Mercurial > repos > iuc > megan_blast2rma

changeset 0:fa3c3a64c993 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/megan commit 2a49a6cdc1b4d37ab30eb85b8c658ccf9f5a0644"
author iuc
date Wed, 24 Nov 2021 21:52:14 +0000
parents
children 2f8d3924bb3b
files blast2rma.xml macros.xml test-data/13-1941-6_S4_L001_R1_600000.fastq.gz test-data/13-1941-6_S4_L001_R2_600000.fastq.gz test-data/blast_R1.txt test-data/blast_R2.txt test-data/contaminants.txt test-data/kegg_output.txt test-data/taxonomy_output.txt
diffstat 9 files changed, 1337 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/blast2rma.xml	Wed Nov 24 21:52:14 2021 +0000
@@ -0,0 +1,246 @@
+<tool id="megan_blast2rma" name="MEGAN: Generate RMA files" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
+    <description>from BLAST output</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="bio_tools"/>
+    <expand macro="requirements"/>
+    <command detect_errors="exit_code"><![CDATA[
+#import re
+
+#if str($input_type_cond.input_type) in ['single', 'pair']:
+    #set read1 = $input_type_cond.read1
+    #set blast1 = $input_type_cond.blast1
+#else:
+    ## Processing paired reads are tricky if we're
+    ## downstream from MALT.  MALT doesn’t have a
+    ## paired-read mode, so it won’t attempt to analyze
+    ## reads in pairs.  To do paired read processing,
+    ## set MALT to generate SAM files and then import the
+    ## SAM files into MEGAN, specifying paired read mode
+    ## there. If you have multiple SAM files for the same
+    ## sample, then import them all at the same time to
+    ## create one unified rma6 file.
+
+    #set read1 = $input_type_cond.reads_collection['forward']
+    #set blast1 = $input_type_cond.blast1
+#end if
+
+#if $read1.is_of_type('fasta', 'fasta.gz'):
+    #set read_ext = '.fasta'
+#else:
+    #set read_ext = '.fastq'
+#end if
+#if $read1.ext.endswith('.gz'):
+    #set read_ext = $read_ext + '.gz'
+#end if
+
+#if $blast1.is_of_type('daa'):
+    #set blast_format = 'DAA'
+#else if $blast1.is_of_type('txt'):
+    #set blast_format = 'BlastText'
+#else if $blast1.is_of_type('blastxml'):
+    #set blast_format = 'BlastXML'
+#else if $blast1.is_of_type('tabular'):
+    #set blast_format = 'BlastTab'
+#else if $blast1.is_of_type('sam'):
+    #set blast_format = 'SAM'
+#end if
+#set blast_ext = '.' + $blast_format
+#if $blast1.ext.endswith('.gz'):
+    #set blast_ext = $blast_ext + '.gz'
+#end if
+
+#set read1_identifier = 'read1' + $read_ext
+ln -s '${read1}' '${read1_identifier}' &&
+
+#set blast1_identifier = 'blast1' + $blast_ext
+ln -s '${blast1}' '${blast1_identifier}' &&
+
+#if str($input_type_cond.input_type) in ['pair', 'paired']:
+    #if str($input_type_cond.input_type) == 'pair':
+        #set read2 = $input_type_cond.read2
+        #set blast2 = $input_type_cond.blast2
+    #else if str($input_type_cond.input_type) == 'paired':
+        #set read2 = $input_type_cond.reads_collection['reverse']
+        #set blast2 = $input_type_cond.blast2
+    #end if
+    #set read2_identifier = 'read2' + $read_ext
+    ln -s '${read2}' '${read2_identifier}' &&
+    #set blast2_identifier = 'blast2' + $blast_ext
+    ln -s '${blast2}' '${blast2_identifier}' &&
+#end if
+
+blast2rma 
+#if str($input_type_cond.input_type) == 'single':
+    --in '${blast1_identifier}'
+    --reads '${read1_identifier}'
+    --out '${rma6_output}'
+#else if str($input_type_cond.input_type) == 'pair':
+    --in '${blast1_identifier}' '${blast2_identifier}'
+    --reads '${read1_identifier}' '${read2_identifier}'
+    --paired
+    --pairedSuffixLength $input_type_cond.pairedSuffixLength 
+    --out '${rma6_output}'
+#else if str($input_type_cond.input_type) == 'paired':
+    --in '${blast1_identifier}' '${blast2_identifier}'
+    --reads '${read1_identifier}' '${read2_identifier}'
+    --paired
+    --pairedSuffixLength $input_type_cond.pairedSuffixLength 
+    ## Strangely, megan requires an output
+    ## directory when processing paired reads
+    ## even though it produces a single file.
