;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker exon 1587 1688 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:exon:14;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker exon 1772 1848 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:exon:15;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker five_prime_UTR 352 397 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:five_prime_utr;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker five_prime_UTR 421 444 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:five_prime_utr;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker CDS 445 582 . + 0 ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker CDS 812 894 . + 0 ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker CDS 1053 1123 . + 1 ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker CDS 1208 1315 . + 2 ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker CDS 1587 1688 . + 2 ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker CDS 1772 1848 . + 2 ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +### +### +HS04636 maker gene 1813 6903 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0;Name=maker-HS04636-exonerate_est2genome-gene-0.0 +HS04636 maker mRNA 1813 6903 8728 + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1;Parent=maker-HS04636-exonerate_est2genome-gene-0.0;Name=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1;_AED=0.00;_eAED=0.00;_QI=49|1|1|1|0|0|9|0|572 +HS04636 maker exon 1813 1934 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:0;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 2055 2198 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:1;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 2852 2995 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:2;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 3426 3607 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:3;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 4340 4423 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:4;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 4543 4789 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:5;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 5072 5358 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:6;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 5860 6007 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:7;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 6494 6903 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:8;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker five_prime_UTR 1813 1861 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:five_prime_utr;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 1862 1934 . + 0 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 2055 2198 . + 2 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 2852 2995 . + 2 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 3426 3607 . + 2 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 4340 4423 . + 0 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 4543 4789 . + 0 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 5072 5358 . + 2 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 5860 6007 . + 0 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 6494 6903 . + 2 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +### +###
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/annot_human.gff3 Thu Oct 19 15:58:39 2017 -0400 @@ -0,0 +1,44 @@ +##gff-version 3 +HS08198 maker gene 352 1848 . + . ID=maker-HS08198-augustus-gene-0.4;Name=maker-HS08198-augustus-gene-0.4 +HS08198 maker mRNA 352 1848 . + . ID=maker-HS08198-augustus-gene-0.4-mRNA-1;Parent=maker-HS08198-augustus-gene-0.4;Name=maker-HS08198-augustus-gene-0.4-mRNA-1;_AED=0.00;_eAED=0.00;_QI=70|1|1|1|0.83|0.85|7|0|192 +HS08198 maker exon 352 397 . + . ID=maker-HS08198-augustus-gene-0.4-mRNA-1:exon:10;Parent=maker-HS08198-augustus-gene-0.4-mRNA-1 +HS08198 maker exon 421 582 . + . ID=maker-HS08198-augustus-gene-0.4-mRNA-1:exon:11;Parent=maker-HS08198-augustus-gene-0.4-mRNA-1 +HS08198 maker exon 812 894 . + . ID=maker-HS08198-augustus-gene-0.4-mRNA-1:exon:12;Parent=maker-HS08198-augustus-gene-0.4-mRNA-1 +HS08198 maker exon 1053 1123 . + . ID=maker-HS08198-augustus-gene-0.4-mRNA-1:exon:13;Parent=maker-HS08198-augustus-gene-0.4-mRNA-1 +HS08198 maker exon 1208 1315 . + . ID=maker-HS08198-augustus-gene-0.4-mRNA-1:exon:14;Parent=maker-HS08198-augustus-gene-0.4-mRNA-1 +HS08198 maker exon 1587 1688 . + . ID=maker-HS08198-augustus-gene-0.4-mRNA-1:exon:15;Parent=maker-HS08198-augustus-gene-0.4-mRNA-1 +HS08198 maker exon 1772 1848 . + . ID=maker-HS08198-augustus-gene-0.4-mRNA-1:exon:16;Parent=maker-HS08198-augustus-gene-0.4-mRNA-1 +HS08198 maker five_prime_UTR 352 397 . + . ID=maker-HS08198-augustus-gene-0.4-mRNA-1:five_prime_utr;Parent=maker-HS08198-augustus-gene-0.4-mRNA-1 +HS08198 maker five_prime_UTR 421 444 . + . ID=maker-HS08198-augustus-gene-0.4-mRNA-1:five_prime_utr;Parent=maker-HS08198-augustus-gene-0.4-mRNA-1 +HS08198 maker CDS 445 582 . + 0 ID=maker-HS08198-augustus-gene-0.4-mRNA-1:cds;Parent=maker-HS08198-augustus-gene-0.4-mRNA-1 +HS08198 maker CDS 812 894 . + 0 ID=maker-HS08198-augustus-gene-0.4-mRNA-1:cds;Parent=maker-HS08198-augustus-gene-0.4-mRNA-1 +HS08198 maker CDS 1053 1123 . + 1 ID=maker-HS08198-augustus-gene-0.4-mRNA-1:cds;Parent=maker-HS08198-augustus-gene-0.4-mRNA-1 +HS08198 maker CDS 1208 1315 . + 2 ID=maker-HS08198-augustus-gene-0.4-mRNA-1:cds;Parent=maker-HS08198-augustus-gene-0.4-mRNA-1 +HS08198 maker CDS 1587 1688 . + 2 ID=maker-HS08198-augustus-gene-0.4-mRNA-1:cds;Parent=maker-HS08198-augustus-gene-0.4-mRNA-1 +HS08198 maker CDS 1772 1848 . + 2 ID=maker-HS08198-augustus-gene-0.4-mRNA-1:cds;Parent=maker-HS08198-augustus-gene-0.4-mRNA-1 +### +### +HS04636 maker gene 966 6903 . + . ID=maker-HS04636-augustus-gene-0.4;Name=maker-HS04636-augustus-gene-0.4 +HS04636 maker mRNA 966 6903 . + . ID=maker-HS04636-augustus-gene-0.4-mRNA-1;Parent=maker-HS04636-augustus-gene-0.4;Name=maker-HS04636-augustus-gene-0.4-mRNA-1;_AED=0.02;_eAED=0.02;_QI=0|0.88|0.8|0.9|1|1|10|0|604 +HS04636 maker exon 966 1017 . + . ID=maker-HS04636-augustus-gene-0.4-mRNA-1:exon:0;Parent=maker-HS04636-augustus-gene-0.4-mRNA-1 +HS04636 maker exon 1818 1934 . + . ID=maker-HS04636-augustus-gene-0.4-mRNA-1:exon:1;Parent=maker-HS04636-augustus-gene-0.4-mRNA-1 +HS04636 maker exon 2055 2198 . + . ID=maker-HS04636-augustus-gene-0.4-mRNA-1:exon:2;Parent=maker-HS04636-augustus-gene-0.4-mRNA-1 +HS04636 maker exon 2852 2995 . + . ID=maker-HS04636-augustus-gene-0.4-mRNA-1:exon:3;Parent=maker-HS04636-augustus-gene-0.4-mRNA-1 +HS04636 maker exon 3426 3607 . + . ID=maker-HS04636-augustus-gene-0.4-mRNA-1:exon:4;Parent=maker-HS04636-augustus-gene-0.4-mRNA-1 +HS04636 maker exon 4340 4423 . + . ID=maker-HS04636-augustus-gene-0.4-mRNA-1:exon:5;Parent=maker-HS04636-augustus-gene-0.4-mRNA-1 +HS04636 maker exon 4543 4789 . + . ID=maker-HS04636-augustus-gene-0.4-mRNA-1:exon:6;Parent=maker-HS04636-augustus-gene-0.4-mRNA-1 +HS04636 maker exon 5072 5358 . + . ID=maker-HS04636-augustus-gene-0.4-mRNA-1:exon:7;Parent=maker-HS04636-augustus-gene-0.4-mRNA-1 +HS04636 maker exon 5860 6007 . + . ID=maker-HS04636-augustus-gene-0.4-mRNA-1:exon:8;Parent=maker-HS04636-augustus-gene-0.4-mRNA-1 +HS04636 maker exon 6494 6903 . + . ID=maker-HS04636-augustus-gene-0.4-mRNA-1:exon:9;Parent=maker-HS04636-augustus-gene-0.4-mRNA-1 +HS04636 maker CDS 966 1017 . + 0 ID=maker-HS04636-augustus-gene-0.4-mRNA-1:cds;Parent=maker-HS04636-augustus-gene-0.4-mRNA-1 +HS04636 maker CDS 1818 1934 . + 2 ID=maker-HS04636-augustus-gene-0.4-mRNA-1:cds;Parent=maker-HS04636-augustus-gene-0.4-mRNA-1 +HS04636 maker CDS 2055 2198 . + 2 ID=maker-HS04636-augustus-gene-0.4-mRNA-1:cds;Parent=maker-HS04636-augustus-gene-0.4-mRNA-1 +HS04636 maker CDS 2852 2995 . + 2 ID=maker-HS04636-augustus-gene-0.4-mRNA-1:cds;Parent=maker-HS04636-augustus-gene-0.4-mRNA-1 +HS04636 maker CDS 3426 3607 . + 2 ID=maker-HS04636-augustus-gene-0.4-mRNA-1:cds;Parent=maker-HS04636-augustus-gene-0.4-mRNA-1 +HS04636 maker CDS 4340 4423 . + 0 ID=maker-HS04636-augustus-gene-0.4-mRNA-1:cds;Parent=maker-HS04636-augustus-gene-0.4-mRNA-1 +HS04636 maker CDS 4543 4789 . + 0 ID=maker-HS04636-augustus-gene-0.4-mRNA-1:cds;Parent=maker-HS04636-augustus-gene-0.4-mRNA-1 +HS04636 maker CDS 5072 5358 . + 2 ID=maker-HS04636-augustus-gene-0.4-mRNA-1:cds;Parent=maker-HS04636-augustus-gene-0.4-mRNA-1 +HS04636 maker CDS 5860 6007 . + 0 ID=maker-HS04636-augustus-gene-0.4-mRNA-1:cds;Parent=maker-HS04636-augustus-gene-0.4-mRNA-1 +HS04636 maker CDS 6494 6903 . + 2 ID=maker-HS04636-augustus-gene-0.4-mRNA-1:cds;Parent=maker-HS04636-augustus-gene-0.4-mRNA-1 +### +###
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/annot_mapped.gff3 Thu Oct 19 15:58:39 2017 -0400 @@ -0,0 +1,43 @@ +##gff-version 3 +HS08198 maker gene 352 1848 . + . ID=YES000002;Name=YES000002;Alias=maker-HS08198-exonerate_est2genome-gene-0.0; +HS08198 maker mRNA 352 1848 2869 + . ID=YES000002-RA;Parent=YES000002;Name=YES000002-RA;Alias=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1;_AED=0.00;_QI=70|1|1|1|0|0|7|0|192;_eAED=0.00; +HS08198 maker exon 352 397 . + . ID=YES000002-RA:exon:9;Parent=YES000002-RA; +HS08198 maker exon 421 582 . + . ID=YES000002-RA:exon:10;Parent=YES000002-RA; +HS08198 maker exon 812 894 . + . ID=YES000002-RA:exon:11;Parent=YES000002-RA; +HS08198 maker exon 1053 1123 . + . ID=YES000002-RA:exon:12;Parent=YES000002-RA; +HS08198 maker exon 1208 1315 . + . ID=YES000002-RA:exon:13;Parent=YES000002-RA; +HS08198 maker exon 1587 1688 . + . ID=YES000002-RA:exon:14;Parent=YES000002-RA; +HS08198 maker exon 1772 1848 . + . ID=YES000002-RA:exon:15;Parent=YES000002-RA; +HS08198 maker five_prime_UTR 352 397 . + . ID=YES000002-RA:five_prime_utr;Parent=YES000002-RA; +HS08198 maker five_prime_UTR 421 444 . + . ID=YES000002-RA:five_prime_utr;Parent=YES000002-RA; +HS08198 maker CDS 445 582 . + 0 ID=YES000002-RA:cds;Parent=YES000002-RA; +HS08198 maker CDS 812 894 . + 0 ID=YES000002-RA:cds;Parent=YES000002-RA; +HS08198 maker CDS 1053 1123 . + 1 ID=YES000002-RA:cds;Parent=YES000002-RA; +HS08198 maker CDS 1208 1315 . + 2 ID=YES000002-RA:cds;Parent=YES000002-RA; +HS08198 maker CDS 1587 1688 . + 2 ID=YES000002-RA:cds;Parent=YES000002-RA; +HS08198 maker CDS 1772 1848 . + 2 ID=YES000002-RA:cds;Parent=YES000002-RA; +### +### +HS04636 maker gene 1813 6903 . + . ID=YES000001;Name=YES000001;Alias=maker-HS04636-exonerate_est2genome-gene-0.0; +HS04636 maker mRNA 1813 6903 8728 + . ID=YES000001-RA;Parent=YES000001;Name=YES000001-RA;Alias=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1;_AED=0.00;_QI=49|1|1|1|0|0|9|0|572;_eAED=0.00; +HS04636 maker exon 1813 1934 . + . ID=YES000001-RA:exon:0;Parent=YES000001-RA; +HS04636 maker exon 2055 2198 . + . ID=YES000001-RA:exon:1;Parent=YES000001-RA; +HS04636 maker exon 2852 2995 . + . ID=YES000001-RA:exon:2;Parent=YES000001-RA; +HS04636 maker exon 3426 3607 . + . ID=YES000001-RA:exon:3;Parent=YES000001-RA; +HS04636 maker exon 4340 4423 . + . ID=YES000001-RA:exon:4;Parent=YES000001-RA; +HS04636 maker exon 4543 4789 . + . ID=YES000001-RA:exon:5;Parent=YES000001-RA; +HS04636 maker exon 5072 5358 . + . ID=YES000001-RA:exon:6;Parent=YES000001-RA; +HS04636 maker exon 5860 6007 . + . ID=YES000001-RA:exon:7;Parent=YES000001-RA; +HS04636 maker exon 6494 6903 . + . ID=YES000001-RA:exon:8;Parent=YES000001-RA; +HS04636 maker five_prime_UTR 1813 1861 . + . ID=YES000001-RA:five_prime_utr;Parent=YES000001-RA; +HS04636 maker CDS 1862 1934 . + 0 ID=YES000001-RA:cds;Parent=YES000001-RA; +HS04636 maker CDS 2055 2198 . + 2 ID=YES000001-RA:cds;Parent=YES000001-RA; +HS04636 maker CDS 2852 2995 . + 2 ID=YES000001-RA:cds;Parent=YES000001-RA; +HS04636 maker CDS 3426 3607 . + 2 ID=YES000001-RA:cds;Parent=YES000001-RA; +HS04636 maker CDS 4340 4423 . + 0 ID=YES000001-RA:cds;Parent=YES000001-RA; +HS04636 maker CDS 4543 4789 . + 0 ID=YES000001-RA:cds;Parent=YES000001-RA; +HS04636 maker CDS 5072 5358 . + 2 ID=YES000001-RA:cds;Parent=YES000001-RA; +HS04636 maker CDS 5860 6007 . + 0 ID=YES000001-RA:cds;Parent=YES000001-RA; +HS04636 maker CDS 6494 6903 . + 2 ID=YES000001-RA:cds;Parent=YES000001-RA; +### +###
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/annot_model.gff3 Thu Oct 19 15:58:39 2017 -0400 @@ -0,0 +1,41 @@ +##gff-version 3 +HS08198 maker gene 352 1848 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0;Name=maker-HS08198-exonerate_est2genome-gene-0.0 +HS08198 maker mRNA 352 1848 2869 + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1;Parent=maker-HS08198-exonerate_est2genome-gene-0.0;Name=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1;_AED=0.00;_eAED=0.00;_QI=70|1|1|1|0|0|7|0|192 +HS08198 maker exon 352 397 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:exon:9;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker exon 421 582 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:exon:10;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker exon 812 894 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:exon:11;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker exon 1053 1123 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:exon:12;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker exon 1208 1315 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:exon:13;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker exon 1587 1688 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:exon:14;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker exon 1772 1848 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:exon:15;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker five_prime_UTR 352 397 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:five_prime_utr;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker five_prime_UTR 421 444 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:five_prime_utr;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker CDS 445 582 . + 0 ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker CDS 812 894 . + 0 ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker CDS 1053 1123 . + 1 ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker CDS 1208 1315 . + 2 ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker CDS 1587 1688 . + 2 ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker CDS 1772 1848 . + 2 ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +### +HS04636 maker gene 1813 6903 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0;Name=maker-HS04636-exonerate_est2genome-gene-0.0 +HS04636 maker mRNA 1813 6903 8728 + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1;Parent=maker-HS04636-exonerate_est2genome-gene-0.0;Name=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1;_AED=0.00;_eAED=0.00;_QI=49|1|1|1|0|0|9|0|572 +HS04636 maker exon 1813 1934 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:0;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 2055 2198 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:1;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 2852 2995 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:2;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 3426 3607 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:3;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 4340 4423 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:4;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 4543 4789 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:5;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 5072 5358 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:6;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 5860 6007 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:7;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 6494 6903 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:8;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker five_prime_UTR 1813 1861 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:five_prime_utr;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 1862 1934 . + 0 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 2055 2198 . + 2 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 2852 2995 . + 2 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 3426 3607 . + 2 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 4340 4423 . + 0 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 4543 4789 . + 0 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 5072 5358 . + 2 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 5860 6007 . + 0 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 6494 6903 . + 2 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +###