+    ## We'll accommodate thie by prepending ./
+    ## to a temporary output file and then move
+    ## it later.
+    --out './tmp.rma6'
+#end if
+--format '${blast_format}'
+--blastMode '${blastMode}'
+--threads \${GALAXY_SLOTS:-8}
+--useCompression false
+$advanced_options.longReads
+--maxMatchesPerRead '$advanced_options.maxMatchesPerRead'
+$advanced_options.classify
+--minScore $advanced_options.minScore
+--maxExpected $advanced_options.maxExpected
+--minPercentIdentity $advanced_options.minPercentIdentity
+--topPercent $advanced_options.topPercent
+--minSupportPercent $advanced_options.minSupportPercent
+--minSupport $advanced_options.minSupport
+--minPercentReadCover $advanced_options.minPercentReadCover
+--minPercentReferenceCover $advanced_options.minPercentReferenceCover
+--minReadLength $advanced_options.minReadLength
+--lcaAlgorithm '$advanced_options.lcaAlgorithm'
+--lcaCoveragePercent $advanced_options.lcaCoveragePercent
+--readAssignmentMode '$advanced_options.readAssignmentMode'
+#if str($advanced_options.con_file_cond.conFile) == 'yes':
+    --conFile '$advanced_options.con_file_cond.conFile'
+#end if
+#if str($input_type_cond.input_type) == 'paired':
+    && mv './tmp.rma6' '$rma6_output'
+#end if
+]]></command>
+    <inputs>
+        <expand macro="input_type_cond"/>
+        <param argument="--blastMode" type="select" label="Blast mode">
+            <expand macro="blast_mode_options"/>
+        </param>
+        <section name="advanced_options" title="Advanced options" expanded="false">
+            <param argument="--longReads" type="boolean" truevalue="--longReads" falsevalue="" checked="false" label="Parse and analyse input reads as long reads?"/>
+            <param argument="--maxMatchesPerRead" type="integer" value="100" label="Maximum matches per read"/>
+            <param argument="--classify" type="boolean" truevalue="--classify" falsevalue="" checked="true" label="Run classification algorithm?"/>
+            <expand macro="common_blast_params"/>
+            <param argument="--minSupportPercent" type="float" value="0.05" min="0.0" max="100.0" label="Minimum support as percent of assigned reads" help="0 value ignores"/>
+            <param argument="--minSupport" type="integer" value="0" label="Minimum support" help="0 value ignores"/>
+            <param argument="--minPercentReadCover" type="float" value="0.0" min="0.0" max="100.0" label="Minimum percent of read length to be covered by alignments"/>
+            <param argument="--minPercentReferenceCover" type="float" value="0.0" min="0.0" max="100.0" label="Minimum percent of reference length to be covered by alignments"/>
+            <param argument="--minReadLength" type="integer" value="0" label="Minimum read length"/>
+            <param argument="--lcaAlgorithm" type="select" label="Select the LCA algorithm to use for taxonomic assignment">
+                <option value="naive" selected="true">naive</option>
+                <option value="weighted">weighted</option>
+                <option value="longReads">longReads</option>
+            </param>
+            <param argument="--lcaCoveragePercent" type="float" value="100.0" min="0.0" max="100.0" label="Percent for the LCA to cover"/>
+            <param argument="--readAssignmentMode" type="select" label="Select the read assignment mode">
+                <option value="alignedBases" selected="true">alignedBases</option>
+                <option value="readCount">readCount</option>
+            </param>
+            <conditional name="con_file_cond">
+                <param argument="--conFile" type="select" label="Process a file of contaminant taxa" help="One id or name per line">
+                    <option value="no" selected="true">No</option>
+                    <option value="yes">Yes</option>
+                </param>
+                <when value="no"/>
+                <when value="yes">
+                    <param argument="conFile" type="data" format="txt" label="File of contaminant taxa"/>
+                </when>
+            </conditional>
+        </section>
+    </inputs>
+    <outputs>
+        <data name="rma6_output" format="rma6"/>
+    </outputs>
+    <tests>
+        <!-- Single dataset input -->
+        <test expect_num_outputs="1">
+            <param name="read1" value="13-1941-6_S4_L001_R1_600000.fastq.gz" ftype="fastqsanger.gz"/>
+            <param name="blast1" value="blast_R1.txt" ftype="txt"/>
+            <param name="blastMode" value="BlastN"/>
+            <output name="rma6_output" ftype="rma6">
+                <assert_contents>
+                    <has_size value="19596"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Single dataset input, contaminants file -->
+        <test expect_num_outputs="1">
+            <param name="read1" value="13-1941-6_S4_L001_R1_600000.fastq.gz" ftype="fastqsanger.gz"/>
+            <param name="blast1" value="blast_R1.txt" ftype="txt"/>
+            <param name="blastMode" value="BlastN"/>
+            <param name="conFile" value="yes"/>
+            <param name="conFile" value="contaminants.txt" ftype="txt"/>
+            <output name="rma6_output" ftype="rma6">
+                <assert_contents>
+                    <has_size value="19596"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Dataset pair input -->
+        <test expect_num_outputs="1">
+            <param name="input_type" value="pair"/>
+            <param name="read1" value="13-1941-6_S4_L001_R1_600000.fastq.gz" ftype="fastqsanger.gz"/>
+            <param name="read2" value="13-1941-6_S4_L001_R2_600000.fastq.gz" ftype="fastqsanger.gz"/>
+            <param name="blast1" value="blast_R1.txt" ftype="txt"/>
+            <param name="blast2" value="blast_R2.txt" ftype="txt"/>
+            <param name="blastMode" value="BlastN"/>
+            <output name="rma6_output" ftype="rma6">
+                <assert_contents>
+                    <has_size value="39887"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- List of dataset pairs input -->
+        <test expect_num_outputs="1">
+            <param name="input_type" value="paired"/>
+            <param name="reads_collection">
+                <collection type="paired">
+                    <element name="forward" value="13-1941-6_S4_L001_R1_600000.fastq.gz"/>
+                    <element name="reverse" value="13-1941-6_S4_L001_R2_600000.fastq.gz"/>
+                </collection>
+            </param>
+            <param name="blast1" value="blast_R1.txt" ftype="txt"/>
+            <param name="blast2" value="blast_R2.txt" ftype="txt"/>
+            <param name="blastMode" value="BlastN"/>
+            <output name="rma6_output" ftype="rma6">
+                <assert_contents>
+                    <has_size value="39806"/>
+                </assert_contents>
+            </output>
+        </test>
+    </tests>
+    <help>
+**What it does**
+
+Computes MEGAN RMA files from BLAST (or similar) files.  Inputs consist of reads in fasta or fasqsanger format (gzip compressin
+is supported) and associated Blast files.  Each read file should have been used previously as the Blast input to produce the
+associated Blast file for this tool.
+
+This wrapper supports the following formats for the input Blast file.  The SAM, Tabular and Text formats can be produced by
+The Galaxy MALT Analyzer tool.  When these formats are used, this tool will apply the SAM, BlastText and BlastTab format options
+required by MEGAN.