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/annot_norm.gff3 Thu Oct 19 15:58:39 2017 -0400 @@ -0,0 +1,41 @@ +##gff-version 3 +HS08198 maker gene 352 1848 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0;Name=maker-HS08198-exonerate_est2genome-gene-0.0 +HS08198 maker mRNA 352 1848 2869 + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1;Parent=maker-HS08198-exonerate_est2genome-gene-0.0;Name=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1;_AED=0.00;_eAED=0.00;_QI=70|1|1|1|0|0|7|0|192 +HS08198 maker exon 352 397 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:exon:9;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker exon 421 582 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:exon:10;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker exon 812 894 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:exon:11;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker exon 1053 1123 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:exon:12;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker exon 1208 1315 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:exon:13;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker exon 1587 1688 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:exon:14;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker exon 1772 1848 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:exon:15;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker five_prime_UTR 352 397 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:five_prime_utr;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker five_prime_UTR 421 444 . + . ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:five_prime_utr;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker CDS 445 582 . + 0 ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker CDS 812 894 . + 0 ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker CDS 1053 1123 . + 1 ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker CDS 1208 1315 . + 2 ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker CDS 1587 1688 . + 2 ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +HS08198 maker CDS 1772 1848 . + 2 ID=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 +### +HS04636 maker gene 1813 6903 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0;Name=maker-HS04636-exonerate_est2genome-gene-0.0 +HS04636 maker mRNA 1813 6903 8728 + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1;Parent=maker-HS04636-exonerate_est2genome-gene-0.0;Name=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1;_AED=0.00;_eAED=0.00;_QI=49|1|1|1|0|0|9|0|572 +HS04636 maker exon 1813 1934 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:0;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 2055 2198 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:1;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 2852 2995 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:2;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 3426 3607 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:3;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 4340 4423 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:4;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 4543 4789 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:5;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 5072 5358 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:6;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 5860 6007 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:7;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 6494 6903 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:exon:8;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker five_prime_UTR 1813 1861 . + . ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:five_prime_utr;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 1862 1934 . + 0 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 2055 2198 . + 2 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 2852 2995 . + 2 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 3426 3607 . + 2 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 4340 4423 . + 0 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 4543 4789 . + 0 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 5072 5358 . + 2 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 5860 6007 . + 0 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 6494 6903 . + 2 ID=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 +###
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/annot_proc.gff3 Thu Oct 19 15:58:39 2017 -0400 @@ -0,0 +1,3 @@ +##gff-version 3 +### +###
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/annot_reuse.gff3 Thu Oct 19 15:58:39 2017 -0400 @@ -0,0 +1,43 @@ +##gff-version 3 +HS08198 maker gene 352 1848 . + . ID=maker-HS08198-est2genome-gene-0.0;Name=maker-HS08198-est2genome-gene-0.0;score=2869 +HS08198 maker mRNA 352 1848 2869 + . ID=maker-HS08198-est2genome-gene-0.0-mRNA-1;Parent=maker-HS08198-est2genome-gene-0.0;Name=maker-HS08198-est2genome-gene-0.0-mRNA-1;_AED=0.00;_eAED=0.00;_QI=70|1|1|1|0|0|7|0|192 +HS08198 maker exon 352 397 . + . ID=maker-HS08198-est2genome-gene-0.0-mRNA-1:exon:9;Parent=maker-HS08198-est2genome-gene-0.0-mRNA-1 +HS08198 maker exon 421 582 . + . ID=maker-HS08198-est2genome-gene-0.0-mRNA-1:exon:10;Parent=maker-HS08198-est2genome-gene-0.0-mRNA-1 +HS08198 maker exon 812 894 . + . ID=maker-HS08198-est2genome-gene-0.0-mRNA-1:exon:11;Parent=maker-HS08198-est2genome-gene-0.0-mRNA-1 +HS08198 maker exon 1053 1123 . + . ID=maker-HS08198-est2genome-gene-0.0-mRNA-1:exon:12;Parent=maker-HS08198-est2genome-gene-0.0-mRNA-1 +HS08198 maker exon 1208 1315 . + . ID=maker-HS08198-est2genome-gene-0.0-mRNA-1:exon:13;Parent=maker-HS08198-est2genome-gene-0.0-mRNA-1 +HS08198 maker exon 1587 1688 . + . ID=maker-HS08198-est2genome-gene-0.0-mRNA-1:exon:14;Parent=maker-HS08198-est2genome-gene-0.0-mRNA-1 +HS08198 maker exon 1772 1848 . + . ID=maker-HS08198-est2genome-gene-0.0-mRNA-1:exon:15;Parent=maker-HS08198-est2genome-gene-0.0-mRNA-1 +HS08198 maker five_prime_UTR 352 397 . + . ID=maker-HS08198-est2genome-gene-0.0-mRNA-1:five_prime_utr;Parent=maker-HS08198-est2genome-gene-0.0-mRNA-1 +HS08198 maker five_prime_UTR 421 444 . + . ID=maker-HS08198-est2genome-gene-0.0-mRNA-1:five_prime_utr;Parent=maker-HS08198-est2genome-gene-0.0-mRNA-1 +HS08198 maker CDS 445 582 . + 0 ID=maker-HS08198-est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS08198-est2genome-gene-0.0-mRNA-1 +HS08198 maker CDS 812 894 . + 0 ID=maker-HS08198-est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS08198-est2genome-gene-0.0-mRNA-1 +HS08198 maker CDS 1053 1123 . + 1 ID=maker-HS08198-est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS08198-est2genome-gene-0.0-mRNA-1 +HS08198 maker CDS 1208 1315 . + 2 ID=maker-HS08198-est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS08198-est2genome-gene-0.0-mRNA-1 +HS08198 maker CDS 1587 1688 . + 2 ID=maker-HS08198-est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS08198-est2genome-gene-0.0-mRNA-1 +HS08198 maker CDS 1772 1848 . + 2 ID=maker-HS08198-est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS08198-est2genome-gene-0.0-mRNA-1 +### +### +HS04636 maker gene 1813 6903 . + . ID=maker-HS04636-est2genome-gene-0.0;Name=maker-HS04636-est2genome-gene-0.0;score=8728 +HS04636 maker mRNA 1813 6903 8728 + . ID=maker-HS04636-est2genome-gene-0.0-mRNA-1;Parent=maker-HS04636-est2genome-gene-0.0;Name=maker-HS04636-est2genome-gene-0.0-mRNA-1;_AED=0.00;_eAED=0.00;_QI=49|1|1|1|0|0|9|0|572 +HS04636 maker exon 1813 1934 . + . ID=maker-HS04636-est2genome-gene-0.0-mRNA-1:exon:0;Parent=maker-HS04636-est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 2055 2198 . + . ID=maker-HS04636-est2genome-gene-0.0-mRNA-1:exon:1;Parent=maker-HS04636-est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 2852 2995 . + . ID=maker-HS04636-est2genome-gene-0.0-mRNA-1:exon:2;Parent=maker-HS04636-est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 3426 3607 . + . ID=maker-HS04636-est2genome-gene-0.0-mRNA-1:exon:3;Parent=maker-HS04636-est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 4340 4423 . + . ID=maker-HS04636-est2genome-gene-0.0-mRNA-1:exon:4;Parent=maker-HS04636-est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 4543 4789 . + . ID=maker-HS04636-est2genome-gene-0.0-mRNA-1:exon:5;Parent=maker-HS04636-est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 5072 5358 . + . ID=maker-HS04636-est2genome-gene-0.0-mRNA-1:exon:6;Parent=maker-HS04636-est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 5860 6007 . + . ID=maker-HS04636-est2genome-gene-0.0-mRNA-1:exon:7;Parent=maker-HS04636-est2genome-gene-0.0-mRNA-1 +HS04636 maker exon 6494 6903 . + . ID=maker-HS04636-est2genome-gene-0.0-mRNA-1:exon:8;Parent=maker-HS04636-est2genome-gene-0.0-mRNA-1 +HS04636 maker five_prime_UTR 1813 1861 . + . ID=maker-HS04636-est2genome-gene-0.0-mRNA-1:five_prime_utr;Parent=maker-HS04636-est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 1862 1934 . + 0 ID=maker-HS04636-est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 2055 2198 . + 2 ID=maker-HS04636-est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 2852 2995 . + 2 ID=maker-HS04636-est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 3426 3607 . + 2 ID=maker-HS04636-est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 4340 4423 . + 0 ID=maker-HS04636-est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 4543 4789 . + 0 ID=maker-HS04636-est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 5072 5358 . + 2 ID=maker-HS04636-est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 5860 6007 . + 0 ID=maker-HS04636-est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-est2genome-gene-0.0-mRNA-1 +HS04636 maker CDS 6494 6903 . + 2 ID=maker-HS04636-est2genome-gene-0.0-mRNA-1:cds;Parent=maker-HS04636-est2genome-gene-0.0-mRNA-1 +### +###
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/est.fasta Thu Oct 19 15:58:39 2017 -0400 @@ -0,0 +1,35 @@ +>HS04636.g1 +atgctcgcccgcgccctgctgctgtgcgcggtcctggcgctcagccatacagcaaatccttgctgttcccacccatgtca +tgctcgcccgcgccctgctgctgtgcgcggtcctggcgctcagccatacagcaaatccttgctgttcccacccatgtcaa +aaccgaggtgtatgtatgagtgtgggatttgaccagtataagtgcgattgtacccggacaggattctatggagaaaactg +ctcaacaccggaatttttgacaagaataaaattatttctgaaacccactccaaacacagtgcactacatacttacccact +tcaagggattttggaacgttgtgaataacattcccttccttcgaaatgcaattatgagttatgtcttgacatccagatca +catttgattgacagtccaccaacttacaatgctgactatggctacaaaagctgggaagccttctctaacctctcctatta +tactagagcccttcctcctgtgcctgatgattgcccgactcccttgggtgtcaaaggtaaaaagcagcttcctgattcaa +atgagattgtggaaaaattgcttctaagaagaaagttcatccctgatccccagggctcaaacatgatgtttgcattcttt +gcccagcacttcacgcatcagtttttcaagacagatcataagcgagggccagctttcaccaacgggctgggccatggggt +ggacttaaatcatatttacggtgaaactctggctagacagcgtaaactgcgccttttcaaggatggaaaaatgaaatatc +agataattgatggagagatgtatcctcccacagtcaaagatactcaggcagagatgatctaccctcctcaagtccctgag +catctacggtttgctgtggggcaggaggtctttggtctggtgcctggtctgatgatgtatgccacaatctggctgcggga +acacaacagagtatgcgatgtgcttaaacaggagcatcctgaatggggtgatgagcagttgttccagacaagcaggctaa +tactgataggagagactattaagattgtgattgaagattatgtgcaacacttgagtggctatcacttcaaactgaaattt +gacccagaactacttttcaacaaacaattccagtaccaaaatcgtattgctgctgaatttaacaccctctatcactggca +tccccttctgcctgacacctttcaaattcatgaccagaaatacaactatcaacagtttatctacaacaactctatattgc +tggaacatggaattacccagtttgttgaatcattcaccaggcaaattgctggcagggttgctggtggtaggaatgttcca +cccgcagtacagaaagtatcacaggcttccattgaccagagcaggcagatgaaataccagtcttttaatgagtaccgcaa +acgctttatgctgaagccctatgaatcatttgaagaacttacaggagaaaaggaaatgtctgcagagttggaagcactct +atggtgacatcgatgctgtggagctgtatcctgcccttctggtagaaaagcctcggccagatgccatctttggtgaaacc +atggtagaagttggagcaccattctccttgaaaggacttatgggtaatgttatatgttctcctgcctactggaagccaag +cacttttggtggagaagtgggttttcaaatcatcaacactgcctcaattcagtctctcatctgcaataacgtgaagggct +gtccctttacttcattcagtgttccagatccagagctcattaaaacagtcaccatcaatgcaagttcttcccgctccgga +ctagatgatatcaatcccacagtactactaaaagaacgttcgactgaactgtag +>HS08198.g2 +atgctgccccctgggactgcgaccctcttgactctgctcctggcagctggctcgctgggccagaagcctcagaggccaca +tgctgccccctgggactgcgaccctcttgactctgctcctggcagctggctcgctgggccagaagcctcagaggccacgc +cggcccgcatcccccatcagcaccatccagcccaaggccaattttgatgcgcagcaggagcagggccaccgggccgaggc +caccacactgcatgtggctccccagggcacagccatggctgtcagtaccttccgaaagctggatgggatctgctggcagg +tgcgccagctctatggagacacaggggtcctcggccgcttcctgcttcaagcccgaggcgcccgaggggctgtgcacgtg +gttgtcgctgagaccgactaccagagtttcgctgtcctgtacctggagcgggcggggcagctgtcagtgaagctctacgc +ccgctcgctccctgtgagcgactcggtcctgagtgggtttgagcagcgggtccaggaggcccacctgactgaggaccaga +tcttctacttccccaagtacggcttctgcgaggctgcagaccagttccacgtcctggacggtgagtgcacagcgggggca +agcatggcggcgtggtga
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/evidences.gff3 Thu Oct 19 15:58:39 2017 -0400 @@ -0,0 +1,62 @@ +##gff-version 3 +HS08198 . contig 1 2344 . . . ID=HS08198;Name=HS08198 +### +HS08198 repeatmasker match 578 651 13 + . ID=HS08198:hit:10:1.3.0.0;Name=species:%28AGAAGGT%29n|genus:Simple_repeat;Target=species:%28AGAAGGT%29n|genus:Simple_repeat 1 75 + +HS08198 repeatmasker match_part 578 651 13 + . ID=HS08198:hsp:27:1.3.0.0;Parent=HS08198:hit:10:1.3.0.0;Target=species:%2528AGAAGGT%2529n|genus:Simple_repeat 1 75 + +### +HS08198 blastn expressed_sequence_match 444 1848 140 + . ID=HS08198:hit:11:3.2.0.0;Name=HS08198.g2 +HS08198 blastn match_part 444 583 140 + . ID=HS08198:hsp:28:3.2.0.0;Parent=HS08198:hit:11:3.2.0.0;Target=HS08198.g2 79 218 +;Gap=M140 +HS08198 blastn match_part 445 523 79 + . ID=HS08198:hsp:29:3.2.0.0;Parent=HS08198:hit:11:3.2.0.0;Target=HS08198.g2 1 79 +;Gap=M79 +HS08198 blastn match_part 808 895 88 + . ID=HS08198:hsp:30:3.2.0.0;Parent=HS08198:hit:11:3.2.0.0;Target=HS08198.g2 214 301 +;Gap=M88 +HS08198 blastn match_part 1053 1123 71 + . ID=HS08198:hsp:31:3.2.0.0;Parent=HS08198:hit:11:3.2.0.0;Target=HS08198.g2 301 371 +;Gap=M71 +HS08198 blastn match_part 1206 1315 110 + . ID=HS08198:hsp:32:3.2.0.0;Parent=HS08198:hit:11:3.2.0.0;Target=HS08198.g2 370 479 +;Gap=M110 +HS08198 blastn match_part 1586 1689 104 + . ID=HS08198:hsp:33:3.2.0.0;Parent=HS08198:hit:11:3.2.0.0;Target=HS08198.g2 479 582 +;Gap=M104 +HS08198 blastn match_part 1771 1848 78 + . ID=HS08198:hsp:34:3.2.0.0;Parent=HS08198:hit:11:3.2.0.0;Target=HS08198.g2 581 658 +;Gap=M78 +HS08198 est2genome expressed_sequence_match 352 1848 2869 + . ID=HS08198:hit:12:3.2.0.0;Name=HS08198.g2 +HS08198 est2genome match_part 352 397 2869 + . ID=HS08198:hsp:35:3.2.0.0;Parent=HS08198:hit:12:3.2.0.0;Target=HS08198.g2 3 52 +;Gap=M18 D1 M2 I4 M10 I1 M15 +HS08198 est2genome match_part 421 582 2869 + . ID=HS08198:hsp:36:3.2.0.0;Parent=HS08198:hit:12:3.2.0.0;Target=HS08198.g2 53 217 +;Gap=M4 I2 M3 I3 M5 D1 M9 D1 M139 +HS08198 est2genome match_part 812 894 2869 + . ID=HS08198:hsp:37:3.2.0.0;Parent=HS08198:hit:12:3.2.0.0;Target=HS08198.g2 218 300 +;Gap=M83 +HS08198 est2genome match_part 1053 1123 2869 + . ID=HS08198:hsp:38:3.2.0.0;Parent=HS08198:hit:12:3.2.0.0;Target=HS08198.g2 301 371 +;Gap=M71 +HS08198 est2genome match_part 1208 1315 2869 + . ID=HS08198:hsp:39:3.2.0.0;Parent=HS08198:hit:12:3.2.0.0;Target=HS08198.g2 372 479 +;Gap=M108 +HS08198 est2genome match_part 1587 1688 2869 + . ID=HS08198:hsp:40:3.2.0.0;Parent=HS08198:hit:12:3.2.0.0;Target=HS08198.g2 480 581 +;Gap=M102 +HS08198 est2genome match_part 1772 1848 2869 + . ID=HS08198:hsp:41:3.2.0.0;Parent=HS08198:hit:12:3.2.0.0;Target=HS08198.g2 582 658 +;Gap=M77 +HS04636 . contig 1 9453 . . . ID=HS04636;Name=HS04636 +### +HS04636 repeatmasker match 9419 9435 16 + . ID=HS04636:hit:0:1.3.0.0;Name=species:%28A%29n|genus:Simple_repeat;Target=species:%28A%29n|genus:Simple_repeat 1 17 + +HS04636 repeatmasker match_part 9419 9435 16 + . ID=HS04636:hsp:0:1.3.0.0;Parent=HS04636:hit:0:1.3.0.0;Target=species:%2528A%2529n|genus:Simple_repeat 1 17 + +HS04636 repeatmasker match 939 980 13 + . ID=HS04636:hit:1:1.3.0.0;Name=species:%28CCGCG%29n|genus:Simple_repeat;Target=species:%28CCGCG%29n|genus:Simple_repeat 1 42 + +HS04636 repeatmasker match_part 939 980 13 + . ID=HS04636:hsp:1:1.3.0.0;Parent=HS04636:hit:1:1.3.0.0;Target=species:%2528CCGCG%2529n|genus:Simple_repeat 1 42 + +HS04636 repeatmasker match 3791 3839 22 + . ID=HS04636:hit:2:1.3.0.0;Name=species:%28AC%29n|genus:Simple_repeat;Target=species:%28AC%29n|genus:Simple_repeat 1 49 + +HS04636 repeatmasker match_part 3791 3839 22 + . ID=HS04636:hsp:2:1.3.0.0;Parent=HS04636:hit:2:1.3.0.0;Target=species:%2528AC%2529n|genus:Simple_repeat 1 49 + +HS04636 repeatmasker match 6918 6977 17 + . ID=HS04636:hit:3:1.3.0.0;Name=species:%28TATT%29n|genus:Simple_repeat;Target=species:%28TATT%29n|genus:Simple_repeat 1 54 + +HS04636 repeatmasker match_part 6918 6977 17 + . ID=HS04636:hsp:3:1.3.0.0;Parent=HS04636:hit:3:1.3.0.0;Target=species:%2528TATT%2529n|genus:Simple_repeat 1 54 + +HS04636 repeatmasker match 6028 6072 21 + . ID=HS04636:hit:4:1.3.0.0;Name=species:%28TTGT%29n|genus:Simple_repeat;Target=species:%28TTGT%29n|genus:Simple_repeat 1 46 + +HS04636 repeatmasker match_part 6028 6072 21 + . ID=HS04636:hsp:4:1.3.0.0;Parent=HS04636:hit:4:1.3.0.0;Target=species:%2528TTGT%2529n|genus:Simple_repeat 1 46 + +HS04636 repeatmasker match 4518 4541 17 + . ID=HS04636:hit:5:1.3.0.0;Name=species:%28TTTA%29n|genus:Simple_repeat;Target=species:%28TTTA%29n|genus:Simple_repeat 1 24 + +HS04636 repeatmasker match_part 4518 4541 17 + . ID=HS04636:hsp:5:1.3.0.0;Parent=HS04636:hit:5:1.3.0.0;Target=species:%2528TTTA%2529n|genus:Simple_repeat 1 24 + +HS04636 repeatmasker match 3852 3888 12 + . ID=HS04636:hit:6:1.3.0.0;Name=species:%28TTGTAAT%29n|genus:Simple_repeat;Target=species:%28TTGTAAT%29n|genus:Simple_repeat 1 37 + +HS04636 repeatmasker match_part 3852 3888 12 + . ID=HS04636:hsp:6:1.3.0.0;Parent=HS04636:hit:6:1.3.0.0;Target=species:%2528TTGTAAT%2529n|genus:Simple_repeat 1 37 + +HS04636 repeatmasker match 3840 3847 17 + . ID=HS04636:hit:7:1.3.0.0;Name=species:%28ATAC%29n|genus:Simple_repeat;Target=species:%28ATAC%29n|genus:Simple_repeat 3 57 + +HS04636 repeatmasker match_part 3840 3847 17 + . ID=HS04636:hsp:7:1.3.0.0;Parent=HS04636:hit:7:1.3.0.0;Target=species:%2528ATAC%2529n|genus:Simple_repeat 3 57 + +### +HS04636 blastn expressed_sequence_match 1815 6903 120 + . ID=HS04636:hit:8:3.2.0.0;Name=HS04636.g1 +HS04636 blastn match_part 1815 1934 120 + . ID=HS04636:hsp:8:3.2.0.0;Parent=HS04636:hit:8:3.2.0.0;Target=HS04636.g1 129 248 +;Gap=M120 +HS04636 blastn match_part 1815 1845 31 + . ID=HS04636:hsp:9:3.2.0.0;Parent=HS04636:hit:8:3.2.0.0;Target=HS04636.g1 50 80 +;Gap=M31 +HS04636 blastn match_part 2055 2198 144 + . ID=HS04636:hsp:10:3.2.0.0;Parent=HS04636:hit:8:3.2.0.0;Target=HS04636.g1 249 392 +;Gap=M144 +HS04636 blastn match_part 2852 2997 146 + . ID=HS04636:hsp:11:3.2.0.0;Parent=HS04636:hit:8:3.2.0.0;Target=HS04636.g1 393 538 +;Gap=M146 +HS04636 blastn match_part 3424 3609 186 + . ID=HS04636:hsp:12:3.2.0.0;Parent=HS04636:hit:8:3.2.0.0;Target=HS04636.g1 535 720 +;Gap=M186 +HS04636 blastn match_part 4339 4423 85 + . ID=HS04636:hsp:13:3.2.0.0;Parent=HS04636:hit:8:3.2.0.0;Target=HS04636.g1 718 802 +;Gap=M85 +HS04636 blastn match_part 4541 4790 250 + . ID=HS04636:hsp:14:3.2.0.0;Parent=HS04636:hit:8:3.2.0.0;Target=HS04636.g1 801 1050 +;Gap=M250 +HS04636 blastn match_part 5068 5360 293 + . ID=HS04636:hsp:15:3.2.0.0;Parent=HS04636:hit:8:3.2.0.0;Target=HS04636.g1 1046 1338 +;Gap=M293 +HS04636 blastn match_part 5859 6008 150 + . ID=HS04636:hsp:16:3.2.0.0;Parent=HS04636:hit:8:3.2.0.0;Target=HS04636.g1 1336 1485 +;Gap=M150 +HS04636 blastn match_part 6490 6903 414 + . ID=HS04636:hsp:17:3.2.0.0;Parent=HS04636:hit:8:3.2.0.0;Target=HS04636.g1 1481 1894 +;Gap=M414 +HS04636 est2genome expressed_sequence_match 1813 6903 8728 + . ID=HS04636:hit:9:3.2.0.0;Name=HS04636.g1 +HS04636 est2genome match_part 1813 1934 8728 + . ID=HS04636:hsp:18:3.2.0.0;Parent=HS04636:hit:9:3.2.0.0;Target=HS04636.g1 127 248 +;Gap=M122 +HS04636 est2genome match_part 2055 2198 8728 + . ID=HS04636:hsp:19:3.2.0.0;Parent=HS04636:hit:9:3.2.0.0;Target=HS04636.g1 249 392 +;Gap=M144 +HS04636 est2genome match_part 2852 2995 8728 + . ID=HS04636:hsp:20:3.2.0.0;Parent=HS04636:hit:9:3.2.0.0;Target=HS04636.g1 393 536 +;Gap=M144 +HS04636 est2genome match_part 3426 3607 8728 + . ID=HS04636:hsp:21:3.2.0.0;Parent=HS04636:hit:9:3.2.0.0;Target=HS04636.g1 537 718 +;Gap=M182 +HS04636 est2genome match_part 4340 4423 8728 + . ID=HS04636:hsp:22:3.2.0.0;Parent=HS04636:hit:9:3.2.0.0;Target=HS04636.g1 719 802 +;Gap=M84 +HS04636 est2genome match_part 4543 4789 8728 + . ID=HS04636:hsp:23:3.2.0.0;Parent=HS04636:hit:9:3.2.0.0;Target=HS04636.g1 803 1049 +;Gap=M247 +HS04636 est2genome match_part 5072 5358 8728 + . ID=HS04636:hsp:24:3.2.0.0;Parent=HS04636:hit:9:3.2.0.0;Target=HS04636.g1 1050 1336 +;Gap=M287 +HS04636 est2genome match_part 5860 6007 8728 + . ID=HS04636:hsp:25:3.2.0.0;Parent=HS04636:hit:9:3.2.0.0;Target=HS04636.g1 1337 1484 +;Gap=M148 +HS04636 est2genome match_part 6494 6903 8728 + . ID=HS04636:hsp:26:3.2.0.0;Parent=HS04636:hit:9:3.2.0.0;Target=HS04636.g1 1485 1894 +;Gap=M410
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/evidences_human.gff3 Thu Oct 19 15:58:39 2017 -0400 @@ -0,0 +1,99 @@ +##gff-version 3 +HS08198 . contig 1 2344 . . . ID=HS08198;Name=HS08198 +HS08198 augustus_masked match 445 1848 1 + . ID=HS08198:hit:15:4.5.0.0;Name=augustus_masked-HS08198-abinit-gene-0.2-mRNA-1 +HS08198 augustus_masked match_part 445 582 1 + . ID=HS08198:hsp:62:4.5.0.0;Parent=HS08198:hit:15:4.5.0.0;Target=augustus_masked-HS08198-abinit-gene-0.2-mRNA-1 1 138 +;Gap=M138 +HS08198 augustus_masked match_part 812 894 1 + . ID=HS08198:hsp:63:4.5.0.0;Parent=HS08198:hit:15:4.5.0.0;Target=augustus_masked-HS08198-abinit-gene-0.2-mRNA-1 139 221 +;Gap=M83 +HS08198 augustus_masked match_part 1053 1123 1 + . ID=HS08198:hsp:64:4.5.0.0;Parent=HS08198:hit:15:4.5.0.0;Target=augustus_masked-HS08198-abinit-gene-0.2-mRNA-1 222 292 +;Gap=M71 +HS08198 augustus_masked match_part 1208 1315 1 + . ID=HS08198:hsp:65:4.5.0.0;Parent=HS08198:hit:15:4.5.0.0;Target=augustus_masked-HS08198-abinit-gene-0.2-mRNA-1 293 400 +;Gap=M108 +HS08198 augustus_masked match_part 1587 1688 1 + . ID=HS08198:hsp:66:4.5.0.0;Parent=HS08198:hit:15:4.5.0.0;Target=augustus_masked-HS08198-abinit-gene-0.2-mRNA-1 401 502 +;Gap=M102 +HS08198 augustus_masked match_part 1772 1848 1 + . ID=HS08198:hsp:67:4.5.0.0;Parent=HS08198:hit:15:4.5.0.0;Target=augustus_masked-HS08198-abinit-gene-0.2-mRNA-1 503 579 +;Gap=M77 +HS08198 snap_masked match 99 1848 233.121 + . ID=HS08198:hit:16:4.5.0.0;Name=snap_masked-HS08198-abinit-gene-0.1-mRNA-1 +HS08198 snap_masked match_part 99 107 -2.800 + . ID=HS08198:hsp:68:4.5.0.0;Parent=HS08198:hit:16:4.5.0.0;Target=snap_masked-HS08198-abinit-gene-0.1-mRNA-1 1 9 +;Gap=M9 +HS08198 snap_masked match_part 421 582 45.298 + . ID=HS08198:hsp:69:4.5.0.0;Parent=HS08198:hit:16:4.5.0.0;Target=snap_masked-HS08198-abinit-gene-0.1-mRNA-1 10 171 +;Gap=M162 +HS08198 snap_masked match_part 812 874 24.711 + . ID=HS08198:hsp:70:4.5.0.0;Parent=HS08198:hit:16:4.5.0.0;Target=snap_masked-HS08198-abinit-gene-0.1-mRNA-1 172 234 +;Gap=M63 +HS08198 snap_masked match_part 1024 1123 34.281 + . ID=HS08198:hsp:71:4.5.0.0;Parent=HS08198:hit:16:4.5.0.0;Target=snap_masked-HS08198-abinit-gene-0.1-mRNA-1 235 334 +;Gap=M100 +HS08198 snap_masked match_part 1208 1315 53.852 + . ID=HS08198:hsp:72:4.5.0.0;Parent=HS08198:hit:16:4.5.0.0;Target=snap_masked-HS08198-abinit-gene-0.1-mRNA-1 335 442 +;Gap=M108 +HS08198 snap_masked match_part 1587 1688 41.983 + . ID=HS08198:hsp:73:4.5.0.0;Parent=HS08198:hit:16:4.5.0.0;Target=snap_masked-HS08198-abinit-gene-0.1-mRNA-1 443 544 +;Gap=M102 +HS08198 snap_masked match_part 1772 1848 35.796 + . ID=HS08198:hsp:74:4.5.0.0;Parent=HS08198:hit:16:4.5.0.0;Target=snap_masked-HS08198-abinit-gene-0.1-mRNA-1 545 621 +;Gap=M77 +### +HS08198 repeatmasker match 578 651 13 + . ID=HS08198:hit:12:1.3.0.0;Name=species:%28AGAAGGT%29n|genus:Simple_repeat;Target=species:%28AGAAGGT%29n|genus:Simple_repeat 1 75 + +HS08198 repeatmasker match_part 578 651 13 + . ID=HS08198:hsp:47:1.3.0.0;Parent=HS08198:hit:12:1.3.0.0;Target=species:%2528AGAAGGT%2529n|genus:Simple_repeat 1 75 + +### +HS08198 blastn expressed_sequence_match 444 1848 140 + . ID=HS08198:hit:13:3.2.0.0;Name=HS08198.g2 +HS08198 blastn match_part 444 583 140 + . ID=HS08198:hsp:48:3.2.0.0;Parent=HS08198:hit:13:3.2.0.0;Target=HS08198.g2 79 218 +;Gap=M140 +HS08198 blastn match_part 445 523 79 + . ID=HS08198:hsp:49:3.2.0.0;Parent=HS08198:hit:13:3.2.0.0;Target=HS08198.g2 1 79 +;Gap=M79 +HS08198 blastn match_part 808 895 88 + . ID=HS08198:hsp:50:3.2.0.0;Parent=HS08198:hit:13:3.2.0.0;Target=HS08198.g2 214 301 +;Gap=M88 +HS08198 blastn match_part 1053 1123 71 + . ID=HS08198:hsp:51:3.2.0.0;Parent=HS08198:hit:13:3.2.0.0;Target=HS08198.g2 301 371 +;Gap=M71 +HS08198 blastn match_part 1206 1315 110 + . ID=HS08198:hsp:52:3.2.0.0;Parent=HS08198:hit:13:3.2.0.0;Target=HS08198.g2 370 479 +;Gap=M110 +HS08198 blastn match_part 1586 1689 104 + . ID=HS08198:hsp:53:3.2.0.0;Parent=HS08198:hit:13:3.2.0.0;Target=HS08198.g2 479 582 +;Gap=M104 +HS08198 blastn match_part 1771 1848 78 + . ID=HS08198:hsp:54:3.2.0.0;Parent=HS08198:hit:13:3.2.0.0;Target=HS08198.g2 581 658 +;Gap=M78 +HS08198 est2genome expressed_sequence_match 352 1848 2869 + . ID=HS08198:hit:14:3.2.0.0;Name=HS08198.g2 +HS08198 est2genome match_part 352 397 2869 + . ID=HS08198:hsp:55:3.2.0.0;Parent=HS08198:hit:14:3.2.0.0;Target=HS08198.g2 3 52 +;Gap=M18 D1 M2 I4 M10 I1 M15 +HS08198 est2genome match_part 421 582 2869 + . ID=HS08198:hsp:56:3.2.0.0;Parent=HS08198:hit:14:3.2.0.0;Target=HS08198.g2 53 217 +;Gap=M4 I2 M3 I3 M5 D1 M9 D1 M139 +HS08198 est2genome match_part 812 894 2869 + . ID=HS08198:hsp:57:3.2.0.0;Parent=HS08198:hit:14:3.2.0.0;Target=HS08198.g2 218 300 +;Gap=M83 +HS08198 est2genome match_part 1053 1123 2869 + . ID=HS08198:hsp:58:3.2.0.0;Parent=HS08198:hit:14:3.2.0.0;Target=HS08198.g2 301 371 +;Gap=M71 +HS08198 est2genome match_part 1208 1315 2869 + . ID=HS08198:hsp:59:3.2.0.0;Parent=HS08198:hit:14:3.2.0.0;Target=HS08198.g2 372 479 +;Gap=M108 +HS08198 est2genome match_part 1587 1688 2869 + . ID=HS08198:hsp:60:3.2.0.0;Parent=HS08198:hit:14:3.2.0.0;Target=HS08198.g2 480 581 +;Gap=M102 +HS08198 est2genome match_part 1772 1848 2869 + . ID=HS08198:hsp:61:3.2.0.0;Parent=HS08198:hit:14:3.2.0.0;Target=HS08198.g2 582 658 +;Gap=M77 +HS04636 . contig 1 9453 . . . ID=HS04636;Name=HS04636 +HS04636 augustus_masked match 966 6903 1 + . ID=HS04636:hit:10:4.5.0.0;Name=augustus_masked-HS04636-abinit-gene-0.3-mRNA-1 +HS04636 augustus_masked match_part 966 1017 1 + . ID=HS04636:hsp:27:4.5.0.0;Parent=HS04636:hit:10:4.5.0.0;Target=augustus_masked-HS04636-abinit-gene-0.3-mRNA-1 1 52 +;Gap=M52 +HS04636 augustus_masked match_part 1818 1934 1 + . ID=HS04636:hsp:28:4.5.0.0;Parent=HS04636:hit:10:4.5.0.0;Target=augustus_masked-HS04636-abinit-gene-0.3-mRNA-1 53 169 +;Gap=M117 +HS04636 augustus_masked match_part 2055 2198 1 + . ID=HS04636:hsp:29:4.5.0.0;Parent=HS04636:hit:10:4.5.0.0;Target=augustus_masked-HS04636-abinit-gene-0.3-mRNA-1 170 313 +;Gap=M144 +HS04636 augustus_masked match_part 2852 2995 1 + . ID=HS04636:hsp:30:4.5.0.0;Parent=HS04636:hit:10:4.5.0.0;Target=augustus_masked-HS04636-abinit-gene-0.3-mRNA-1 314 457 +;Gap=M144 +HS04636 augustus_masked match_part 3426 3607 1 + . ID=HS04636:hsp:31:4.5.0.0;Parent=HS04636:hit:10:4.5.0.0;Target=augustus_masked-HS04636-abinit-gene-0.3-mRNA-1 458 639 +;Gap=M182 +HS04636 augustus_masked match_part 4340 4423 1 + . ID=HS04636:hsp:32:4.5.0.0;Parent=HS04636:hit:10:4.5.0.0;Target=augustus_masked-HS04636-abinit-gene-0.3-mRNA-1 640 723 +;Gap=M84 +HS04636 augustus_masked match_part 4543 4789 1 + . ID=HS04636:hsp:33:4.5.0.0;Parent=HS04636:hit:10:4.5.0.0;Target=augustus_masked-HS04636-abinit-gene-0.3-mRNA-1 724 970 +;Gap=M247 +HS04636 augustus_masked match_part 5072 5358 1 + . ID=HS04636:hsp:34:4.5.0.0;Parent=HS04636:hit:10:4.5.0.0;Target=augustus_masked-HS04636-abinit-gene-0.3-mRNA-1 971 1257 +;Gap=M287 +HS04636 augustus_masked match_part 5860 6007 1 + . ID=HS04636:hsp:35:4.5.0.0;Parent=HS04636:hit:10:4.5.0.0;Target=augustus_masked-HS04636-abinit-gene-0.3-mRNA-1 1258 1405 +;Gap=M148 +HS04636 augustus_masked match_part 6494 6903 1 + . ID=HS04636:hsp:36:4.5.0.0;Parent=HS04636:hit:10:4.5.0.0;Target=augustus_masked-HS04636-abinit-gene-0.3-mRNA-1 1406 1815 +;Gap=M410 +HS04636 snap_masked match 1862 6903 761.916 + . ID=HS04636:hit:11:4.5.0.0;Name=snap_masked-HS04636-abinit-gene-0.1-mRNA-1 +HS04636 snap_masked match_part 1862 1867 8.523 + . ID=HS04636:hsp:37:4.5.0.0;Parent=HS04636:hit:11:4.5.0.0;Target=snap_masked-HS04636-abinit-gene-0.1-mRNA-1 1 6 +;Gap=M6 +HS04636 snap_masked match_part 1883 1934 20.348 + . ID=HS04636:hsp:38:4.5.0.0;Parent=HS04636:hit:11:4.5.0.0;Target=snap_masked-HS04636-abinit-gene-0.1-mRNA-1 7 58 +;Gap=M52 +HS04636 snap_masked match_part 2055 2198 69.846 + . ID=HS04636:hsp:39:4.5.0.0;Parent=HS04636:hit:11:4.5.0.0;Target=snap_masked-HS04636-abinit-gene-0.1-mRNA-1 59 202 +;Gap=M144 +HS04636 snap_masked match_part 2852 2995 67.055 + . ID=HS04636:hsp:40:4.5.0.0;Parent=HS04636:hit:11:4.5.0.0;Target=snap_masked-HS04636-abinit-gene-0.1-mRNA-1 203 346 +;Gap=M144 +HS04636 snap_masked match_part 3426 3607 77.942 + . ID=HS04636:hsp:41:4.5.0.0;Parent=HS04636:hit:11:4.5.0.0;Target=snap_masked-HS04636-abinit-gene-0.1-mRNA-1 347 528 +;Gap=M182 +HS04636 snap_masked match_part 4340 4423 47.588 + . ID=HS04636:hsp:42:4.5.0.0;Parent=HS04636:hit:11:4.5.0.0;Target=snap_masked-HS04636-abinit-gene-0.1-mRNA-1 529 612 +;Gap=M84 +HS04636 snap_masked match_part 4543 4789 112.472 + . ID=HS04636:hsp:43:4.5.0.0;Parent=HS04636:hit:11:4.5.0.0;Target=snap_masked-HS04636-abinit-gene-0.1-mRNA-1 613 859 +;Gap=M247 +HS04636 snap_masked match_part 5072 5358 122.974 + . ID=HS04636:hsp:44:4.5.0.0;Parent=HS04636:hit:11:4.5.0.0;Target=snap_masked-HS04636-abinit-gene-0.1-mRNA-1 860 1146 +;Gap=M287 +HS04636 snap_masked match_part 5860 6007 72.046 + . ID=HS04636:hsp:45:4.5.0.0;Parent=HS04636:hit:11:4.5.0.0;Target=snap_masked-HS04636-abinit-gene-0.1-mRNA-1 1147 1294 +;Gap=M148 +HS04636 snap_masked match_part 6494 6903 163.122 + . ID=HS04636:hsp:46:4.5.0.0;Parent=HS04636:hit:11:4.5.0.0;Target=snap_masked-HS04636-abinit-gene-0.1-mRNA-1 1295 1704 +;Gap=M410 +### +HS04636 repeatmasker match 3852 3888 12 + . ID=HS04636:hit:0:1.3.0.0;Name=species:%28TTGTAAT%29n|genus:Simple_repeat;Target=species:%28TTGTAAT%29n|genus:Simple_repeat 1 37 + +HS04636 repeatmasker match_part 3852 3888 12 + . ID=HS04636:hsp:0:1.3.0.0;Parent=HS04636:hit:0:1.3.0.0;Target=species:%2528TTGTAAT%2529n|genus:Simple_repeat 1 37 + +HS04636 repeatmasker match 4518 4541 17 + . ID=HS04636:hit:1:1.3.0.0;Name=species:%28TTTA%29n|genus:Simple_repeat;Target=species:%28TTTA%29n|genus:Simple_repeat 1 24 + +HS04636 repeatmasker match_part 4518 4541 17 + . ID=HS04636:hsp:1:1.3.0.0;Parent=HS04636:hit:1:1.3.0.0;Target=species:%2528TTTA%2529n|genus:Simple_repeat 1 24 + +HS04636 repeatmasker match 939 980 13 + . ID=HS04636:hit:2:1.3.0.0;Name=species:%28CCGCG%29n|genus:Simple_repeat;Target=species:%28CCGCG%29n|genus:Simple_repeat 1 42 + +HS04636 repeatmasker match_part 939 980 13 + . ID=HS04636:hsp:2:1.3.0.0;Parent=HS04636:hit:2:1.3.0.0;Target=species:%2528CCGCG%2529n|genus:Simple_repeat 1 42 + +HS04636 repeatmasker match 3791 3839 22 + . ID=HS04636:hit:3:1.3.0.0;Name=species:%28AC%29n|genus:Simple_repeat;Target=species:%28AC%29n|genus:Simple_repeat 1 49 + +HS04636 repeatmasker match_part 3791 3839 22 + . ID=HS04636:hsp:3:1.3.0.0;Parent=HS04636:hit:3:1.3.0.0;Target=species:%2528AC%2529n|genus:Simple_repeat 1 49 + +HS04636 repeatmasker match 6028 6072 21 + . ID=HS04636:hit:4:1.3.0.0;Name=species:%28TTGT%29n|genus:Simple_repeat;Target=species:%28TTGT%29n|genus:Simple_repeat 1 46 + +HS04636 repeatmasker match_part 6028 6072 21 + . ID=HS04636:hsp:4:1.3.0.0;Parent=HS04636:hit:4:1.3.0.0;Target=species:%2528TTGT%2529n|genus:Simple_repeat 1 46 + +HS04636 repeatmasker match 6918 6977 17 + . ID=HS04636:hit:5:1.3.0.0;Name=species:%28TATT%29n|genus:Simple_repeat;Target=species:%28TATT%29n|genus:Simple_repeat 1 54 + +HS04636 repeatmasker match_part 6918 6977 17 + . ID=HS04636:hsp:5:1.3.0.0;Parent=HS04636:hit:5:1.3.0.0;Target=species:%2528TATT%2529n|genus:Simple_repeat 1 54 + +HS04636 repeatmasker match 3840 3847 17 + . ID=HS04636:hit:6:1.3.0.0;Name=species:%28ATAC%29n|genus:Simple_repeat;Target=species:%28ATAC%29n|genus:Simple_repeat 3 57 + +HS04636 repeatmasker match_part 3840 3847 17 + . ID=HS04636:hsp:6:1.3.0.0;Parent=HS04636:hit:6:1.3.0.0;Target=species:%2528ATAC%2529n|genus:Simple_repeat 3 57 + +HS04636 repeatmasker match 9419 9435 16 + . ID=HS04636:hit:7:1.3.0.0;Name=species:%28A%29n|genus:Simple_repeat;Target=species:%28A%29n|genus:Simple_repeat 1 17 + +HS04636 repeatmasker match_part 9419 9435 16 + . ID=HS04636:hsp:7:1.3.0.0;Parent=HS04636:hit:7:1.3.0.0;Target=species:%2528A%2529n|genus:Simple_repeat 1 17 + +### +HS04636 blastn expressed_sequence_match 1815 6903 120 + . ID=HS04636:hit:8:3.2.0.0;Name=HS04636.g1 +HS04636 blastn match_part 1815 1934 120 + . ID=HS04636:hsp:8:3.2.0.0;Parent=HS04636:hit:8:3.2.0.0;Target=HS04636.g1 129 248 +;Gap=M120 +HS04636 blastn match_part 1815 1845 31 + . ID=HS04636:hsp:9:3.2.0.0;Parent=HS04636:hit:8:3.2.0.0;Target=HS04636.g1 50 80 +;Gap=M31 +HS04636 blastn match_part 2055 2198 144 + . ID=HS04636:hsp:10:3.2.0.0;Parent=HS04636:hit:8:3.2.0.0;Target=HS04636.g1 249 392 +;Gap=M144 +HS04636 blastn match_part 2852 2997 146 + . ID=HS04636:hsp:11:3.2.0.0;Parent=HS04636:hit:8:3.2.0.0;Target=HS04636.g1 393 538 +;Gap=M146 +HS04636 blastn match_part 3424 3609 186 + . ID=HS04636:hsp:12:3.2.0.0;Parent=HS04636:hit:8:3.2.0.0;Target=HS04636.g1 535 720 +;Gap=M186 +HS04636 blastn match_part 4339 4423 85 + . ID=HS04636:hsp:13:3.2.0.0;Parent=HS04636:hit:8:3.2.0.0;Target=HS04636.g1 718 802 +;Gap=M85 +HS04636 blastn match_part 4541 4790 250 + . ID=HS04636:hsp:14:3.2.0.0;Parent=HS04636:hit:8:3.2.0.0;Target=HS04636.g1 801 1050 +;Gap=M250 +HS04636 blastn match_part 5068 5360 293 + . ID=HS04636:hsp:15:3.2.0.0;Parent=HS04636:hit:8:3.2.0.0;Target=HS04636.g1 1046 1338 +;Gap=M293 +HS04636 blastn match_part 5859 6008 150 + . ID=HS04636:hsp:16:3.2.0.0;Parent=HS04636:hit:8:3.2.0.0;Target=HS04636.g1 1336 1485 +;Gap=M150 +HS04636 blastn match_part 6490 6903 414 + . ID=HS04636:hsp:17:3.2.0.0;Parent=HS04636:hit:8:3.2.0.0;Target=HS04636.g1 1481 1894 +;Gap=M414 +HS04636 est2genome expressed_sequence_match 1813 6903 8728 + . ID=HS04636:hit:9:3.2.0.0;Name=HS04636.g1 +HS04636 est2genome match_part 1813 1934 8728 + . ID=HS04636:hsp:18:3.2.0.0;Parent=HS04636:hit:9:3.2.0.0;Target=HS04636.g1 127 248 +;Gap=M122 +HS04636 est2genome match_part 2055 2198 8728 + . ID=HS04636:hsp:19:3.2.0.0;Parent=HS04636:hit:9:3.2.0.0;Target=HS04636.g1 249 392 +;Gap=M144 +HS04636 est2genome match_part 2852 2995 8728 + . ID=HS04636:hsp:20:3.2.0.0;Parent=HS04636:hit:9:3.2.0.0;Target=HS04636.g1 393 536 +;Gap=M144 +HS04636 est2genome match_part 3426 3607 8728 + . ID=HS04636:hsp:21:3.2.0.0;Parent=HS04636:hit:9:3.2.0.0;Target=HS04636.g1 537 718 +;Gap=M182 +HS04636 est2genome match_part 4340 4423 8728 + . ID=HS04636:hsp:22:3.2.0.0;Parent=HS04636:hit:9:3.2.0.0;Target=HS04636.g1 719 802 +;Gap=M84 +HS04636 est2genome match_part 4543 4789 8728 + . ID=HS04636:hsp:23:3.2.0.0;Parent=HS04636:hit:9:3.2.0.0;Target=HS04636.g1 803 1049 +;Gap=M247 +HS04636 est2genome match_part 5072 5358 8728 + . ID=HS04636:hsp:24:3.2.0.0;Parent=HS04636:hit:9:3.2.0.0;Target=HS04636.g1 1050 1336 +;Gap=M287 +HS04636 est2genome match_part 5860 6007 8728 + . ID=HS04636:hsp:25:3.2.0.0;Parent=HS04636:hit:9:3.2.0.0;Target=HS04636.g1 1337 1484 +;Gap=M148 +HS04636 est2genome match_part 6494 6903 8728 + . ID=HS04636:hsp:26:3.2.0.0;Parent=HS04636:hit:9:3.2.0.0;Target=HS04636.g1 1485 1894 +;Gap=M410
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/evidences_model.gff3 Thu Oct 19 15:58:39 2017 -0400 @@ -0,0 +1,42 @@ +##gff-version 3 +HS08198 . contig 1 2344 . . . ID=HS08198;Name=HS08198 +### +HS08198 blastn expressed_sequence_match 444 1848 140 + . ID=HS08198:hit:2:3.2.0.0;Name=HS08198.g2 +HS08198 blastn match_part 444 583 140 + . ID=HS08198:hsp:19:3.2.0.0;Parent=HS08198:hit:2:3.2.0.0;Target=HS08198.g2 79 218 +;Gap=M140 +HS08198 blastn match_part 445 523 79 + . ID=HS08198:hsp:20:3.2.0.0;Parent=HS08198:hit:2:3.2.0.0;Target=HS08198.g2 1 79 +;Gap=M79 +HS08198 blastn match_part 808 895 88 + . ID=HS08198:hsp:21:3.2.0.0;Parent=HS08198:hit:2:3.2.0.0;Target=HS08198.g2 214 301 +;Gap=M88 +HS08198 blastn match_part 1053 1123 71 + . ID=HS08198:hsp:22:3.2.0.0;Parent=HS08198:hit:2:3.2.0.0;Target=HS08198.g2 301 371 +;Gap=M71 +HS08198 blastn match_part 1206 1315 110 + . ID=HS08198:hsp:23:3.2.0.0;Parent=HS08198:hit:2:3.2.0.0;Target=HS08198.g2 370 479 +;Gap=M110 +HS08198 blastn match_part 1586 1689 104 + . ID=HS08198:hsp:24:3.2.0.0;Parent=HS08198:hit:2:3.2.0.0;Target=HS08198.g2 479 582 +;Gap=M104 +HS08198 blastn match_part 1771 1848 78 + . ID=HS08198:hsp:25:3.2.0.0;Parent=HS08198:hit:2:3.2.0.0;Target=HS08198.g2 581 658 +;Gap=M78 +HS08198 est2genome expressed_sequence_match 352 1848 2869 + . ID=HS08198:hit:3:3.2.0.0;Name=HS08198.g2 +HS08198 est2genome match_part 352 397 2869 + . ID=HS08198:hsp:26:3.2.0.0;Parent=HS08198:hit:3:3.2.0.0;Target=HS08198.g2 3 52 +;Gap=M18 D1 M2 I4 M10 I1 M15 +HS08198 est2genome match_part 421 582 2869 + . ID=HS08198:hsp:27:3.2.0.0;Parent=HS08198:hit:3:3.2.0.0;Target=HS08198.g2 53 217 +;Gap=M4 I2 M3 I3 M5 D1 M9 D1 M139 +HS08198 est2genome match_part 812 894 2869 + . ID=HS08198:hsp:28:3.2.0.0;Parent=HS08198:hit:3:3.2.0.0;Target=HS08198.g2 218 300 +;Gap=M83 +HS08198 est2genome match_part 1053 1123 2869 + . ID=HS08198:hsp:29:3.2.0.0;Parent=HS08198:hit:3:3.2.0.0;Target=HS08198.g2 301 371 +;Gap=M71 +HS08198 est2genome match_part 1208 1315 2869 + . ID=HS08198:hsp:30:3.2.0.0;Parent=HS08198:hit:3:3.2.0.0;Target=HS08198.g2 372 479 +;Gap=M108 +HS08198 est2genome match_part 1587 1688 2869 + . ID=HS08198:hsp:31:3.2.0.0;Parent=HS08198:hit:3:3.2.0.0;Target=HS08198.g2 480 581 +;Gap=M102 +HS08198 est2genome match_part 1772 1848 2869 + . ID=HS08198:hsp:32:3.2.0.0;Parent=HS08198:hit:3:3.2.0.0;Target=HS08198.g2 582 658 +;Gap=M77 +HS04636 . contig 1 9453 . . . ID=HS04636;Name=HS04636 +### +HS04636 blastn expressed_sequence_match 1815 6903 120 + . ID=HS04636:hit:0:3.2.0.0;Name=HS04636.g1 +HS04636 blastn match_part 1815 1934 120 + . ID=HS04636:hsp:0:3.2.0.0;Parent=HS04636:hit:0:3.2.0.0;Target=HS04636.g1 129 248 +;Gap=M120 +HS04636 blastn match_part 1815 1845 31 + . ID=HS04636:hsp:1:3.2.0.0;Parent=HS04636:hit:0:3.2.0.0;Target=HS04636.g1 50 80 +;Gap=M31 +HS04636 blastn match_part 2055 2198 144 + . ID=HS04636:hsp:2:3.2.0.0;Parent=HS04636:hit:0:3.2.0.0;Target=HS04636.g1 249 392 +;Gap=M144 +HS04636 blastn match_part 2852 2997 146 + . ID=HS04636:hsp:3:3.2.0.0;Parent=HS04636:hit:0:3.2.0.0;Target=HS04636.g1 393 538 +;Gap=M146 +HS04636 blastn match_part 3424 3609 186 + . ID=HS04636:hsp:4:3.2.0.0;Parent=HS04636:hit:0:3.2.0.0;Target=HS04636.g1 535 720 +;Gap=M186 +HS04636 blastn match_part 4339 4423 85 + . ID=HS04636:hsp:5:3.2.0.0;Parent=HS04636:hit:0:3.2.0.0;Target=HS04636.g1 718 802 +;Gap=M85 +HS04636 blastn match_part 4541 4790 250 + . ID=HS04636:hsp:6:3.2.0.0;Parent=HS04636:hit:0:3.2.0.0;Target=HS04636.g1 801 1050 +;Gap=M250 +HS04636 blastn match_part 5068 5360 293 + . ID=HS04636:hsp:7:3.2.0.0;Parent=HS04636:hit:0:3.2.0.0;Target=HS04636.g1 1046 1338 +;Gap=M293 +HS04636 blastn match_part 5859 6008 150 + . ID=HS04636:hsp:8:3.2.0.0;Parent=HS04636:hit:0:3.2.0.0;Target=HS04636.g1 1336 1485 +;Gap=M150 +HS04636 blastn match_part 6490 6903 414 + . ID=HS04636:hsp:9:3.2.0.0;Parent=HS04636:hit:0:3.2.0.0;Target=HS04636.g1 1481 1894 +;Gap=M414 +HS04636 est2genome expressed_sequence_match 1813 6903 8728 + . ID=HS04636:hit:1:3.2.0.0;Name=HS04636.g1 +HS04636 est2genome match_part 1813 1934 8728 + . ID=HS04636:hsp:10:3.2.0.0;Parent=HS04636:hit:1:3.2.0.0;Target=HS04636.g1 127 248 +;Gap=M122 +HS04636 est2genome match_part 2055 2198 8728 + . ID=HS04636:hsp:11:3.2.0.0;Parent=HS04636:hit:1:3.2.0.0;Target=HS04636.g1 249 392 +;Gap=M144 +HS04636 est2genome match_part 2852 2995 8728 + . ID=HS04636:hsp:12:3.2.0.0;Parent=HS04636:hit:1:3.2.0.0;Target=HS04636.g1 393 536 +;Gap=M144 +HS04636 est2genome match_part 3426 3607 8728 + . ID=HS04636:hsp:13:3.2.0.0;Parent=HS04636:hit:1:3.2.0.0;Target=HS04636.g1 537 718 +;Gap=M182 +HS04636 est2genome match_part 4340 4423 8728 + . ID=HS04636:hsp:14:3.2.0.0;Parent=HS04636:hit:1:3.2.0.0;Target=HS04636.g1 719 802 +;Gap=M84 +HS04636 est2genome match_part 4543 4789 8728 + . ID=HS04636:hsp:15:3.2.0.0;Parent=HS04636:hit:1:3.2.0.0;Target=HS04636.g1 803 1049 +;Gap=M247 +HS04636 est2genome match_part 5072 5358 8728 + . ID=HS04636:hsp:16:3.2.0.0;Parent=HS04636:hit:1:3.2.0.0;Target=HS04636.g1 1050 1336 +;Gap=M287 +HS04636 est2genome match_part 5860 6007 8728 + . ID=HS04636:hsp:17:3.2.0.0;Parent=HS04636:hit:1:3.2.0.0;Target=HS04636.g1 1337 1484 +;Gap=M148 +HS04636 est2genome match_part 6494 6903 8728 + . ID=HS04636:hsp:18:3.2.0.0;Parent=HS04636:hit:1:3.2.0.0;Target=HS04636.g1 1485 1894 +;Gap=M410
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/evidences_norm.gff3 Thu Oct 19 15:58:39 2017 -0400 @@ -0,0 +1,42 @@ +##gff-version 3 +HS08198 . contig 1 2344 . . . ID=HS08198;Name=HS08198 +### +HS08198 blastn expressed_sequence_match 444 1848 140 + . ID=HS08198:hit:2:3.2.0.0;Name=HS08198.g2 +HS08198 blastn match_part 444 583 140 + . ID=HS08198:hsp:19:3.2.0.0;Parent=HS08198:hit:2:3.2.0.0;Target=HS08198.g2 79 218 +;Gap=M140 +HS08198 blastn match_part 445 523 79 + . ID=HS08198:hsp:20:3.2.0.0;Parent=HS08198:hit:2:3.2.0.0;Target=HS08198.g2 1 79 +;Gap=M79 +HS08198 blastn match_part 808 895 88 + . ID=HS08198:hsp:21:3.2.0.0;Parent=HS08198:hit:2:3.2.0.0;Target=HS08198.g2 214 301 +;Gap=M88 +HS08198 blastn match_part 1053 1123 71 + . ID=HS08198:hsp:22:3.2.0.0;Parent=HS08198:hit:2:3.2.0.0;Target=HS08198.g2 301 371 +;Gap=M71 +HS08198 blastn match_part 1206 1315 110 + . ID=HS08198:hsp:23:3.2.0.0;Parent=HS08198:hit:2:3.2.0.0;Target=HS08198.g2 370 479 +;Gap=M110 +HS08198 blastn match_part 1586 1689 104 + . ID=HS08198:hsp:24:3.2.0.0;Parent=HS08198:hit:2:3.2.0.0;Target=HS08198.g2 479 582 +;Gap=M104 +HS08198 blastn match_part 1771 1848 78 + . ID=HS08198:hsp:25:3.2.0.0;Parent=HS08198:hit:2:3.2.0.0;Target=HS08198.g2 581 658 +;Gap=M78 +HS08198 est2genome expressed_sequence_match 352 1848 2869 + . ID=HS08198:hit:3:3.2.0.0;Name=HS08198.g2 +HS08198 est2genome match_part 352 397 2869 + . ID=HS08198:hsp:26:3.2.0.0;Parent=HS08198:hit:3:3.2.0.0;Target=HS08198.g2 3 52 +;Gap=M18 D1 M2 I4 M10 I1 M15 +HS08198 est2genome match_part 421 582 2869 + . ID=HS08198:hsp:27:3.2.0.0;Parent=HS08198:hit:3:3.2.0.0;Target=HS08198.g2 53 217 +;Gap=M4 I2 M3 I3 M5 D1 M9 D1 M139 +HS08198 est2genome match_part 812 894 2869 + . ID=HS08198:hsp:28:3.2.0.0;Parent=HS08198:hit:3:3.2.0.0;Target=HS08198.g2 218 300 +;Gap=M83 +HS08198 est2genome match_part 1053 1123 2869 + . ID=HS08198:hsp:29:3.2.0.0;Parent=HS08198:hit:3:3.2.0.0;Target=HS08198.g2 301 371 +;Gap=M71 +HS08198 est2genome match_part 1208 1315 2869 + . ID=HS08198:hsp:30:3.2.0.0;Parent=HS08198:hit:3:3.2.0.0;Target=HS08198.g2 372 479 +;Gap=M108 +HS08198 est2genome match_part 1587 1688 2869 + . ID=HS08198:hsp:31:3.2.0.0;Parent=HS08198:hit:3:3.2.0.0;Target=HS08198.g2 480 581 +;Gap=M102 +HS08198 est2genome match_part 1772 1848 2869 + . ID=HS08198:hsp:32:3.2.0.0;Parent=HS08198:hit:3:3.2.0.0;Target=HS08198.g2 582 658 +;Gap=M77 +HS04636 . contig 1 9453 . . . ID=HS04636;Name=HS04636 +### +HS04636 blastn expressed_sequence_match 1815 6903 120 + . ID=HS04636:hit:0:3.2.0.0;Name=HS04636.g1 +HS04636 blastn match_part 1815 1934 120 + . ID=HS04636:hsp:0:3.2.0.0;Parent=HS04636:hit:0:3.2.0.0;Target=HS04636.g1 129 248 +;Gap=M120 +HS04636 blastn match_part 1815 1845 31 + . ID=HS04636:hsp:1:3.2.0.0;Parent=HS04636:hit:0:3.2.0.0;Target=HS04636.g1 50 80 +;Gap=M31 +HS04636 blastn match_part 2055 2198 144 + . ID=HS04636:hsp:2:3.2.0.0;Parent=HS04636:hit:0:3.2.0.0;Target=HS04636.g1 249 392 +;Gap=M144 +HS04636 blastn match_part 2852 2997 146 + . ID=HS04636:hsp:3:3.2.0.0;Parent=HS04636:hit:0:3.2.0.0;Target=HS04636.g1 393 538 +;Gap=M146 +HS04636 blastn match_part 3424 3609 186 + . ID=HS04636:hsp:4:3.2.0.0;Parent=HS04636:hit:0:3.2.0.0;Target=HS04636.g1 535 720 +;Gap=M186 +HS04636 blastn match_part 4339 4423 85 + . ID=HS04636:hsp:5:3.2.0.0;Parent=HS04636:hit:0:3.2.0.0;Target=HS04636.g1 718 802 +;Gap=M85 +HS04636 blastn match_part 4541 4790 250 + . ID=HS04636:hsp:6:3.2.0.0;Parent=HS04636:hit:0:3.2.0.0;Target=HS04636.g1 801 1050 +;Gap=M250 +HS04636 blastn match_part 5068 5360 293 + . ID=HS04636:hsp:7:3.2.0.0;Parent=HS04636:hit:0:3.2.0.0;Target=HS04636.g1 1046 1338 +;Gap=M293 +HS04636 blastn match_part 5859 6008 150 + . ID=HS04636:hsp:8:3.2.0.0;Parent=HS04636:hit:0:3.2.0.0;Target=HS04636.g1 1336 1485 +;Gap=M150 +HS04636 blastn match_part 6490 6903 414 + . ID=HS04636:hsp:9:3.2.0.0;Parent=HS04636:hit:0:3.2.0.0;Target=HS04636.g1 1481 1894 +;Gap=M414 +HS04636 est2genome expressed_sequence_match 1813 6903 8728 + . ID=HS04636:hit:1:3.2.0.0;Name=HS04636.g1 +HS04636 est2genome match_part 1813 1934 8728 + . ID=HS04636:hsp:10:3.2.0.0;Parent=HS04636:hit:1:3.2.0.0;Target=HS04636.g1 127 248 +;Gap=M122 +HS04636 est2genome match_part 2055 2198 8728 + . ID=HS04636:hsp:11:3.2.0.0;Parent=HS04636:hit:1:3.2.0.0;Target=HS04636.g1 249 392 +;Gap=M144 +HS04636 est2genome match_part 2852 2995 8728 + . ID=HS04636:hsp:12:3.2.0.0;Parent=HS04636:hit:1:3.2.0.0;Target=HS04636.g1 393 536 +;Gap=M144 +HS04636 est2genome match_part 3426 3607 8728 + . ID=HS04636:hsp:13:3.2.0.0;Parent=HS04636:hit:1:3.2.0.0;Target=HS04636.g1 537 718 +;Gap=M182 +HS04636 est2genome match_part 4340 4423 8728 + . ID=HS04636:hsp:14:3.2.0.0;Parent=HS04636:hit:1:3.2.0.0;Target=HS04636.g1 719 802 +;Gap=M84 +HS04636 est2genome match_part 4543 4789 8728 + . ID=HS04636:hsp:15:3.2.0.0;Parent=HS04636:hit:1:3.2.0.0;Target=HS04636.g1 803 1049 +;Gap=M247 +HS04636 est2genome match_part 5072 5358 8728 + . ID=HS04636:hsp:16:3.2.0.0;Parent=HS04636:hit:1:3.2.0.0;Target=HS04636.g1 1050 1336 +;Gap=M287 +HS04636 est2genome match_part 5860 6007 8728 + . ID=HS04636:hsp:17:3.2.0.0;Parent=HS04636:hit:1:3.2.0.0;Target=HS04636.g1 1337 1484 +;Gap=M148 +HS04636 est2genome match_part 6494 6903 8728 + . ID=HS04636:hsp:18:3.2.0.0;Parent=HS04636:hit:1:3.2.0.0;Target=HS04636.g1 1485 1894 +;Gap=M410