+
+ * **Direct Access Archive (DAA)** - a proprietary file format developed by PowerISO Computing for disk image files
+ * **BlastXML** - XML output from Blast
+ * **Sequence Alignment/Map (SAM)** - a tab-delimited text format consisting of a header section, which is optional, and an alignment section
+ * **Tabular** - information presented in the form of a table with rows and columns
+ * **Text** - plain text format
+
+This tool outputs a RealMedia Audio (RMA) file.  MEGAN uses an update of the original RMA file format known as RMA6.  This update
+requires less disk space for files.
+    </help>
+    <citations>
+        <citation type="doi">https://doi.org/10.1101/050559</citation>
+    </citations>
+</tool>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml	Wed Nov 24 21:52:14 2021 +0000
@@ -0,0 +1,71 @@
+<macros>
+    <token name="@TOOL_VERSION@">6.21.7</token>
+    <token name="@VERSION_SUFFIX@">0</token>
+    <token name="@PROFILE@">20.09</token>
+    <xml name="bio_tools">
+        <xrefs>
+            <xref type="bio.tools">megan</xref>
+        </xrefs>
+    </xml>
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package" version="@TOOL_VERSION@">megan</requirement>
+        </requirements>
+    </xml>
+    <macro name="input_type_cond">
+        <conditional name="input_type_cond">
+            <param name="input_type" type="select" label="Choose the category of the reads files to be analyzed">
+                <option value="single" selected="true">Single dataset</option>
+                <option value="pair">Dataset pair</option>
+                <option value="paired">List of dataset pairs</option>
+            </param>
+            <when value="single">
+                <param name="read1" type="data" format="fasta,fasta.gz,fastqsanger.gz,fastqsanger" label="Forward read file" help="This read file should be the one used by Blast to generate the Blast file below"/>
+                <param name="blast1" type="data" format="daa,blastxml,sam,tabular,txt" label="Output file of Blast on input forward read file"/>
+            </when>
+            <when value="pair">
+                <param name="read1" type="data" format="fasta,fasta.gz,fastqsanger.gz,fastqsanger" label="Forward read file" help="This read file should be the one used by Blast to generate the Blast file below"/>
+                <param name="read2" type="data" format="fasta,fasta.gz,fastqsanger.gz,fastqsanger" label="Reverse read file" help="This read file should be the one used by Blast to generate the Blast file below"/>
+                <param argument="--pairedSuffixLength" type="integer" value="0" label="Length of name suffix used to distinguish read names" help="Use 0 if read and mate have the same name"/>
+                <param name="blast1" type="data" format="daa,blastxml,sam,tabular,txt" label="Output file of Blast on input forward read file"/>
+                <param name="blast2" type="data" format="daa,blastxml,sam,tabular,txt" label="Output file of Blast on input reverse read file"/>
+            </when>
+            <when value="paired">
+                <param name="reads_collection" type="data_collection" format="fasta,fasta.gz,fastqsanger,fastqsanger.gz" collection_type="paired" label="Collection of paired read files"/>
+                <param argument="--pairedSuffixLength" type="integer" value="0" label="Length of name suffix used to distinguish read names" help="Use 0 if read and mate have the same name"/>
+                <param name="blast1" type="data" format="daa,blastxml,sam,tabular,txt" label="Blast file for forward read"/>
+                <param name="blast2" type="data" format="daa,blastxml,sam,tabular,txt" label="Blast file for reverse read"/>
+            </when>
+        </conditional>
+    </macro>
+    <macro name="blast_mode_options">
+        <option value="Unknown" selected="true">Unknown</option>
+        <option value="BlastN">BlastN</option>
+        <option value="BlastP">BlastP</option>
+        <option value="BlastX">BlastX</option>
+        <option value="Classifier">Classifier</option>
+    </macro>
+    <macro name="common_blast_params">
+        <param argument="--minScore" type="float" value="50.0" label="Minimum score"/>
+        <param argument="--maxExpected" type="float" value="0.01" label="Maximum expected"/>
+        <param argument="--minPercentIdentity" type="float" value="0.0" min="0.0" max="100.0" label="Minimum percent identity"/>
+        <param argument="--topPercent" type="float" value="10.0" min="0.0" max="100.0" label="Top percent"/>
+    </macro>
+    <xml name="sanitize_query" token_validinitial="string.printable">
+        <sanitizer>
+            <valid initial="@VALIDINITIAL@">
+                <remove value="&apos;" />
+                <add value="|" />
+            </valid>
+            <mapping initial="none">
+                <add source="&apos;" target="&apos;&quot;&apos;&quot;&apos;" />
+            </mapping>
+       </sanitizer>
+    </xml>
+    <xml name="citations">
+        <citations>
+            <citation type="doi">10.1101/gr.5969107</citation>
+        </citations>
+    </xml>
+</macros>
+
Binary file test-data/13-1941-6_S4_L001_R1_600000.fastq.gz has changed
Binary file test-data/13-1941-6_S4_L001_R2_600000.fastq.gz has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/blast_R1.txt	Wed Nov 24 21:52:14 2021 +0000
@@ -0,0 +1,404 @@
+BLASTN output produced by MALT
+
+
+Query= XXXXXXXXXX:7:1101:1582:1835#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1610:1859#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1743:1871#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1536:1878#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2990:100153#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1624:1906#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1666:1926#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2921:100163#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1513:1929#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2759:100170#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1708:1937#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2981:100211#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1688:1946#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2767:100225#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1536:1959#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2797:100234#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1552:1976#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1748:1978#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2779:100239#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1593:1980#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2946:100242#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1987:1781#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3046:100006#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1900:1788#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