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/evidences_proc.gff3 Thu Oct 19 15:58:39 2017 -0400 @@ -0,0 +1,5 @@ +##gff-version 3 +HS08198 . contig 1 2344 . . . ID=HS08198;Name=HS08198 +### +HS04636 . contig 1 9453 . . . ID=HS04636;Name=HS04636 +###
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/evidences_reuse.gff3 Thu Oct 19 15:58:39 2017 -0400 @@ -0,0 +1,62 @@ +##gff-version 3 +HS08198 . contig 1 2344 . . . ID=HS08198;Name=HS08198 +### +HS08198 repeatmasker match 578 651 13 + . ID=HS08198:hit:10:1.3.0.0;Name=species:%28AGAAGGT%29n|genus:Simple_repeat;Target=species:%28AGAAGGT%29n|genus:Simple_repeat 1 75 + +HS08198 repeatmasker match_part 578 651 13 + . ID=HS08198:hsp:27:1.3.0.0;Parent=HS08198:hit:10:1.3.0.0;Target=species:%2528AGAAGGT%2529n|genus:Simple_repeat 1 75 + +### +HS08198 blastn expressed_sequence_match 444 1848 140 + . ID=HS08198:hit:11:3.12.0.0;Name=HS08198.g2;score=140 +HS08198 blastn match_part 444 583 140 + . ID=HS08198:hsp:28:3.12.0.0;Parent=HS08198:hit:11:3.12.0.0;Target=HS08198.g2 79 218 +;Gap=M140 +HS08198 blastn match_part 445 523 79 + . ID=HS08198:hsp:29:3.12.0.0;Parent=HS08198:hit:11:3.12.0.0;Target=HS08198.g2 1 79 +;Gap=M79 +HS08198 blastn match_part 808 895 88 + . ID=HS08198:hsp:30:3.12.0.0;Parent=HS08198:hit:11:3.12.0.0;Target=HS08198.g2 214 301 +;Gap=M88 +HS08198 blastn match_part 1053 1123 71 + . ID=HS08198:hsp:31:3.12.0.0;Parent=HS08198:hit:11:3.12.0.0;Target=HS08198.g2 301 371 +;Gap=M71 +HS08198 blastn match_part 1206 1315 110 + . ID=HS08198:hsp:32:3.12.0.0;Parent=HS08198:hit:11:3.12.0.0;Target=HS08198.g2 370 479 +;Gap=M110 +HS08198 blastn match_part 1586 1689 104 + . ID=HS08198:hsp:33:3.12.0.0;Parent=HS08198:hit:11:3.12.0.0;Target=HS08198.g2 479 582 +;Gap=M104 +HS08198 blastn match_part 1771 1848 78 + . ID=HS08198:hsp:34:3.12.0.0;Parent=HS08198:hit:11:3.12.0.0;Target=HS08198.g2 581 658 +;Gap=M78 +HS08198 est2genome expressed_sequence_match 352 1848 2869 + . ID=HS08198:hit:12:3.12.0.0;Name=HS08198.g2;score=2869 +HS08198 est2genome match_part 352 397 2869 + . ID=HS08198:hsp:35:3.12.0.0;Parent=HS08198:hit:12:3.12.0.0;Target=HS08198.g2 3 52 +;Gap=M46 +HS08198 est2genome match_part 421 582 2869 + . ID=HS08198:hsp:36:3.12.0.0;Parent=HS08198:hit:12:3.12.0.0;Target=HS08198.g2 53 217 +;Gap=M162 +HS08198 est2genome match_part 812 894 2869 + . ID=HS08198:hsp:37:3.12.0.0;Parent=HS08198:hit:12:3.12.0.0;Target=HS08198.g2 218 300 +;Gap=M83 +HS08198 est2genome match_part 1053 1123 2869 + . ID=HS08198:hsp:38:3.12.0.0;Parent=HS08198:hit:12:3.12.0.0;Target=HS08198.g2 301 371 +;Gap=M71 +HS08198 est2genome match_part 1208 1315 2869 + . ID=HS08198:hsp:39:3.12.0.0;Parent=HS08198:hit:12:3.12.0.0;Target=HS08198.g2 372 479 +;Gap=M108 +HS08198 est2genome match_part 1587 1688 2869 + . ID=HS08198:hsp:40:3.12.0.0;Parent=HS08198:hit:12:3.12.0.0;Target=HS08198.g2 480 581 +;Gap=M102 +HS08198 est2genome match_part 1772 1848 2869 + . ID=HS08198:hsp:41:3.12.0.0;Parent=HS08198:hit:12:3.12.0.0;Target=HS08198.g2 582 658 +;Gap=M77 +HS04636 . contig 1 9453 . . . ID=HS04636;Name=HS04636 +### +HS04636 repeatmasker match 3852 3888 12 + . ID=HS04636:hit:0:1.3.0.0;Name=species:%28TTGTAAT%29n|genus:Simple_repeat;Target=species:%28TTGTAAT%29n|genus:Simple_repeat 1 37 + +HS04636 repeatmasker match_part 3852 3888 12 + . ID=HS04636:hsp:0:1.3.0.0;Parent=HS04636:hit:0:1.3.0.0;Target=species:%2528TTGTAAT%2529n|genus:Simple_repeat 1 37 + +HS04636 repeatmasker match 6028 6072 21 + . ID=HS04636:hit:1:1.3.0.0;Name=species:%28TTGT%29n|genus:Simple_repeat;Target=species:%28TTGT%29n|genus:Simple_repeat 1 46 + +HS04636 repeatmasker match_part 6028 6072 21 + . ID=HS04636:hsp:1:1.3.0.0;Parent=HS04636:hit:1:1.3.0.0;Target=species:%2528TTGT%2529n|genus:Simple_repeat 1 46 + +HS04636 repeatmasker match 3840 3847 17 + . ID=HS04636:hit:2:1.3.0.0;Name=species:%28ATAC%29n|genus:Simple_repeat;Target=species:%28ATAC%29n|genus:Simple_repeat 3 57 + +HS04636 repeatmasker match_part 3840 3847 17 + . ID=HS04636:hsp:2:1.3.0.0;Parent=HS04636:hit:2:1.3.0.0;Target=species:%2528ATAC%2529n|genus:Simple_repeat 3 57 + +HS04636 repeatmasker match 3791 3839 22 + . ID=HS04636:hit:3:1.3.0.0;Name=species:%28AC%29n|genus:Simple_repeat;Target=species:%28AC%29n|genus:Simple_repeat 1 49 + +HS04636 repeatmasker match_part 3791 3839 22 + . ID=HS04636:hsp:3:1.3.0.0;Parent=HS04636:hit:3:1.3.0.0;Target=species:%2528AC%2529n|genus:Simple_repeat 1 49 + +HS04636 repeatmasker match 9419 9435 16 + . ID=HS04636:hit:4:1.3.0.0;Name=species:%28A%29n|genus:Simple_repeat;Target=species:%28A%29n|genus:Simple_repeat 1 17 + +HS04636 repeatmasker match_part 9419 9435 16 + . ID=HS04636:hsp:4:1.3.0.0;Parent=HS04636:hit:4:1.3.0.0;Target=species:%2528A%2529n|genus:Simple_repeat 1 17 + +HS04636 repeatmasker match 939 980 13 + . ID=HS04636:hit:5:1.3.0.0;Name=species:%28CCGCG%29n|genus:Simple_repeat;Target=species:%28CCGCG%29n|genus:Simple_repeat 1 42 + +HS04636 repeatmasker match_part 939 980 13 + . ID=HS04636:hsp:5:1.3.0.0;Parent=HS04636:hit:5:1.3.0.0;Target=species:%2528CCGCG%2529n|genus:Simple_repeat 1 42 + +HS04636 repeatmasker match 6918 6977 17 + . ID=HS04636:hit:6:1.3.0.0;Name=species:%28TATT%29n|genus:Simple_repeat;Target=species:%28TATT%29n|genus:Simple_repeat 1 54 + +HS04636 repeatmasker match_part 6918 6977 17 + . ID=HS04636:hsp:6:1.3.0.0;Parent=HS04636:hit:6:1.3.0.0;Target=species:%2528TATT%2529n|genus:Simple_repeat 1 54 + +HS04636 repeatmasker match 4518 4541 17 + . ID=HS04636:hit:7:1.3.0.0;Name=species:%28TTTA%29n|genus:Simple_repeat;Target=species:%28TTTA%29n|genus:Simple_repeat 1 24 + +HS04636 repeatmasker match_part 4518 4541 17 + . ID=HS04636:hsp:7:1.3.0.0;Parent=HS04636:hit:7:1.3.0.0;Target=species:%2528TTTA%2529n|genus:Simple_repeat 1 24 + +### +HS04636 blastn expressed_sequence_match 1815 6903 120 + . ID=HS04636:hit:8:3.12.0.0;Name=HS04636.g1;score=120 +HS04636 blastn match_part 1815 1934 120 + . ID=HS04636:hsp:8:3.12.0.0;Parent=HS04636:hit:8:3.12.0.0;Target=HS04636.g1 129 248 +;Gap=M120 +HS04636 blastn match_part 1815 1845 31 + . ID=HS04636:hsp:9:3.12.0.0;Parent=HS04636:hit:8:3.12.0.0;Target=HS04636.g1 50 80 +;Gap=M31 +HS04636 blastn match_part 2055 2198 144 + . ID=HS04636:hsp:10:3.12.0.0;Parent=HS04636:hit:8:3.12.0.0;Target=HS04636.g1 249 392 +;Gap=M144 +HS04636 blastn match_part 2852 2997 146 + . ID=HS04636:hsp:11:3.12.0.0;Parent=HS04636:hit:8:3.12.0.0;Target=HS04636.g1 393 538 +;Gap=M146 +HS04636 blastn match_part 3424 3609 186 + . ID=HS04636:hsp:12:3.12.0.0;Parent=HS04636:hit:8:3.12.0.0;Target=HS04636.g1 535 720 +;Gap=M186 +HS04636 blastn match_part 4339 4423 85 + . ID=HS04636:hsp:13:3.12.0.0;Parent=HS04636:hit:8:3.12.0.0;Target=HS04636.g1 718 802 +;Gap=M85 +HS04636 blastn match_part 4541 4790 250 + . ID=HS04636:hsp:14:3.12.0.0;Parent=HS04636:hit:8:3.12.0.0;Target=HS04636.g1 801 1050 +;Gap=M250 +HS04636 blastn match_part 5068 5360 293 + . ID=HS04636:hsp:15:3.12.0.0;Parent=HS04636:hit:8:3.12.0.0;Target=HS04636.g1 1046 1338 +;Gap=M293 +HS04636 blastn match_part 5859 6008 150 + . ID=HS04636:hsp:16:3.12.0.0;Parent=HS04636:hit:8:3.12.0.0;Target=HS04636.g1 1336 1485 +;Gap=M150 +HS04636 blastn match_part 6490 6903 414 + . ID=HS04636:hsp:17:3.12.0.0;Parent=HS04636:hit:8:3.12.0.0;Target=HS04636.g1 1481 1894 +;Gap=M414 +HS04636 est2genome expressed_sequence_match 1813 6903 8728 + . ID=HS04636:hit:9:3.12.0.0;Name=HS04636.g1;score=8728 +HS04636 est2genome match_part 1813 1934 8728 + . ID=HS04636:hsp:18:3.12.0.0;Parent=HS04636:hit:9:3.12.0.0;Target=HS04636.g1 127 248 +;Gap=M122 +HS04636 est2genome match_part 2055 2198 8728 + . ID=HS04636:hsp:19:3.12.0.0;Parent=HS04636:hit:9:3.12.0.0;Target=HS04636.g1 249 392 +;Gap=M144 +HS04636 est2genome match_part 2852 2995 8728 + . ID=HS04636:hsp:20:3.12.0.0;Parent=HS04636:hit:9:3.12.0.0;Target=HS04636.g1 393 536 +;Gap=M144 +HS04636 est2genome match_part 3426 3607 8728 + . ID=HS04636:hsp:21:3.12.0.0;Parent=HS04636:hit:9:3.12.0.0;Target=HS04636.g1 537 718 +;Gap=M182 +HS04636 est2genome match_part 4340 4423 8728 + . ID=HS04636:hsp:22:3.12.0.0;Parent=HS04636:hit:9:3.12.0.0;Target=HS04636.g1 719 802 +;Gap=M84 +HS04636 est2genome match_part 4543 4789 8728 + . ID=HS04636:hsp:23:3.12.0.0;Parent=HS04636:hit:9:3.12.0.0;Target=HS04636.g1 803 1049 +;Gap=M247 +HS04636 est2genome match_part 5072 5358 8728 + . ID=HS04636:hsp:24:3.12.0.0;Parent=HS04636:hit:9:3.12.0.0;Target=HS04636.g1 1050 1336 +;Gap=M287 +HS04636 est2genome match_part 5860 6007 8728 + . ID=HS04636:hsp:25:3.12.0.0;Parent=HS04636:hit:9:3.12.0.0;Target=HS04636.g1 1337 1484 +;Gap=M148 +HS04636 est2genome match_part 6494 6903 8728 + . ID=HS04636:hsp:26:3.12.0.0;Parent=HS04636:hit:9:3.12.0.0;Target=HS04636.g1 1485 1894 +;Gap=M410
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/genome.fasta Thu Oct 19 15:58:39 2017 -0400 @@ -0,0 +1,200 @@ +>HS04636 +gagctcacattaactatttacagggtaactgcttaggaccagtattatgaggagaattta +cctttcccgcctctctttccaagaaacaaggagggggtgaaggtacggagaacagtattt +cttctgttgaaagcaacttagctacaaagataaattacagctatgtacactgaaggtagc +tatttcattccacaaaataagagttttttaaaaagctatgtatgtatgtgctgcatatag +agcagatatacagcctattaagcgtcgtcactaaaacataaaacatgtcagcctttctta +accttactcgccccagtctgtcccgacgtgacttcctcgaccctctaaagacgtacagac +cagacacggcggcggcggcgggagaggggattccctgcgcccccggacctcagggccgct +cagattcctggagaggaagccaagtgtccttctgccctcccccggtatcccatccaaggc +gatcagtccagaactggctctcggaagcgctcgggcaaagactgcgaagaagaaaagaca +tctggcggaaacctgtgcgcctggggcggtggaactcggggaggagagggagggatcaga +caggagagtggggactaccccctctgctcccaaattggggcagcttcctgggtttccgat +tttctcatttccgtgggtaaaaaaccctgcccccaccgggcttacgcaatttttttaagg +ggagaggagggaaaaaatttgtgggggggtacgaaaaggcggaaagaaacagtcattcac +atgggcttggttttcagtcttataaaaaggaaggttctctcggttagcgaccaattgtca +tacgacttgcagtgagcgtcaggagcacgtccaggaactcctcagcagcgcctccttcag +ctccacagccagacgccctcagacagcaaagcctacccccgcgccgcgccctgcccgccg +ctcggatgctcgcccgcgccctgctgctgtgcgcggtcctggcgctcagccatacaggtg +agtacctggcgccgcgcaccggggactccggttccacgcacccgggcagagtttccgctc +tgacctcctgggtctatcccagtactccgacttctctccgaatagagaagctacgtgact +tgggaaagagcttggaccgctagagtccgaaagaactccgtggatattccagctttccca +caagcactgatcattatgagccagttacttaaccgatctgagacactctcacctcctaaa +tagggatagatgatactaatttgcaggttgtcattatgataagacaggatctgatcaata +tatgtgaattgtttatatttggaacctttttattgagtggaagaagttgttttaaatatt +ctagtcagttctttcctgctcccaggaaagcccggattatgttttaagataagcaaaatg +tcttaaaagtaagctgttttactttgaatttttccctaaatgttgattagtgtactagat +ccattttaatttggaaagtgaagtgctacttatttgaacttcttaaaaatgctaatttta +acatctaaagagttaactaagaaaagcttagtaacatgatgtaccaagttgaatatgctg +ttatccttatttagaatagaaaattggtatttctacgttttatccattctaaggcaggtt +aaaaaattgtatttccatgactacctatatatttcttgaatttattattgtaaagttgat +tcatagtcaaacaattaaatgtttaaattaagattaagacactagagaatgatttatttg +ctgtcctttaattgcagcaaatccttgctgttcccacccatgtcaaaaccgaggtgtatg +tatgagtgtgggatttgaccagtataagtgcgattgtacccggacaggattctatggaga +aaactgctcaacacgtaagtttgtcctttggttgcctcattaggagtggggctggataca +gttatcattgtatagatttgtgtcttataatgagtcccattaatttctccctccctttct +tcgtcttcttgcagcggaatttttgacaagaataaaattatttctgaaacccactccaaa +cacagtgcactacatacttacccacttcaagggattttggaacgttgtgaataacattcc +cttccttcgaaatgcaattatgagttatgtcttgacatgtaagtacaagtgtctttctaa +ggtttttagccttctcaaagaaaaatatgctttataatactgtaagcctaatctaaaaac +atatttccaagcttatcaaaaagactttaagatagcttttaagtttgccttccatcttaa +tcgccaaaaatattgacatttagtcccatccagtttatacagtctgctcacaactctgta +tacctcttctaacctttactgtttggtcagtttgtggaggtagcatggtccagctgttta +ttgaatgcccatgggccacagaattgttctgaacatgtagcacccattaaaataaatttg +gatttggatcagcaagaaaataactttccatgattctaaagtgggtgccatactcagcca +ttcctttcataggcctcttggatagtgagcagatggctacctgaaaaatcaatattgcca +gattataatgtgcagagtatatgtattttattaaagatgtatttcaagtggccattagac +tataaagtgtagttgtttaaaaatagattttttttattttggagttacattcaacctcag +gtgccactttccacattttacaataaaaataatggttgatttacttaacaaatgagaata +aataaaacatttttttctttgaaaatttcagccagatcacatttgattgacagtccacca +acttacaatgctgactatggctacaaaagctgggaagccttctctaacctctcctattat +actagagcccttcctcctgtgcctgatgattgcccgactcccttgggtgtcaaaggtgag +taagaagaatccattagagatgtattaactataagacgggctgcattgctgccaaaaaaa +aaaattgaccttagactaccatttatttattaacaaaagcagtttttacttttagcatgg +ttatctatgggtattttttaaagtatgagtctatataaactattatgtaaaagcaaatga +gcgtcttggtataatgtcttaatattttcaaattatttctttagaaatgaaataattcta +attaaaatagataaaatcattcagtaagaagttgttccaccatatcttagaactgttgtt +tatattatgatcctattcacaattgtaattctcatataaatgaagaattcttggtagatt +gacagtcaccatctcctttcttgaatacatagatggattcttaccttagctttctcattt +ttcaggtaaaaagcagcttcctgattcaaatgagattgtggaaaaattgcttctaagaag +aaagttcatccctgatccccagggctcaaacatgatgtttgcattctttgcccagcactt +cacgcatcagtttttcaagacagatcataagcgagggccagctttcaccaacgggctggg +ccatggggtaagatagagttaatatcttagagttagtaaaattataccaaatcatagtca +agggctaacattaaaggagatatacagatagatagatccaaataacttatccactttttt +taaaaagaagtcttatctataaaaaccttaaaggaattttccatttacttcactggtcta +gtaaaattatacacacacacagacatgcacacacatatataaacattcacacacatacat +atgtacaggtattgttatttgtaatttgacccttgtattttttagtttaaaatgttagta +ctgcaaaatgttatgtcctcaaaaacacattgtaccatgattatgccgctttcaatattg +taaagtgaggtttttgccgcattattattttttggatttcaatagcatagcttcaagtta +ttcgtaagaattttttataaataatacatttttatacttttttataattaccatatcatc +atagtgaagtatataatatatatgatataagctcaatatagtatattaattccgttaaac +acaaagacatatcagtttgtagctttggtggataaacaaattaatttagcaattcatggc +tatgaaaaatgtatattttatttaaaaattttaaagaaagctaaatgatcaaattattta +atgatgaattatatgatagacactttatataagaaaaacttcaacagcaacaaattaaaa +ttttttcatcattttctaggtggacttaaatcatatttacggtgaaactctggctagaca +gcgtaaactgcgccttttcaaggatggaaaaatgaaatatcaggtatgcttcctttgact +attaagacttagttattaccgcttatacccatattttaaaatccctaaaaatgtgttcct +taactttttaactgatgtttatttatttatttatttttttagataattgatggagagatg +tatcctcccacagtcaaagatactcaggcagagatgatctaccctcctcaagtccctgag +catctacggtttgctgtggggcaggaggtctttggtctggtgcctggtctgatgatgtat +gccacaatctggctgcgggaacacaacagagtatgcgatgtgcttaaacaggagcatcct +gaatggggtgatgagcagttgttccagacaagcaggctaatactgataggtaaacaagaa +aatgatttatataaaaccctcttccccagggaaaattagtgtgctatctttgttatgttt +tgagtaaatgacaagatgtggtaaatgaaaactcacacattctatatacattaaatatgt +aagcatgactgataaaatagctatcttttgatactgacaaggaagaaaacagaaatgaag +gaatagcaaattttaaaaattgcattccagttgcttgaaagcttgtgatcagatgcaata +aatgtttttattatttattttgtgcaaataggagagactattaagattgtgattgaagat +tatgtgcaacacttgagtggctatcacttcaaactgaaatttgacccagaactacttttc +aacaaacaattccagtaccaaaatcgtattgctgctgaatttaacaccctctatcactgg +catccccttctgcctgacacctttcaaattcatgaccagaaatacaactatcaacagttt +atctacaacaactctatattgctggaacatggaattacccagtttgttgaatcattcacc +aggcaaattgctggcagggtaagcattattattgaaaaccaaaacaaaagactagtcagt +aactttagaatttctgccacggaaattatttttcttaaacttactaaaagagtagttagt +tatattgctagtaaaattattttattgatataagaagcctaactttgtttgaaaagtcta +aacttttagtctagtctacagttgtcagacaaatagcaaattgtacccctaccttaaaaa +tattttcaaaaagtatctataatcttataggaataaatattttaggcttgaatactagtg +ttatttttgaaatgtaaaaaggcaaattagttctaggctggtgtcccattgaattttaag +cagagctcctgttgaaatgtaggtaagcatctttccagcaaataaaaattgtctccgctg +ggagtttcagttttacctgatttgtacctaaggcaagctgaatacaaacagtaaatatgc +ctaaaattcttgttttacaactaattttactttccacaggttgctggtggtaggaatgtt +ccacccgcagtacagaaagtatcacaggcttccattgaccagagcaggcagatgaaatac +cagtcttttaatgagtaccgcaaacgctttatgctgaagccctatgaatcatttgaagaa +cttacaggtaagaaacagtttctaaacttcttcgttttttgtttgtttgtttgtttttgt +tgtttttggttttcttttcgagatggagccgccctctgtcacccaggctggagtgcagtg +gcgccatctcggctcactgcaacctccgcctcctgggttcaagcaattctcctgcctcaa +cttcctgagtagctgggactacaggctcacgtcgcacgcatggataattttttgtatttt +cagtatagacggggtttcaccgtgttagccaggctggtctcaaactcctgacctagtgat +ccgccggcttcggcctcccgaagtgctgggattacaggcgtgagccaccgcgcctggccc +ctaaacttcttaaaagaatcaggggtcaaatggaaacagagaagttggcagcaaattgag +caaaagaatcaaactgttttttattttgtgaagtttgacattggttgtatctctgtcttc +atcgccttcacaggagaaaaggaaatgtctgcagagttggaagcactctatggtgacatc +gatgctgtggagctgtatcctgcccttctggtagaaaagcctcggccagatgccatcttt +ggtgaaaccatggtagaagttggagcaccattctccttgaaaggacttatgggtaatgtt +atatgttctcctgcctactggaagccaagcacttttggtggagaagtgggttttcaaatc +atcaacactgcctcaattcagtctctcatctgcaataacgtgaagggctgtccctttact +tcattcagtgttccagatccagagctcattaaaacagtcaccatcaatgcaagttcttcc +cgctccggactagatgatatcaatcccacagtactactaaaagaacgttcgactgaactg +tagaagtctaatgatcatatttatttatttatatgaaccatgtctattaatttaattatt +taataatatttatattaaactccttatgttacttaacatcttctgtaacagaagtcagta +ctcctgttgcggagaaaggagtcatacttgtgaagacttttatgtcactactctaaagat +tttgctgttgctgttaagtttggaaaacagtttttattctgttttataaaccagagagaa +atgagttttgacgtctttttacttgaatttcaacttatattataagaacgaaagtaaaga +tgtttgaatacttaaacactatcacaagatggcaaaatgctgaaagtttttacactgtcg +atgtttccaatgcatcttccatgatgcattagaagtaactaatgtttgaaattttaaagt +acttttggttatttttctgtcatcaaacaaaaacaggtatcagtgcattattaaatgaat +atttaaattagacattaccagtaatttcatgtctactttttaaaatcagcaatgaaacaa +taatttgaaatttctaaattcatagggtagaatcacctgtaaaagcttgtttgatttctt +aaagttattaaacttgtacatataccaaaaagaagctgtcttggatttaaatctgtaaaa +tcagatgaaattttactacaattgcttgttaaaatattttataagtgatgttcctttttc +accaagagtataaacctttttagtgtgactgttaaaacttccttttaaatcaaaatgcca +aatttattaaggtggtggagccactgcagtgttatctcaaaataagaatattttgttgag +atattccagaatttgtttatatggctggtaacatgtaaaatctatatcagcaaaagggtc +tacctttaaaataagcaataacaaagaagaaaaccaaattattgttcaaatttaggttta +aacttttgaagcaaacttttttttatccttgtgcactgcaggcctggtactcagattttg +ctatgaggttaatgaagtaccaagctgtgcttgaataacgatatgttttctcagattttc +tgttgtacagtttaatttagcagtccatatcacattgcaaaagtagcaatgacctcataa +aatacctcttcaaaatgcttaaattcatttcacacattaattttatctcagtcttgaagc +caattcagtaggtgcattggaatcaagcctggctacctgcatgctgttccttttcttttc +ttcttttagccattttgctaagagacacagtcttctcatcacttcgtttctcctattttg +ttttactagttttaagatcagagttcactttctttggactctgcctatattttcttacct +gaacttttgcaagttttcaggtaaacctcagctcaggactgctatttagctcctcttaag +aagattaaaagagaaaaaaaaaggcccttttaaaaatagtatacacttattttaagtgaa +aagcagagaattttatttatagctaattttagctatctgtaaccaagatggatgcaaaga +ggctagtgcctcagagagaactgtacggggtttgtgactggaaaaagttacgttcccatt +ctaattaatgccctttcttatttaaaaacaaaaccaaatgatatctaagtagttctcagc +aataataataatgacgataatacttcttttccacatctcattgtcactgacatttaatgg +tactgtatattacttaatttattgaagattattatttatgtcttattaggacactatggt +tataaactgtgtttaagcctacaatcattgatttttttttgttatgtcacaatcagtata +ttttctttggggttacctctctgaatattatgtaaacaatccaaagaaatgattgtatta +agatttgtgaataaatttttagaaatctgattggcatattgagatatttaaggttgaatg +tttgtccttaggataggcctatgtgctagcccacaaagaatattgtctcattagcctgaa +tgtgccataagactgaccttttaaaatgttttgagggatctgtggatgcttcgttaattt +gttcagccacaatttattgagaaaatattctgtgtcaagcactgtgggttttaatatttt +taaatcaaacgctgattacagataatagtatttatataaataattgaaaaaaattttctt +ttgggaagagggagaaaatgaaataaatatcattaaagataactcaggagaatcttcttt +acaattttacgtttagaatgtttaaggttaagaaagaaatagtcaatatgcttgtataaa +acactgttcactgttttttttaaaaaaaaaacttgatttgttattaacattgatctgctg +acaaaacctgggaatttgggttgtgtatgcgaatgtttcagtgcctcagacaaatgtgta +tttaacttatgtaaaagataagtctggaaataaatgtctgtttatttttgtactatttaa +aaaaaaaaaaaaaaatcgatgtcgactcgagtc +>HS08198 +agcgggcggcggtcgtgggcggggttgcaggcgaggctcaacgaacgctggtctgaccgt +cggcgctccctgttgccgggccctgagcaagtggcttcatgaaccccgtgacgttggcca +tggagataagaccactgggtgatggtttaaggaagataacgtgtaaagggctaaggactg +tcggtggaaatcaggggtgcaggagaaatggataaacagccagaggtcaactcggacttt +gtacataggacatggtgccaggccctgccaggaagtgcagatcgaagctaggctcacgag +gaggctggaggtggggggtggggaggcaacggatggacatggacttcctgggctgggctc +tgtgacagcagagtagactctgtcctgggacttggtggtgctacccttggcctcccacag +tcctgccaccctgctgccgccaccatgctgccccctgggactgcgaccctcttgactctg +ctcctggcagctggctcgctgggccagaagcctcagaggccacgccggcccgcatccccc +atcagcaccatccagcccaaggccaattttgatgcgcagcaggtagaagttggggggggt +agagggaggcaggtagaagttgtgggaggggtagagggagacaggtagaagttgttgcgg +gggagagggaagcaggtgaagttgtggggggtgtagagggaagcaggtgaggggccctcc +cacagtgccctcgagttctcccatggtctgcccccagtttgcagggacctggctccttgt +ggctgtgggctccgcttgccgtttcctgcaggagcagggccaccgggccgaggccaccac +actgcatgtggctccccagggcacagccatggctgtcagtaccttccgaaagctgtgagt +cccagagcagccctgcaccctaaccccaaccctcctctcagcccccggacttcagccctg +ctctggcccctgaccccaccccggctgtggcctggactaggattcctggttggggtctcc +cagcctgtggtgcctcctccccgcccccccagggatgggatctgctggcaggtgcgccag +ctctatggagacacaggggtcctcggccgcttcctgcttcaaggtgaggcaggggctgca +ggtcatgtgggtgggggatgacgcagccactgtggctctctgacatggctactgtggctc +tgcccagcccgaggcgcccgaggggctgtgcacgtggttgtcgctgagaccgactaccag +agtttcgctgtcctgtacctggagcgggcggggcagctgtcagtgaagctctacggtatg +tgggggccagcctctgtgaccaggcaggcgctcaagctctgcacactcactgggccaccc +cgaggggctgggtgagccatggggacacacttcctttctcccatcctgatcctcctgcta +agcaggggcccagggagtagtgacagacaggcctggtgtgggagcagggaggagggcccc +gaggggcaggggacacacagaccccgttcccagagccctccacgccgcctggtgccagga +ccccaggaaccctgtctgccctgcagcccgctcgctccctgtgagcgactcggtcctgag +tgggtttgagcagcgggtccaggaggcccacctgactgaggaccagatcttctacttccc +caagtacggtgagtgtccccagcaggtccccagctcagccacccccactctctggctgat +gtccagcctgacccctgccttggcgccccaggcttctgcgaggctgcagaccagttccac +gtcctggacggtgagtgcacagcgggggcaagcatggcggcgtggtgaggggggccactc +gcaccggctgagtctcgtctctgctgcagaagtgaggaggtgaggccggcacacagctcc +agtgctgagaagtcagtgccccgagagacgaccccaccagtggggtgcccgctgcctgtc +ctccgtgaaaccagcctcagatcagggccctgccacccagggcaggggatcttctgccgg +ctgccccagaggacagtgggtggagtggtacctacttattaaatgtctcagacccctctc +tgactcttctgtccactctggaccggcgccagtaccaccaaggccctctctgcccccacc +ccgcctctttaaaagcccggcgctccctgttggctggagtccacgcagggtcactgggcc +gatttcggctcttgggatttgggaggggagatcctctctggcatatgccatcttgtgccc +tgctggacctgggggcgtccacgtcactccaaggctgctcttgcctgggccatgcctgca +gccc
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/id_map.tsv Thu Oct 19 15:58:39 2017 -0400 @@ -0,0 +1,4 @@ +maker-HS04636-exonerate_est2genome-gene-0.0 YES000001 +maker-HS04636-exonerate_est2genome-gene-0.0-mRNA-1 YES000001-RA +maker-HS08198-exonerate_est2genome-gene-0.0 YES000002 +maker-HS08198-exonerate_est2genome-gene-0.0-mRNA-1 YES000002-RA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/snap.hmm Thu Oct 19 15:58:39 2017 -0400 @@ -0,0 +1,1612 @@ +zoeHMM snap_training 6 8 6 7 + +<STATES> + +Einit 0 0 3 -1 explicit +Esngl 0 0 150 -1 explicit +Eterm 0 0 3 -1 explicit +Exon 0 0 6 -1 explicit +Inter 0.9 0.9 0 0 geometric +Intron 0.1 0.1 0 0 geometric + +<STATE_TRANSITIONS> + +Einit Intron 1 +Esngl Inter 1 +Eterm Inter 1 +Exon Intron 1 +Inter Einit 1.000000 +Inter Esngl 0.000000 +Intron Eterm 0.153846 +Intron Exon 0.846154 + +<PHASE_PREFERENCES> + +0.500000 +0.500000 +0.000000 +0.333333 +0.666667 +0.000000 +0.571429 +0.428571 +0.000000 +0.000000 +1.000000 +0.000000 +1.000000 +0.000000 +0.750000 +0.250000 +1.000000 +0.000000 + +<STATE_DURATIONS> + +Einit 2 + DEFINED 0 249 + -2.459 -2.611 -2.781 -2.974 -3.196 + -3.459 -3.781 -4.196 -4.781 -5.781 + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + . . . . . + GEOMETRIC 250 -1 + 3 + +Esngl 1 + GEOMETRIC 0 -1 + 1000 + +Eterm 2 + DEFINED 0 249 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -10.052 -9.080 -8.505 -8.095 + -7.776 -7.515 -7.294 -7.102 -6.933 + -6.782 -6.782 -6.782 -6.782 -6.782 + -6.782 -6.782 -6.782 -6.782 -6.782 + -6.782 -6.782 -6.782 -6.782 -6.782 + -6.782 -6.782 -6.782 -6.782 -6.782 + -6.782 -6.782 -6.782 -6.782 -6.782 + -6.782 -6.782 -6.782 -6.782 -6.782 + -6.782 -6.933 -7.102 -7.294 -7.515 + -7.776 -8.095 -8.505 -9.080 -10.052 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + -14.718 -14.718 -14.718 -14.718 -14.718 + GEOMETRIC 250 -1 + 668 + +Exon 2 + DEFINED 0 249 + -16.777 -16.777 -16.777 -16.777 -16.777 + -16.777 -16.777 -16.777 -16.777 -16.777 + -16.777 -16.777 -16.777 -16.777 -16.777 + -16.777 -16.777 -16.777 -16.777 -16.777 + -16.777 -16.777 -16.777 -16.777 -16.777 + -16.777 -16.777 -16.777 -16.777 -16.777 + -16.777 -16.777 -16.777 -16.777 -16.777 + -16.777 -16.777 -16.777 -16.777 -16.777 + -16.777 -12.111 -11.140 -10.565 -10.154 + -9.835 -9.574 -9.353 -9.162 -8.993 + -8.841 -8.579 -8.357 -8.165 -7.996 + -7.844 -7.707 -7.582 -7.466 -7.360 + -7.260 -7.260 -7.260 -7.260 -7.260 + -7.260 -7.260 -7.260 -7.260 -7.260 + -7.260 -7.167 -7.080 -6.998 -6.920 + -6.846 -6.775 -6.708 -6.644 -6.583 + -6.524 -6.553 -6.583 -6.613 -6.644 + -6.676 -6.708 -6.741 -6.775 -6.810 + -6.846 -6.920 -6.998 -7.080 -7.167 + -7.260 -7.360 -7.466 -7.582 -7.707 + -7.844 -7.844 -7.844 -7.844 -7.844 + -7.844 -7.844 -7.844 -7.844 -7.844 + -7.844 -7.774 -7.707 -7.643 -7.582 + -7.523 -7.466 -7.412 -7.360 -7.309 + -7.260 -7.260 -7.260 -7.260 -7.260 + -7.260 -7.260 -7.260 -7.260 -7.260 + -7.260 -7.260 -7.260 -7.260 -7.260 + -7.260 -7.260 -7.260 -7.260 -7.260 + -7.260 -7.260 -7.260 -7.260 -7.260 + -7.260 -7.260 -7.260 -7.260 -7.260 + -7.260 -7.360 -7.466 -7.582 -7.707 + -7.844 -7.996 -8.165 -8.357 -8.579 + -8.841 -8.841 -8.841 -8.841 -8.841 + -8.841 -8.841 -8.841 -8.841 -8.841 + -8.841 -8.841 -8.841 -8.841 -8.841 + -8.841 -8.841 -8.841 -8.841 -8.841 + -8.841 -8.841 -8.841 -8.841 -8.841 + -8.841 -8.841 -8.841 -8.841 -8.841 + -8.841 -8.993 -9.162 -9.353 -9.574 + -9.835 -10.154 -10.565 -11.140 -12.111 + -16.777 -16.777 -16.777 -16.777 -16.777 + -16.777 -16.777 -16.777 -16.777 -16.777 + -16.777 -12.111 -11.140 -10.565 -10.154 + -9.835 -9.574 -9.353 -9.162 -8.993 + -8.841 -8.841 -8.841 -8.841 -8.841 + -8.841 -8.841 -8.841 -8.841 -8.841 + -8.841 -8.841 -8.841 -8.841 -8.841 + -8.841 -8.841 -8.841 -8.841 -8.841 + -8.841 -8.841 -8.841 -8.841 -8.841 + -8.841 -8.841 -8.841 -8.841 -8.841 + GEOMETRIC 250 -1 + 241 + +Inter 1 + GEOMETRIC 0 -1 + 500 + +Intron 1 + GEOMETRIC 0 -1 + 388 + +<SEQUENCE_MODELS> + +Acceptor SDT 2 1 4 2 0.000 + AG WMM 30 26 4 0 0.000 + 0.234 -2.087 -0.503 0.913 + -0.503 -0.087 0.234 0.234 + -0.087 -0.087 -1.087 0.720 + -2.087 0.497 -0.503 0.720 + 0.497 -0.503 -0.503 0.234 + 0.234 0.234 -1.087 0.234 + -0.087 -0.087 -0.087 0.234 + -0.503 0.234 -0.503 0.497 + -0.503 0.497 -1.087 0.497 + -0.087 -1.087 -1.087 1.082 + -0.503 0.497 -1.087 0.497 + -1.087 0.497 -2.087 0.913 + -1.087 -0.503 -1.087 1.234 + -1.087 -0.087 -0.503 0.913 + -1.087 0.497 -1.087 0.720 + -1.087 -0.087 -0.503 0.913 + -1.087 -0.087 -0.087 0.720 + -0.503 0.497 0.234 -0.503 + -0.087 -0.503 -0.503 0.720 + -1.087 0.497 -1.087 0.720 + -1.087 0.497 -1.087 0.720 + -1.087 0.497 -1.087 0.720 + -1.087 0.497 -2.087 0.913 + -0.087 0.234 -0.087 -0.087 + -2.087 1.372 -2.087 -0.087 + 1.720 -2.087 -2.087 -2.087 + -2.087 -2.087 1.720 -2.087 + -1.087 0.234 1.082 -2.087 + -0.087 0.234 -0.503 0.234 + 0.234 -0.503 0.497 -0.503 + NN TRM 0 0 0 0 0.000 + +Coding CDS 3 2 4 3 0.000 + frame0 LUT 5 4 4 0 0.000 + -0.322 -0.322 0.678 -0.322 + 0.193 0.193 -0.807 0.193 + -0.322 0.678 -0.322 -0.322 + -1.170 -0.170 0.415 0.415 + -0.322 0.263 0.263 -0.322 + -0.322 0.678 -0.322 -0.322 + -0.585 0.415 -0.585 0.415 + -0.170 -1.170 0.830 -0.170 + 0.585 -1.000 -1.000 0.585 + 0.415 0.415 -0.585 -0.585 + 0.678 -0.322 -0.322 -0.322 + 0.000 0.000 0.000 0.000 + -0.807 0.778 -0.807 0.193 + 1.000 -0.585 -0.585 -0.585 + -0.322 -0.322 0.678 -0.322 + -0.322 -0.322 -0.322 0.678 + 0.126 0.862 -1.459 -0.459 + 0.415 0.415 -1.170 -0.170 + 0.415 -0.585 -0.585 0.415 + 0.000 0.000 0.000 0.000 + -0.585 -1.585 1.415 -1.585 + 0.415 -0.585 -0.585 0.415 + -0.585 0.415 0.415 -0.585 + -0.807 0.193 0.778 -0.807 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + -0.807 -0.807 0.193 0.778 + -1.000 0.000 0.585 0.000 + -1.000 0.585 -1.000 0.585 + -0.585 -0.585 0.415 0.415 + -0.807 0.193 0.778 -0.807 + -0.322 1.000 -0.322 -1.322 + 0.778 -0.807 0.193 -0.807 + 0.585 0.000 -1.000 0.000 + -0.807 0.193 0.193 0.193 + -1.322 -0.322 0.678 0.263 + -1.459 -0.459 0.862 0.126 + -0.170 0.415 -1.170 0.415 + 0.000 -1.000 0.585 0.000 + -1.322 0.678 0.263 -0.322 + -0.322 -0.322 0.678 -0.322 + -0.322 0.678 -1.322 0.263 + -0.170 1.152 -1.170 -1.170 + -0.585 0.415 0.415 -0.585 + -1.000 1.000 -1.000 0.000 + -0.585 -0.585 -0.585 1.000 + -0.585 1.000 -0.585 -0.585 + -1.459 0.126 0.126 0.541 + -1.000 0.585 0.585 -1.000 + -0.585 -0.585 -0.585 1.000 + 0.000 0.000 0.000 0.000 + -0.585 0.415 -0.585 0.415 + -0.459 0.126 0.126 0.126 + -0.459 0.541 -1.459 0.541 + -0.322 -0.322 -0.322 0.678 + 0.678 -0.322 -0.322 -0.322 + -0.459 -0.459 0.541 0.126 + 0.126 0.126 -0.459 0.126 + 0.885 -0.700 -0.115 -0.700 + -1.322 -0.322 0.678 0.263 + -0.585 -0.585 -0.585 1.000 + 0.678 -0.322 -0.322 -0.322 + -0.585 0.415 -0.585 0.415 + -0.585 -0.585 0.415 0.415 + -0.807 0.778 -0.807 0.193 + 0.415 -0.585 -0.585 0.415 + -0.170 0.830 -1.170 -0.170 + -0.807 0.193 -0.807 0.778 + -0.585 -0.585 0.415 0.415 + 0.778 0.193 -0.807 -0.807 + -0.322 0.678 -0.322 -0.322 + -0.585 0.415 0.415 -0.585 + -0.585 -0.585 0.415 0.415 + -1.000 0.000 0.000 0.585 + 0.415 -0.585 0.415 -0.585 + 0.263 0.263 0.263 -1.322 + 0.000 0.000 0.000 0.000 + -0.322 0.678 -0.322 -0.322 + 0.000 0.000 0.000 0.000 + -1.170 1.152 -1.170 -0.170 + -1.000 0.000 0.585 0.000 + 1.000 -0.322 -1.322 -0.322 + -0.322 -0.322 0.678 -0.322 + -1.459 0.862 0.126 -0.459 + -1.322 0.263 1.000 -1.322 + -0.585 0.415 -0.585 0.415 + 0.193 0.193 0.193 -0.807 + -1.170 0.415 -1.170 0.830 + -0.585 0.415 0.415 -0.585 + 1.000 -0.585 -0.585 -0.585 + 0.678 -0.322 -0.322 -0.322 + 0.000 0.000 0.000 0.000 + -0.807 0.193 -0.807 0.778 + 0.678 -0.322 -0.322 -0.322 + 0.000 0.000 0.000 0.000 + -1.459 0.541 0.126 0.126 + 0.000 0.000 0.000 0.000 + -0.807 0.193 -0.807 0.778 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + -0.585 -0.585 0.415 0.415 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + -0.585 0.415 0.415 -0.585 + 0.000 0.000 0.000 0.000 + -0.322 -0.322 0.678 -0.322 + -0.585 -0.585 1.000 -0.585 + -0.322 0.678 -0.322 -0.322 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + -0.322 -0.322 0.678 -0.322 + 0.000 0.000 0.000 0.000 + -0.322 0.678 -0.322 -0.322 + 0.000 0.000 0.000 0.000 + 1.000 -0.585 -0.585 -0.585 + 0.415 -0.585 -0.585 0.415 + 0.193 -0.807 0.778 -0.807 + -0.459 0.541 -1.459 0.541 + -0.322 -0.322 0.678 -0.322 + -0.807 0.193 0.778 -0.807 + 0.093 -0.322 0.093 0.093 + 0.126 0.541 -0.459 -0.459 + -1.170 0.415 -0.170 0.415 + -1.459 0.126 1.126 -1.459 + -0.322 0.678 -0.322 -0.322 + 0.193 0.778 -0.807 -0.807 + 0.000 0.000 0.000 0.000 + -0.807 0.193 -0.807 0.778 + 0.000 -1.000 0.585 0.000 + 0.000 0.000 0.000 0.000 + 0.678 -0.322 -0.322 -0.322 + 0.415 -0.585 -0.585 0.415 + -0.322 -0.322 0.678 -0.322 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.415 -0.585 -0.585 0.415 + 0.585 0.000 0.000 -1.000 + 0.415 0.415 -0.585 -0.585 + -0.807 0.193 0.778 -0.807 + 0.678 -0.322 -0.322 -0.322 + 0.000 0.000 0.000 0.000 + 0.678 -0.322 -0.322 -0.322 + 0.000 0.000 0.000 0.000 + -0.807 0.193 -0.807 0.778 + 0.415 -0.585 -0.585 0.415 + 0.585 0.000 -1.000 0.000 + -0.807 -0.807 1.193 -0.807 + -0.322 -0.322 0.678 -0.322 + -1.000 0.000 0.585 0.000 + -0.322 -0.322 0.678 -0.322 + -0.585 0.415 0.415 -0.585 + -0.322 -0.322 -0.322 0.678 + -1.000 0.000 0.000 0.585 + -0.322 0.678 -0.322 -0.322 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + -0.585 0.415 -0.585 0.415 + 0.415 -0.170 0.415 -1.170 + -0.807 -0.807 0.778 0.193 + -0.585 0.415 -0.585 0.415 + -0.807 0.193 0.193 0.193 + 0.415 -0.585 -0.585 0.415 + 0.000 0.000 0.000 0.000 + -0.322 0.678 -0.322 -0.322 + -0.322 -1.322 1.000 -0.322 + 1.000 0.000 -1.000 -1.000 + 0.000 0.000 0.000 0.000 + 0.193 -0.807 0.778 -0.807 + 1.000 -0.585 -0.585 -0.585 + 0.000 0.000 0.000 0.000 + -0.322 -0.322 -0.322 0.678 + -0.585 1.000 -0.585 -0.585 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + -0.585 -0.585 -0.585 1.000 + 0.415 -0.585 -0.585 0.415 + -0.585 1.000 -0.585 -0.585 + -0.322 -0.322 0.678 -0.322 + -0.322 -0.322 -0.322 0.678 + 0.000 0.000 0.000 0.000 + 0.415 0.415 -0.585 -0.585 + 0.000 0.000 0.000 0.000 + -0.585 -0.585 1.000 -0.585 + 0.415 -0.170 -0.170 -0.170 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + -0.807 0.193 0.193 0.193 + -0.322 -0.322 -0.322 0.678 + -0.807 -0.807 0.193 0.778 + 0.000 0.000 0.000 0.000 + -0.585 0.415 -0.585 0.415 + 0.778 -0.807 -0.807 0.193 + 0.000 0.000 0.000 0.000 + 0.678 -0.322 -0.322 -0.322 + 0.678 -0.322 -0.322 -0.322 + -0.322 -0.322 0.678 -0.322 + 0.000 0.000 0.000 0.000 + -0.322 -0.322 0.678 -0.322 + 0.415 -1.170 -0.170 0.415 + 0.778 -0.807 -0.807 0.193 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.678 -0.322 -0.322 -0.322 + -0.585 0.415 -0.585 0.415 + -0.585 -0.585 0.415 0.415 + 0.193 -0.222 0.193 -0.222 + -1.000 1.000 0.000 -1.000 + -0.807 0.193 -0.807 0.778 + -1.000 1.000 -1.000 0.000 + -1.170 -0.170 1.152 -1.170 + -1.000 0.000 -1.000 1.000 + 0.678 -0.322 -0.322 -0.322 + -1.459 -0.459 1.126 -0.459 + -0.322 -0.322 -0.322 0.678 + -0.585 -0.585 -0.585 1.000 + -0.322 0.678 -0.322 -0.322 + 0.000 0.000 0.000 0.000 + -1.585 0.737 -1.585 0.737 + -0.807 0.778 -0.807 0.193 + -1.000 1.000 0.000 -1.000 + -1.322 -0.322 0.263 0.678 + 0.885 -1.700 0.300 -0.700 + 0.585 -1.000 -1.000 0.585 + -1.000 0.000 -1.000 1.000 + -0.459 -0.459 0.541 0.126 + 0.000 0.585 -1.000 0.000 + -1.000 0.000 -1.000 1.000 + -0.807 0.778 0.193 -0.807 + -1.322 -0.322 0.263 0.678 + 0.678 -0.322 0.263 -1.322 + -0.170 -1.170 -0.170 0.830 + -0.459 0.126 -0.459 0.541 + 0.585 -1.000 0.000 0.000 + -1.000 0.000 -1.000 1.000 + 0.415 -0.585 -0.585 0.415 + 0.000 0.000 0.000 0.000 + -0.585 0.415 -0.585 0.415 + 0.415 -0.170 -0.170 -0.170 + 0.000 0.585 -1.000 0.000 + 0.000 0.000 0.000 0.000 + -0.170 -0.170 0.830 -1.170 + 0.830 -1.170 -0.170 -0.170 + 0.415 -0.170 -1.170 0.415 + 0.678 -0.322 -0.322 -0.322 + 0.000 -1.000 1.000 -1.000 + 0.193 0.515 -0.807 -0.222 + -0.170 -0.170 -1.170 0.830 + 0.000 -1.000 -1.000 1.000 + -1.170 -0.170 0.830 -0.170 + -0.322 0.678 -0.322 -0.322 + 0.000 0.000 0.000 0.000 + -0.322 -0.322 0.678 -0.322 + -1.000 1.000 0.000 -1.000 + frame1 LUT 5 4 4 0 0.000 + 0.000 -1.000 0.000 0.585 + 0.778 -0.807 -0.807 0.193 + -1.170 0.830 -0.170 -0.170 + -1.000 0.585 0.585 -1.000 + -0.585 0.415 0.415 -0.585 + 0.678 -0.322 -0.322 -0.322 + 0.000 0.000 0.000 0.000 + -0.585 0.415 -0.585 0.415 + 1.193 -0.807 -0.807 -0.807 + 1.000 -1.000 -1.000 0.000 + 0.000 0.000 0.000 0.000 + -0.322 -0.322 -0.322 0.678 + 0.415 0.415 -0.585 -0.585 + 0.415 -0.585 -0.585 0.415 + 0.415 -0.585 -0.585 0.415 + 0.263 0.263 0.263 -1.322 + -0.322 -0.322 -0.322 0.678 + 0.415 -0.585 -0.585 0.415 + -0.170 -0.170 0.415 -0.170 + -0.585 -0.585 0.415 0.415 + 0.415 -0.585 -0.585 0.415 + 0.415 -0.585 0.415 -0.585 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + -0.585 0.415 -0.585 0.415 + -0.322 -0.322 -0.322 0.678 + -0.322 -0.322 -0.322 0.678 + 0.000 0.585 0.000 -1.000 + -0.322 -0.322 -0.322 0.678 + 0.585 0.585 -1.000 -1.000 + 1.000 -1.000 -1.000 0.000 + 0.126 0.541 0.126 -1.459 + 0.415 0.415 -0.585 -0.585 + 0.585 0.000 -1.000 0.000 + -0.322 0.263 0.263 -0.322 + -0.585 1.000 -0.585 -0.585 + 0.193 0.193 -0.807 0.193 + -0.322 -0.322 0.678 -0.322 + -0.585 -0.585 0.415 0.415 + -0.585 0.415 -0.585 0.415 + -0.322 -0.322 0.678 -0.322 + -0.807 0.193 0.778 -0.807 + 0.000 0.000 0.000 0.000 + -1.000 0.585 -1.000 0.585 + 0.778 0.193 -0.807 -0.807 + 0.193 0.193 0.193 -0.807 + -0.322 -0.322 0.678 -0.322 + 0.000 0.000 0.000 0.000 + 0.415 0.415 -0.585 -0.585 + 0.000 0.000 0.000 0.000 + -0.322 0.678 -0.322 -0.322 + -1.000 0.585 -1.000 0.585 + -0.322 0.678 -0.322 -0.322 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + -0.322 -0.322 0.678 -0.322 + -0.322 -0.322 0.678 -0.322 + -0.322 -0.322 -0.322 0.678 + -0.322 -0.322 -0.322 0.678 + 0.263 -0.322 -1.322 0.678 + -0.585 1.000 -0.585 -0.585 + -0.459 -0.459 0.541 0.126 + -0.322 0.678 0.263 -1.322 + 0.862 -1.459 -0.459 0.126 + -0.170 -1.170 0.830 -0.170 + -0.170 -0.170 0.415 -0.170 + -0.585 -0.585 1.222 -1.585 + 1.126 -0.459 -1.459 -0.459 + -0.322 0.678 -0.322 -0.322 + -0.807 0.193 0.193 0.193 + -0.322 -0.322 0.678 -0.322 + 0.678 -0.322 -0.322 -0.322 + -0.807 1.193 -0.807 -0.807 + 0.193 0.193 0.193 -0.807 + -0.322 0.678 -0.322 -0.322 + 0.415 0.000 -0.585 0.000 + 0.000 -1.000 1.000 -1.000 + 0.193 0.193 0.193 -0.807 + 0.678 -0.322 -0.322 -0.322 + -1.000 0.585 0.000 0.000 + 0.415 -0.392 -0.392 0.193 + -0.322 -0.322 0.678 -0.322 + -0.322 -0.322 0.678 -0.322 + 1.000 -0.585 -0.585 -0.585 + 0.678 -0.322 -0.322 -0.322 + -1.170 -0.170 1.152 -1.170 + 0.415 -0.585 0.415 -0.585 + 0.193 -0.807 -0.807 0.778 + 0.193 0.193 0.193 -0.807 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + -1.000 -1.000 0.000 1.000 + 0.126 -0.459 0.541 -0.459 + -1.170 1.152 -1.170 -0.170 + 0.000 0.000 0.000 0.000 + -0.585 -0.585 -0.585 1.000 + -0.585 -0.585 1.000 -0.585 + -0.807 -0.807 0.778 0.193 + -0.585 -0.585 0.415 0.415 + -0.322 0.678 -0.322 -0.322 + 0.000 0.000 0.000 0.000 + -0.585 -0.585 1.000 -0.585 + -0.322 0.678 -0.322 -0.322 + -0.322 0.678 -0.322 -0.322 + -0.322 0.678 -0.322 -0.322 + -0.585 -0.585 1.000 -0.585 + 0.000 0.000 0.000 0.000 + -0.322 0.678 -0.322 -0.322 + 0.415 -0.585 0.415 -0.585 + -0.322 -0.322 0.678 -0.322 + 0.000 0.000 0.000 0.000 + 0.415 0.000 -0.585 0.000 + 0.000 0.000 0.000 0.000 + -1.700 0.300 0.885 -0.700 + 1.193 -0.807 -0.807 -0.807 + -0.807 -0.807 0.193 0.778 + -0.807 0.778 0.193 -0.807 + 1.000 -0.585 -0.585 -0.585 + 0.000 0.000 0.000 0.000 + 0.000 -1.000 0.000 0.585 + -0.170 0.830 -0.170 -1.170 + -0.322 0.678 -0.322 -0.322 + 0.678 -0.322 -0.322 -0.322 + 0.300 0.621 -1.700 -0.115 + 1.152 -1.170 -0.170 -1.170 + 0.263 -0.322 0.678 -1.322 + -1.459 -0.459 0.126 0.862 + -0.322 -0.322 0.678 -0.322 + -1.170 1.152 -0.170 -1.170 + 0.415 -0.585 0.415 -0.585 + 0.415 -1.170 0.415 -0.170 + -0.585 0.415 0.415 -0.585 + 0.000 0.000 0.000 0.000 + -0.322 0.263 0.678 -1.322 + 0.000 0.000 0.000 0.000 + 0.415 -0.585 0.415 -0.585 + -0.322 0.678 -0.322 -0.322 + -1.170 -1.170 0.830 0.415 + -0.322 -0.322 0.678 -0.322 + -0.807 -0.807 -0.807 1.193 + 0.678 -1.322 -1.322 0.678 + -1.000 -1.000 1.322 -1.000 + 0.415 0.415 -0.585 -0.585 + -0.807 -0.807 0.193 0.778 + -0.700 0.621 0.300 -0.700 + -1.170 1.152 -0.170 -1.170 + 0.000 0.000 0.585 -1.000 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + -1.170 0.415 0.830 -1.170 + -0.322 -0.322 0.678 -0.322 + -0.585 1.000 -0.585 -0.585 + -0.807 -0.807 1.193 -0.807 + 0.678 -0.322 -0.322 -0.322 + 0.678 -0.322 -0.322 -0.322 + -0.170 0.415 -1.170 0.415 + -0.585 0.000 0.415 0.000 + 0.000 1.000 -1.000 -1.000 + 0.263 0.263 0.263 -1.322 + -0.807 0.193 0.193 0.193 + -1.170 0.830 0.415 -1.170 + -0.322 -0.322 0.678 -0.322 + 0.193 -0.807 0.778 -0.807 + 0.585 0.000 0.000 -1.000 + -0.807 -0.807 0.778 0.193 + -0.322 -0.322 0.678 -0.322 + -0.585 -0.585 -0.585 1.000 + -0.322 0.678 -1.322 0.263 + -0.807 0.778 0.193 -0.807 + 0.000 -1.000 0.585 0.000 + -0.585 -0.585 1.000 -0.585 + -1.000 1.000 -1.000 0.000 + -0.585 1.000 -0.585 -0.585 + -0.322 -0.322 0.678 -0.322 + 0.000 0.000 0.000 0.000 + -1.000 1.000 0.000 -1.000 + 0.000 0.000 0.000 0.000 + 0.000 0.585 0.000 -1.000 + -0.322 -0.322 0.678 -0.322 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + -0.807 0.193 0.193 0.193 + 0.000 0.000 0.000 0.000 + 0.415 -0.585 0.415 -0.585 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.193 0.778 -0.807 -0.807 + -0.585 -0.585 0.415 0.415 + -0.322 -1.322 1.000 -0.322 + 0.193 0.778 -0.807 -0.807 + 0.585 0.000 0.000 -1.000 + 0.193 0.193 -0.807 0.193 + -0.585 -0.585 1.000 -0.585 + -0.322 -0.322 0.678 -0.322 + -1.000 1.000 -1.000 0.000 + 0.000 0.000 0.000 0.000 + 0.193 0.193 -0.807 0.193 + -0.585 0.415 0.415 -0.585 + 0.000 0.000 0.000 0.000 + 0.678 -0.322 -0.322 -0.322 + 0.000 0.000 0.000 0.000 + -0.585 -0.585 -0.585 1.000 + 0.415 -0.585 -0.585 0.415 + 0.193 0.193 0.193 -0.807 + 0.193 -0.807 0.193 0.193 + 0.415 -0.170 0.415 -1.170 + -0.585 -0.585 -0.585 1.000 + 0.000 -1.000 0.000 0.585 + 0.778 -0.807 0.193 -0.807 + -0.170 0.415 0.415 -1.170 + 0.000 0.415 -1.585 0.415 + 0.000 0.000 0.000 0.000 + -1.585 0.415 1.000 -1.585 + 0.678 -0.322 -0.322 -0.322 + 0.000 0.000 0.000 0.000 + -0.322 0.678 -0.322 -0.322 + 0.678 -0.322 -0.322 -0.322 + 0.415 0.415 -0.585 -0.585 + 0.678 -0.322 -0.322 -0.322 + 0.126 0.126 0.541 -1.459 + 0.000 0.000 0.000 0.000 + -0.115 -0.700 -0.115 0.621 + 0.415 0.737 -1.585 -0.585 + 0.000 0.415 -0.585 0.000 + -0.585 -0.585 0.737 0.000 + 0.415 -1.170 0.415 -0.170 + 0.263 0.263 -1.322 0.263 + 0.415 0.415 -0.585 -0.585 + -1.459 -1.459 1.541 -1.459 + 0.126 -1.459 1.126 -1.459 + 0.000 -1.000 -1.000 1.000 + 0.778 -0.807 -0.807 0.193 + -0.459 0.126 0.862 -1.459 + 0.000 0.000 0.000 0.000 + 0.415 -0.170 -0.170 -0.170 + 0.000 0.322 0.585 -2.000 + 0.000 0.585 0.000 -1.000 + 0.000 0.000 0.000 0.000 + 0.415 -0.585 0.415 -0.585 + 0.000 0.000 0.000 0.000 + 0.193 -0.807 0.778 -0.807 + 0.415 -0.585 -0.585 0.415 + 0.415 0.415 -0.585 -0.585 + 0.678 -0.322 -0.322 -0.322 + -0.585 0.415 -0.585 0.415 + 0.000 0.000 0.000 0.000 + -0.322 0.678 -0.322 -0.322 + 0.678 -0.322 -0.322 -0.322 + 0.678 -0.322 -0.322 -0.322 + 0.000 0.000 0.000 0.000 + 1.152 -1.170 -0.170 -1.170 + 1.000 -0.585 -0.585 -0.585 + 0.000 0.000 0.585 -1.000 + frame2 LUT 5 4 4 0 0.000 + 0.000 0.000 0.000 0.000 + 0.263 -0.322 -0.322 0.263 + 0.585 -1.000 0.000 0.000 + 0.678 -1.322 -1.322 0.678 + 0.000 0.415 -0.585 0.000 + -0.322 -0.322 -0.322 0.678 + -0.807 -0.807 0.193 0.778 + 0.193 0.193 0.193 -0.807 + -0.585 0.415 -0.585 0.415 + -0.585 0.737 -0.585 0.000 + 0.415 -0.170 0.415 -1.170 + 0.193 -0.807 0.193 0.193 + 1.000 -0.585 -0.585 -0.585 + 0.193 0.193 0.193 -0.807 + 0.126 0.541 -1.459 0.126 + -0.322 -0.322 -0.322 0.678 + -0.807 -0.807 0.778 0.193 + -0.322 -0.322 -0.322 0.678 + -0.700 -0.115 -0.115 0.621 + 0.000 0.000 0.000 0.000 + -0.322 -0.322 -0.322 0.678 + 0.415 -1.170 -0.170 0.415 + 0.678 -0.322 -0.322 -0.322 + -0.585 -0.585 -0.585 1.000 + 0.000 0.000 0.000 0.000 + 0.678 -0.322 -0.322 -0.322 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + -0.585 -0.585 0.415 0.415 + -0.170 0.415 -1.170 0.415 + 0.585 0.585 -1.000 -1.000 + 0.193 0.193 -0.807 0.193 + 0.193 -0.807 0.193 0.193 + 0.678 -0.322 -0.322 -0.322 + -0.585 0.415 -0.585 0.415 + -0.322 0.678 -0.322 -0.322 + -1.170 0.415 0.415 -0.170 + 0.000 0.000 0.000 0.000 + 0.678 -0.322 -0.322 -0.322 + -0.322 -0.322 0.678 -0.322 + 0.678 -0.322 -0.322 -0.322 + 0.585 0.000 -1.000 0.000 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + -0.322 0.678 -0.322 -0.322 + -0.322 0.678 -0.322 -0.322 + -1.000 -1.000 0.585 0.585 + 0.193 0.193 -0.807 0.193 + 0.678 -0.322 -0.322 -0.322 + -0.585 -0.585 -0.585 1.000 + 0.000 0.000 0.000 0.000 + -0.585 -0.585 0.415 0.415 + 0.830 -1.170 -0.170 -0.170 + 0.415 0.415 -0.585 -0.585 + 0.678 -0.322 -0.322 -0.322 + 0.126 -1.459 0.541 0.126 + 0.263 -1.322 -0.322 0.678 + -0.322 -0.322 -0.322 0.678 + -1.000 0.585 0.000 0.000 + 0.585 0.000 -1.000 0.000 + 0.585 0.000 -1.000 0.000 + 0.778 0.193 -0.807 -0.807 + 0.737 0.000 -1.585 0.000 + 0.678 -0.322 -0.322 -0.322 + 0.000 -1.000 -1.000 1.000 + 1.000 -0.585 -0.585 -0.585 + -0.322 -0.322 -0.322 0.678 + -0.322 -0.322 -0.322 0.678 + 0.678 -0.322 -0.322 -0.322 + -0.585 -0.585 0.415 0.415 + -0.585 -0.585 -0.585 1.000 + -0.322 -1.322 -0.322 1.000 + 0.300 -0.700 0.300 -0.115 + 0.000 -0.585 0.000 0.415 + 0.300 -0.115 0.300 -0.700 + -0.115 -0.115 -1.700 0.885 + 0.415 -0.585 -0.585 0.415 + 0.000 0.585 -1.000 0.000 + 0.000 -1.000 0.585 0.000 + -0.322 -0.322 -0.322 0.678 + 0.193 0.193 0.193 -0.807 + -0.807 0.778 0.193 -0.807 + 1.152 -0.170 -1.170 -1.170 + -0.322 -0.322 -0.322 0.678 + 0.263 0.678 -1.322 -0.322 + 0.585 0.000 -1.000 0.000 + -0.585 1.000 -0.585 -0.585 + 0.000 -1.000 -1.000 1.000 + -0.322 0.678 -0.322 -0.322 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.263 0.678 -0.322 -1.322 + 0.807 -0.415 -0.415 -0.415 + 0.000 0.000 0.000 0.000 + 1.000 -0.585 -0.585 -0.585 + 0.000 0.000 0.000 0.000 + -0.807 -0.807 1.193 -0.807 + 0.000 0.000 0.000 0.000 + 0.678 -0.322 -0.322 -0.322 + 0.193 -0.807 0.193 0.193 + 0.000 0.000 0.000 0.000 + -1.000 0.585 -1.000 0.585 + -0.322 0.678 -0.322 -0.322 + -0.585 1.000 -0.585 -0.585 + 0.000 0.585 -1.000 0.000 + -0.322 -0.322 -0.322 0.678 + 0.415 -0.585 -0.585 0.415 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + -0.322 0.678 -0.322 -0.322 + 0.193 -0.807 0.193 0.193 + -0.807 -0.807 0.193 0.778 + 0.678 -0.322 -0.322 -0.322 + 0.000 0.000 0.000 0.000 + -0.585 -0.585 -0.585 1.000 + -0.585 0.415 -0.585 0.415 + -0.322 -0.322 0.678 -0.322 + 1.000 -0.322 -1.322 -0.322 + 0.541 -0.459 -0.459 0.126 + -0.459 0.126 0.126 0.126 + 0.300 -0.115 -0.115 -0.115 + 0.778 0.193 -0.807 -0.807 + 0.000 0.585 -1.000 0.000 + -0.459 0.126 -0.459 0.541 + 0.000 0.000 0.000 0.000 + -0.585 -0.585 -0.585 1.000 + 0.862 0.126 -1.459 -0.459 + 0.263 -1.322 -0.322 0.678 + 0.263 0.263 -1.322 0.263 + -1.170 0.415 -0.170 0.415 + -1.000 0.585 0.000 0.000 + 1.263 -0.322 -1.322 -1.322 + -0.322 -0.322 0.678 -0.322 + 0.585 0.000 -1.000 0.000 + -1.170 0.415 -1.170 0.830 + 0.862 -1.459 -0.459 0.126 + -0.170 0.830 -1.170 -0.170 + 0.193 -0.807 0.193 0.193 + -0.585 0.415 -0.585 0.415 + 0.193 0.778 -0.807 -0.807 + 0.300 0.300 -0.115 -0.700 + 0.000 0.000 0.585 -1.000 + -0.807 -0.807 0.778 0.193 + -0.585 0.415 -0.585 0.415 + 0.830 -0.170 -1.170 -0.170 + -0.585 0.415 -0.585 0.415 + -0.170 0.415 -1.170 0.415 + 0.415 -1.170 -0.170 0.415 + 0.678 -0.322 -0.322 -0.322 + 0.193 0.193 -0.807 0.193 + -0.322 0.678 -0.322 -0.322 + 0.678 -0.322 -0.322 -0.322 + -0.807 0.193 0.778 -0.807 + -0.322 -0.322 0.678 -0.322 + -0.322 -0.322 0.678 -0.322 + -0.322 0.678 -0.322 -0.322 + -0.087 -0.503 -0.087 0.497 + -0.585 0.415 -0.585 0.415 + 0.415 -0.585 -0.585 0.415 + -0.585 -0.585 -0.585 1.000 + 1.152 -0.170 -1.170 -1.170 + -0.807 -0.807 -0.807 1.193 + -0.585 0.415 0.415 -0.585 + 1.000 -1.000 0.000 -1.000 + -0.322 0.678 -0.322 -0.322 + 0.415 0.415 -0.170 -1.170 + -0.585 0.415 -0.585 0.415 + 0.585 0.000 -1.000 0.000 + -0.807 0.778 -0.807 0.193 + -0.322 -0.322 -0.322 0.678 + 0.415 -0.585 0.415 -0.585 + -0.585 -0.585 -0.585 1.000 + 1.000 -1.585 0.000 -0.585 + -0.322 -0.322 -0.322 0.678 + 0.000 0.000 0.000 0.000 + 0.415 -0.585 -0.585 0.415 + 1.000 -0.585 -0.585 -0.585 + -0.585 0.415 0.415 -0.585 + 0.585 0.000 0.000 -1.000 + -0.322 -0.322 -1.322 1.000 + -0.322 0.678 -0.322 -0.322 + -0.585 -0.585 -0.585 1.000 + 0.830 -1.170 -0.170 -0.170 + 0.541 0.126 -0.459 -0.459 + 0.126 -0.459 0.541 -0.459 + 0.000 0.000 0.000 0.000 + -0.322 -0.322 -0.322 0.678 + -0.585 1.000 -0.585 -0.585 + 0.000 -1.000 0.000 0.585 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 1.152 -1.170 -1.170 -0.170 + 0.678 -0.322 -0.322 -0.322 + -0.322 -0.322 0.678 -0.322 + -0.585 -0.585 0.415 0.415 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.415 0.415 -0.585 -0.585 + 1.000 0.263 -1.322 -1.322 + -0.585 -0.585 0.737 0.000 + 0.678 -0.322 -0.322 -0.322 + 0.585 0.000 -1.000 0.000 + 1.000 -0.585 -0.585 -0.585 + -0.322 -0.322 -0.322 0.678 + -0.807 -0.807 -0.807 1.193 + -0.322 -0.322 -0.322 0.678 + -0.585 0.415 0.415 -0.585 + -0.322 -0.322 0.678 -0.322 + 0.415 -0.585 -0.585 0.415 + -0.322 0.678 -0.322 -0.322 + -0.585 -0.585 -0.585 1.000 + -0.322 -0.322 -0.322 0.678 + 0.000 0.000 0.000 0.000 + 0.415 -0.585 -0.585 0.415 + -0.585 0.415 -0.585 0.415 + -0.322 0.678 -0.322 -0.322 + -0.585 0.415 -0.585 0.415 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.415 0.415 -0.585 -0.585 + -0.322 0.678 -0.322 -0.322 + 1.193 -0.807 -0.807 -0.807 + -0.585 0.415 0.415 -0.585 + 1.000 -0.585 -0.585 -0.585 + 0.778 -0.807 -0.807 0.193 + 0.415 -0.585 0.415 -0.585 + 0.000 0.000 0.000 0.000 + -0.322 0.678 -0.322 -0.322 + -0.322 0.678 -0.322 -0.322 + 0.000 0.000 0.000 0.000 + -0.322 0.678 -0.322 -0.322 + 0.678 -0.322 -0.322 -0.322 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + -0.322 -0.322 -0.322 0.678 + 0.778 0.193 -0.807 -0.807 + 0.541 -0.459 -0.459 0.126 + -0.322 0.678 -0.322 -0.322 + 0.263 0.263 -0.322 -0.322 + -0.322 0.678 -0.322 -0.322 + -0.585 -0.585 -0.585 1.000 + 0.415 -0.585 0.415 -0.585 + -0.322 -0.322 -0.322 0.678 + 0.415 -0.170 -1.170 0.415 + 0.778 -0.807 -0.807 0.193 + 0.585 0.000 0.000 -1.000 + -0.807 -0.807 0.193 0.778 + +Donor SDT 2 0 4 2 0.000 + GT WMM 9 3 4 0 0.000 + 0.497 0.497 -0.503 -1.087 + 1.082 -0.087 -0.503 -2.087 + -2.087 -1.087 1.372 -0.503 + -2.087 -2.087 1.720 -2.087 + -2.087 -2.087 -2.087 1.720 + 1.234 -2.087 0.234 -2.087 + 1.372 -2.087 -1.087 -0.503 + -0.503 -2.087 1.497 -2.087 + -0.087 -0.087 -1.087 0.720 + NN TRM 0 0 0 0 0.000 + +Inter LUT 5 4 4 0 0.000 + -0.415 -0.415 -0.193 0.700 + 0.608 0.193 -2.392 0.193 + 0.300 -0.115 -0.700 0.300 + -0.624 -0.209 0.250 0.376 + 0.234 -1.087 0.234 0.234 + 0.621 -0.700 -0.115 -0.115 + 0.415 -0.170 -0.170 -0.170 + -0.415 0.322 -2.000 0.807 + 0.526 -0.322 -0.644 0.163 + 0.234 -0.087 -2.087 0.720 + 0.300 0.300 -0.115 -0.700 + -0.202 -0.524 0.284 0.284 + 0.263 -1.322 -0.322 0.678 + 1.000 -0.585 -1.585 0.000 + 0.337 0.074 -1.248 0.337 + -0.322 -1.907 -0.322 1.093 + 0.126 -1.459 0.126 0.541 + -0.170 -1.170 -1.170 1.152 + -1.000 0.585 0.000 0.000 + -0.115 -0.115 0.621 -0.700 + 0.585 -0.415 0.322 -1.000 + -0.222 0.778 -0.807 -0.222 + 0.126 -0.459 0.541 -0.459 + -0.222 -0.222 0.193 0.193 + 0.585 0.000 0.000 -1.000 + 0.585 0.000 -1.000 0.000 + 0.678 -0.322 -0.322 -0.322 + -1.459 0.541 0.126 0.126 + 0.300 0.300 -0.115 -0.700 + -2.170 0.830 -0.585 0.415 + -0.459 -0.459 0.126 0.541 + 0.107 -0.379 -0.115 0.300 + 0.107 -1.115 0.621 -0.115 + 0.678 -0.322 -0.322 -0.322 + 0.497 -1.087 -0.503 0.497 + 0.152 0.152 0.152 -0.585 + 1.170 -0.415 -0.415 -2.000 + 0.885 -0.115 -1.700 -0.115 + -0.322 0.678 -0.322 -0.322 + -0.222 -0.222 -0.222 0.515 + 0.322 0.000 0.322 -1.000 + -0.222 0.193 -0.807 0.515 + -0.907 0.093 0.415 0.093 + -0.807 -0.807 0.778 0.193 + 0.585 0.585 -1.000 -1.000 + 0.778 0.193 -1.807 -0.222 + -0.322 0.263 0.263 -0.322 + 0.000 -1.000 0.000 0.585 + -0.170 -0.585 0.830 -0.585 + -0.170 -0.170 -1.170 0.830 + 0.541 -1.459 0.541 -0.459 + -0.644 -1.644 -0.059 1.057 + -0.087 -0.503 0.720 -0.503 + 0.126 -0.459 -1.459 0.862 + 0.678 -0.322 -0.322 -0.322 + -0.222 -0.807 0.193 0.515 + 0.415 -1.170 -0.585 0.637 + -0.115 0.300 -1.700 0.621 + 0.737 0.000 -1.585 0.000 + -0.807 0.415 -1.392 0.778 + 0.678 -1.644 -0.644 0.526 + 0.126 0.126 -1.459 0.541 + -0.585 0.000 -0.585 0.737 + 0.415 -0.222 -0.222 -0.070 + 0.778 -0.392 -0.807 -0.070 + -1.000 -1.000 0.585 0.585 + 0.126 -0.459 0.126 0.126 + 0.541 -1.459 0.126 0.126 + 0.263 -0.322 0.678 -1.322 + 0.000 0.585 -0.415 -0.415 + -0.170 0.415 -1.170 0.415 + -0.087 0.234 0.720 -2.087 + -0.170 -0.170 0.415 -0.170 + 0.637 0.152 -1.170 -0.170 + 0.263 -0.737 0.263 0.000 + 0.152 -1.170 0.637 -0.170 + -1.585 0.000 0.415 0.415 + -0.170 -1.170 -1.170 1.152 + 0.322 -1.000 0.000 0.322 + 1.126 -0.459 -1.459 -0.459 + 0.415 -1.585 0.737 -0.585 + -0.392 0.608 -0.392 -0.070 + 0.126 -0.874 0.126 0.348 + -0.807 -0.807 1.000 -0.222 + -1.807 0.778 0.515 -0.807 + 0.193 -0.222 0.515 -0.807 + -0.807 0.778 0.193 -0.807 + -1.170 -0.170 1.152 -1.170 + 0.126 -0.459 0.126 0.126 + -1.907 0.093 0.415 0.415 + -0.807 0.778 0.193 -0.807 + -1.000 0.000 1.000 -1.000 + 0.415 0.415 -1.170 -0.170 + 0.000 0.585 -2.000 0.322 + -1.700 0.621 0.300 -0.115 + -0.415 -1.000 0.000 0.807 + 0.415 -0.170 -0.170 -0.170 + -0.585 0.415 -0.585 0.415 + 0.000 -1.000 1.000 -1.000 + -0.807 0.193 0.193 0.193 + -1.000 1.000 0.000 -1.000 + -0.322 0.415 0.093 -0.322 + -1.170 1.152 -0.170 -1.170 + -0.585 1.000 0.000 -1.585 + -1.170 -0.170 -0.170 0.830 + -0.585 -1.585 0.737 0.415 + -1.170 0.830 0.415 -1.170 + -1.000 0.585 0.000 0.000 + 0.000 0.000 0.000 0.000 + -0.322 0.263 -0.322 0.263 + 0.678 -1.322 0.263 -0.322 + -0.585 -0.585 0.415 0.415 + 0.585 -2.000 0.000 0.322 + -0.907 0.415 -0.322 0.415 + 0.830 -1.170 -0.170 -0.170 + 0.415 0.415 -1.170 -0.170 + -0.115 -0.115 0.885 -1.700 + -0.459 -0.138 0.126 0.348 + -1.170 0.415 0.415 -0.170 + -1.459 0.126 0.710 -0.138 + -0.807 0.193 0.515 -0.222 + -0.874 0.862 -2.459 0.541 + -0.070 -0.392 0.778 -0.807 + -0.755 0.415 -1.170 0.705 + 0.807 -2.000 -1.000 0.585 + -0.222 0.193 -1.807 0.778 + -0.737 -0.737 0.485 0.485 + -0.392 -0.807 -0.807 1.067 + -0.202 -0.939 0.476 0.284 + -1.585 0.415 0.000 0.415 + 0.000 0.000 -2.322 0.848 + 0.720 -1.087 -1.087 0.497 + -1.700 -0.115 0.621 0.300 + -0.585 0.000 0.415 0.000 + 0.000 0.000 -1.000 0.585 + -1.000 0.000 -0.415 0.807 + 0.720 -0.503 -0.503 -0.087 + 0.415 0.415 -1.170 -0.170 + -0.087 0.234 -0.503 0.234 + 0.000 0.322 -0.415 0.000 + 0.885 -0.700 -0.700 -0.115 + 0.515 -0.222 -0.807 0.193 + -0.322 -0.322 0.093 0.415 + 0.193 -0.807 -1.807 1.000 + 1.000 -0.807 -0.807 -0.222 + -0.459 0.541 -0.459 0.126 + 0.234 -0.503 0.720 -1.087 + 0.000 0.000 -1.000 0.585 + -1.322 0.263 0.485 0.000 + -2.322 -0.322 0.263 0.848 + -0.585 0.737 0.415 -1.585 + -0.585 0.737 0.415 -1.585 + -0.322 -0.322 0.678 -0.322 + -0.907 0.900 -0.907 0.093 + -0.322 -0.322 0.263 0.263 + -0.322 0.678 -0.322 -0.322 + 0.126 0.541 0.126 -1.459 + -0.170 0.415 -0.585 0.152 + -0.755 0.052 0.052 0.415 + -0.322 -0.322 0.678 -0.322 + 0.778 -0.222 0.193 -1.807 + 0.093 0.093 -1.907 0.678 + 0.234 -1.087 0.497 -0.087 + 0.193 -0.222 -0.222 0.193 + 0.126 -0.459 0.541 -0.459 + 0.193 0.515 -0.222 -0.807 + -0.807 0.778 0.193 -0.807 + -1.087 0.234 0.913 -1.087 + -0.700 -0.115 0.300 0.300 + -0.503 0.497 -0.087 -0.087 + 0.074 -0.663 0.337 0.074 + -0.807 0.193 0.778 -0.807 + -0.170 -0.170 -0.170 0.415 + 0.126 -0.459 -0.459 0.541 + -0.248 0.074 0.752 -1.248 + 0.126 -0.459 0.126 0.126 + 0.807 0.322 -1.000 -1.000 + -0.222 0.515 -1.807 0.515 + 1.193 -0.807 -0.807 -0.807 + -0.170 -0.170 -0.170 0.415 + 0.000 0.000 0.000 0.000 + 0.515 -1.807 -0.807 0.778 + 0.000 -1.000 0.585 0.000 + 0.585 0.000 -1.000 0.000 + 0.152 0.152 0.152 -0.585 + 0.322 0.322 -1.000 0.000 + 0.415 -1.170 0.415 -0.170 + 0.830 -1.170 -0.170 -0.170 + 0.678 -0.322 -1.907 0.415 + -0.170 0.830 -1.170 -0.170 + 0.322 0.322 -0.415 -0.415 + 0.061 -0.939 -0.202 0.646 + 0.263 -0.322 -0.322 0.263 + 1.000 -0.807 -0.807 -0.222 + 0.778 -0.392 -0.070 -0.807 + -0.415 -2.000 -0.415 1.170 + -0.170 -0.170 -0.170 0.415 + 0.515 -0.222 -1.807 0.515 + -0.585 -0.585 -0.585 1.000 + -0.322 -0.322 -2.322 1.138 + 0.585 -0.415 0.000 -0.415 + 0.000 0.000 0.000 0.000 + -0.170 -0.170 0.415 -0.170 + -0.170 0.415 0.415 -1.170 + 0.152 -1.170 -2.170 1.152 + 0.415 0.737 -1.585 -0.585 + 0.093 -0.322 -0.907 0.678 + 0.041 -0.807 -1.129 0.958 + 1.000 0.193 -1.807 -0.807 + -0.585 0.415 -0.585 0.415 + 0.074 0.337 -0.663 0.074 + 0.621 -0.700 -0.115 -0.115 + -0.663 0.337 0.074 0.074 + 1.000 -1.585 -1.585 0.415 + 0.541 -0.459 -0.459 0.126 + -1.524 -0.524 0.476 0.646 + 0.415 -0.585 -0.585 0.415 + 0.415 0.415 -0.585 -0.585 + 0.415 0.415 -1.170 -0.170 + -0.585 0.415 0.415 -0.585 + 0.585 0.000 -1.000 0.000 + 0.193 -0.807 -0.807 0.778 + 0.193 -0.392 -0.807 0.608 + -0.248 0.074 0.337 -0.248 + 0.284 -0.524 -0.524 0.476 + -0.700 -0.115 -0.115 0.621 + 0.000 -0.415 0.000 0.322 + -0.503 -0.087 0.234 0.234 + -1.907 -0.907 1.093 0.093 + 0.348 0.348 -0.459 -0.459 + -0.585 0.415 0.415 -0.585 + -0.524 -0.524 1.177 -1.524 + 0.126 0.126 0.126 -0.459 + -0.115 -0.115 -0.115 0.300 + 0.000 0.263 0.000 -0.322 + 0.193 -0.807 0.515 -0.222 + 0.807 0.322 -2.000 -0.415 + 0.074 0.074 -0.663 0.337 + 0.862 0.541 -1.459 -1.459 + -0.100 -0.907 -0.100 0.678 + 1.166 -1.036 -0.550 -0.773 + -0.459 -0.459 -1.459 1.126 + 0.541 -1.459 -0.459 0.541 + -0.040 -0.888 -0.624 0.878 + 0.000 -0.585 -0.585 0.737 + 0.637 -0.170 -1.170 0.152 + -0.322 -0.322 0.678 -0.322 + 0.152 -1.170 0.415 0.152 + 1.074 -1.248 -0.663 -0.248 + 0.093 -0.322 -0.907 0.678 + 0.415 -0.170 -0.170 -0.170 + 0.074 -1.248 -0.248 0.752 + 0.710 -1.138 -1.459 0.628 + -0.248 0.559 -1.248 0.337 + 0.646 -0.524 0.061 -0.524 + 0.862 -1.459 -0.874 0.348 + +Intron LUT 5 4 4 0 0.000 + 0.451 -0.844 -0.719 0.554 + 0.893 -0.807 -2.807 0.515 + 0.652 -0.485 -0.485 0.000 + 0.300 -1.700 0.148 0.437 + 0.348 -0.874 0.126 0.126 + -0.700 0.621 -1.700 0.621 + 0.000 0.000 0.000 0.000 + -0.585 -0.585 -0.585 1.000 + 1.181 -0.322 -1.907 -0.585 + 1.000 -0.874 -2.459 0.348 + 0.515 -0.222 -0.807 0.193 + -0.379 -1.115 0.107 0.759 + 0.379 -0.737 -0.322 0.379 + 0.778 -0.222 -0.807 -0.222 + 0.830 -1.755 -1.170 0.567 + 0.316 -0.492 -0.492 0.415 + 0.848 -0.737 0.000 -0.737 + 1.447 -2.459 -1.459 -0.459 + 0.356 -1.644 0.163 0.356 + 0.163 -2.644 -0.322 0.941 + 0.000 -1.585 -0.585 1.000 + -0.392 0.930 -2.392 0.193 + -0.807 0.778 -0.807 0.193 + -0.503 -0.087 -0.087 0.497 + 0.000 0.000 0.000 0.000 + 0.778 0.193 -0.807 -0.807 + -0.170 -1.170 0.415 0.415 + 0.415 0.415 -0.585 -0.585 + -0.322 -0.322 0.093 0.415 + 0.678 -0.322 -1.322 0.263 + -0.087 -0.503 -0.503 0.720 + -0.433 0.245 -2.755 0.946 + 0.415 -1.907 0.263 0.263 + 0.637 -1.170 -0.585 0.415 + -0.503 -0.087 0.234 0.234 + 0.348 -1.459 0.541 -0.138 + 0.553 -1.907 0.415 -0.100 + 0.415 -0.070 -1.392 0.415 + -0.322 -0.322 -0.322 0.678 + -0.737 0.000 0.000 0.485 + 0.778 -0.807 0.193 -0.807 + 0.415 -0.585 -0.585 0.415 + 0.646 -0.939 0.646 -1.524 + 0.862 -0.874 0.126 -0.874 + 0.646 -0.939 -0.524 0.284 + 0.000 0.000 -2.000 0.807 + 0.193 -0.392 -0.070 0.193 + 0.041 -1.544 0.193 0.571 + 0.922 -1.663 -0.926 0.337 + 0.930 -0.392 -2.392 0.193 + 0.621 0.107 -0.700 -0.379 + 0.549 -1.036 -0.358 0.343 + 0.152 -2.170 0.152 0.637 + 0.621 -0.700 -0.700 0.300 + -0.585 1.000 -0.585 -0.585 + 0.152 -0.170 -2.170 0.830 + 0.163 -0.644 -0.322 0.526 + 0.126 0.541 -1.459 0.126 + 0.152 -0.170 -0.170 0.152 + 0.778 -0.807 -0.222 -0.222 + 0.379 -1.322 -0.737 0.766 + 0.126 -0.138 -1.459 0.710 + 0.526 -0.322 -1.644 0.526 + -0.123 -0.931 -1.123 1.069 + 0.330 -1.129 -1.544 0.958 + 0.000 0.415 -1.585 0.415 + -0.087 0.234 -0.087 -0.087 + 1.107 -1.700 -1.700 0.300 + -0.858 0.727 -0.051 -0.273 + -0.222 1.000 -0.222 -1.807 + -1.170 0.415 -0.170 0.415 + -1.807 -0.222 0.515 0.515 + -0.663 0.074 0.337 0.074 + 0.263 1.000 -2.322 -0.737 + -1.459 -0.044 0.278 0.541 + -0.138 -0.874 -0.874 1.000 + -2.248 -0.663 0.337 0.922 + -0.115 -0.115 -0.700 0.621 + -0.248 -1.248 0.922 -0.248 + 0.322 -0.193 -0.415 0.170 + 1.126 -0.459 -0.459 -1.459 + 0.074 0.337 -0.663 0.074 + -0.585 0.415 0.415 -0.585 + -0.379 -0.115 -0.115 0.469 + -1.858 -0.858 0.949 0.312 + 0.553 -0.100 -0.100 -0.585 + 0.541 -0.459 0.126 -0.459 + -0.202 0.476 0.284 -0.939 + 0.193 -0.807 0.778 -0.807 + -0.907 0.678 -0.907 0.415 + 0.193 0.778 -0.807 -0.807 + -1.000 -1.000 0.000 1.000 + 1.193 -0.807 -0.807 -0.807 + -0.322 0.816 -1.644 0.163 + 0.193 0.193 0.193 -0.807 + 0.126 -0.459 -0.459 0.541 + -0.322 -0.322 0.678 -0.322 + 0.000 0.000 0.000 0.000 + 0.000 -1.000 0.585 0.000 + 0.000 0.000 0.000 0.000 + -1.000 0.000 0.000 0.585 + -0.322 0.093 -0.322 0.415 + -0.322 0.678 -0.322 -0.322 + -1.170 -0.170 -0.170 0.830 + 0.415 0.415 -0.585 -0.585 + -1.000 0.000 -1.000 1.000 + -0.807 0.193 0.778 -0.807 + 0.415 -0.585 0.415 -0.585 + 1.000 -0.585 -0.585 -0.585 + -0.807 -0.807 0.193 0.778 + 0.415 -0.585 -0.585 0.415 + 0.000 0.000 -1.000 0.585 + 0.798 -0.202 -0.524 -0.524 + 0.263 0.678 -1.322 -0.322 + -1.585 -1.585 0.000 1.222 + 0.720 -0.503 -0.503 -0.087 + 0.348 0.126 -0.138 -0.459 + -1.644 0.526 -0.644 0.678 + 0.415 -0.585 0.415 -0.585 + -2.248 -0.248 1.074 -0.248 + -0.170 0.415 -1.170 0.415 + 0.710 0.541 -2.459 -0.459 + -0.524 -0.202 0.284 0.284 + -0.807 -0.392 0.608 0.193 + 0.526 -1.059 -0.059 0.163 + 0.284 0.061 -0.524 0.061 + -0.087 -0.503 0.234 0.234 + -0.322 0.456 -0.322 0.041 + 1.000 -1.115 -1.115 0.107 + 0.193 0.193 -0.807 0.193 + -0.392 -0.392 -1.392 1.067 + 0.415 -0.392 -1.392 0.608 + -0.248 -0.248 0.074 0.337 + -0.700 0.885 -1.700 0.300 + -0.807 0.193 0.778 -0.807 + 1.000 -1.807 -0.807 0.193 + 0.126 -0.459 -0.459 0.541 + 0.515 0.515 -0.807 -0.807 + -1.170 -0.585 1.152 -0.585 + 0.415 -0.392 -0.392 0.193 + 0.074 -0.663 0.559 -0.248 + 0.541 0.862 -1.459 -1.459 + -0.322 -0.907 0.093 0.678 + -0.170 -0.170 -1.170 0.830 + 1.000 -0.737 -0.737 -0.322 + 0.415 0.415 -0.170 -1.170 + -0.585 -0.585 1.115 -1.000 + -0.807 -0.807 0.515 0.515 + -0.874 0.541 -0.138 0.126 + -0.392 0.608 -2.392 0.608 + -1.322 1.000 -0.322 -0.322 + -0.585 0.415 0.222 -0.263 + 0.000 0.000 0.000 0.000 + -1.000 1.000 -1.000 0.000 + -0.322 -0.322 0.678 -0.322 + -0.585 0.415 0.415 -0.585 + 0.300 -0.115 -0.700 0.300 + 0.720 -0.087 -2.087 0.234 + -0.807 -0.392 0.778 -0.070 + -0.585 -0.170 0.152 0.415 + 0.193 -0.807 0.193 0.193 + 0.126 0.126 -1.459 0.541 + -0.248 -0.663 0.337 0.337 + 0.415 -0.907 -0.907 0.678 + 0.126 -1.459 1.126 -1.459 + 0.234 0.497 -2.087 0.234 + -1.000 1.000 -1.000 0.000 + -0.379 0.107 0.759 -1.115 + -0.392 -0.070 0.778 -0.807 + -1.087 0.720 -2.087 0.720 + -0.632 0.046 0.368 0.046 + 0.497 -0.503 0.234 -0.503 + 0.348 -2.459 0.541 0.126 + 0.300 -0.115 -1.700 0.621 + 0.559 0.074 -0.663 -0.248 + -0.807 -0.807 0.515 0.515 + 0.652 -1.807 0.778 -1.222 + 0.263 0.678 -1.322 -0.322 + 0.752 0.074 -1.248 -0.248 + 0.585 -1.000 -0.585 0.415 + 0.000 0.000 0.415 -0.585 + -0.222 1.000 -1.807 -0.222 + -0.322 0.678 -0.322 -0.322 + 0.126 -0.459 -0.459 0.541 + -0.322 -0.737 1.000 -0.737 + 0.193 0.778 -1.807 -0.222 + -0.939 0.284 0.798 -0.939 + -0.322 0.415 -0.322 0.093 + -0.737 -1.322 0.000 1.000 + -0.459 0.541 -1.459 0.541 + -0.807 -0.392 -0.392 0.930 + -0.402 -0.888 0.376 0.491 + 0.925 -0.561 -0.713 -0.298 + 0.000 -0.415 -2.000 1.000 + 0.759 0.300 -1.115 -0.700 + -0.170 -0.755 -0.170 0.705 + -0.070 -1.392 0.608 0.193 + 0.234 -0.503 -1.087 0.720 + -0.585 -0.585 1.000 -0.585 + -0.503 -1.087 0.497 0.497 + 0.052 -0.433 0.052 0.245 + 0.752 -0.663 -2.248 0.559 + 0.415 0.415 -1.585 0.000 + -0.115 -0.115 0.107 0.107 + 0.663 -0.415 -1.263 0.322 + 0.234 -1.087 -2.087 1.082 + 0.193 -0.070 -1.392 0.608 + -0.143 -2.143 -0.558 1.130 + 0.678 -0.644 -0.059 -0.322 + 0.585 0.000 -1.000 0.000 + -0.737 0.263 -0.322 0.485 + 0.152 -0.170 -0.585 0.415 + -0.737 0.263 0.263 0.000 + 0.930 -0.070 -1.392 -0.392 + -1.170 1.152 -1.170 -0.170 + -1.644 -0.322 0.678 0.356 + -0.585 -0.585 1.000 -0.585 + 0.193 0.778 -0.807 -0.807 + -0.585 1.000 -0.585 -0.585 + 0.193 0.193 -0.807 0.193 + 0.608 -1.392 -0.070 0.193 + 0.263 0.678 -1.322 -0.322 + -0.585 0.637 -0.585 0.152 + 0.415 -0.237 -0.237 -0.044 + 0.759 -1.700 -0.115 0.107 + 0.678 0.485 -1.322 -0.737 + -1.322 0.263 -0.322 0.678 + 0.126 0.126 -0.459 0.126 + 0.000 -0.322 0.678 -0.737 + 0.222 0.000 -0.585 0.222 + -0.322 -0.322 0.678 -0.322 + 0.193 -0.222 -0.222 0.193 + -1.170 -1.170 0.152 1.000 + -1.248 0.074 -0.663 0.922 + -0.059 -0.644 0.526 -0.059 + -0.524 0.061 0.061 0.284 + 0.263 -0.585 -0.322 0.415 + -0.503 0.497 -2.087 0.720 + -0.379 -0.700 1.107 -1.115 + -0.193 -1.000 -0.678 1.000 + 1.037 -0.700 -0.963 -0.285 + 0.152 0.152 -2.170 0.637 + 0.245 -0.170 -1.170 0.567 + 0.255 -1.248 -1.248 0.974 + 0.515 -0.222 0.000 -0.485 + 0.798 -0.939 -1.524 0.476 + -0.170 -1.170 -0.170 0.830 + 0.126 -0.044 -1.459 0.656 + 0.816 0.163 -1.059 -0.644 + 0.000 0.585 -1.000 0.000 + 0.263 -0.737 -0.737 0.678 + 0.227 -1.358 -0.188 0.642 + -0.026 -0.663 -0.373 0.691 + 0.491 -0.209 -2.209 0.598 + -0.115 -1.285 -0.115 0.802 + 0.258 -1.015 -0.899 0.826 + +Start SDT 3 0 4 2 0.000 + ATG WMM 15 9 4 0 0.000 + -0.585 -0.585 1.000 -0.585 + -0.585 0.415 0.415 -0.585 + -0.585 0.415 -0.585 0.415 + -0.585 -0.585 1.000 -0.585 + -0.585 0.415 -0.585 0.415 + 0.415 0.415 -0.585 -0.585 + 0.415 -0.585 -0.585 0.415 + -0.585 0.415 0.415 -0.585 + -0.585 0.415 -0.585 0.415 + 1.000 -0.585 -0.585 -0.585 + -0.585 -0.585 -0.585 1.000 + -0.585 -0.585 1.000 -0.585 + 0.415 0.415 -0.585 -0.585 + -0.585 -0.585 0.415 0.415 + -0.585 -0.585 0.415 0.415 + NNN TRM 0 0 0 0 0.000 + +Stop SDT 3 0 4 4 0.000 + TAA WMM 9 6 4 0 0.000 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + 0.000 0.000 0.000 0.000 + TAG WMM 9 6 4 0 0.000 + -0.322 -0.322 0.678 -0.322 + 0.678 -0.322 -0.322 -0.322 + 0.678 -0.322 -0.322 -0.322 + -0.322 0.678 -0.322 -0.322 + -0.322 -0.322 -0.322 0.678 + -0.322 -0.322 0.678 -0.322 + -0.322 -0.322 -0.322 0.678 + 0.678 -0.322 -0.322 -0.322 + -0.322 -0.322 0.678 -0.322 + TGA WMM 9 6 4 0 0.000 + -0.322 -0.322 0.678 -0.322 + -0.322 0.678 -0.322 -0.322 + -0.322 -0.322 0.678 -0.322 + -0.322 -0.322 -0.322 0.678 + -0.322 -0.322 0.678 -0.322 + -0.322 -0.322 0.678 -0.322 + -0.322 -0.322 -0.322 0.678 + -0.322 -0.322 0.678 -0.322 + 0.678 -0.322 -0.322 -0.322 + NNN TRM 0 0 0 0 0.000 +