3214:100027#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1848:1879#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3237:100032#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3027:100049#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1756:1891#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3238:100065#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1915:1901#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3198:100082#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1964:1931#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3088:100091#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1840:1948#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3105:100094#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1958:1952#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3190:100106#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1993:1999#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3117:100110#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2159:1798#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3147:100111#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2152:1838#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3065:100152#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2180:1843#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3154:100159#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2125:1861#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3198:100173#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2076:1911#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3166:100190#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2196:1920#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3225:100207#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2115:1927#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3019:100219#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2179:1937#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3202:100230#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2149:1945#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3211:100242#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2169:1964#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3168:100244#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3005:100246#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2313:1789#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3253:100014#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2361:1794#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2337:1794#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3284:100039#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2477:1795#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3310:100056#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2355:1821#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3420:100060#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2418:1834#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3267:100061#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2378:1838#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3416:100083#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2481:1853#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3411:100111#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3258:100128#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2252:1856#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3428:100129#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2394:1871#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3387:100138#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2269:1904#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3444:100163#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2259:1943#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3371:100179#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2371:1957#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3311:100186#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2394:1961#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3438:100192#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2333:1962#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3479:100209#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2459:1990#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3417:100210#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2372:1994#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3452:100214#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2677:1830#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3354:100219#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2603:1846#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3600:100019#/1
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2535:1848#/1
+
+***** No hits found ******
+
+EOF
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/blast_R2.txt	Wed Nov 24 21:52:14 2021 +0000
@@ -0,0 +1,404 @@
+BLASTN output produced by MALT
+
+
+Query= XXXXXXXXXX:7:1101:1582:1835#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1610:1859#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1743:1871#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1536:1878#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2990:100153#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1624:1906#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1666:1926#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2921:100163#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1513:1929#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2759:100170#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1708:1937#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2981:100211#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1688:1946#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2767:100225#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1536:1959#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2797:100234#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1552:1976#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1748:1978#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2779:100239#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1593:1980#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2946:100242#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1987:1781#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3046:100006#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1900:1788#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3214:100027#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1848:1879#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3237:100032#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3027:100049#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1756:1891#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3238:100065#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1915:1901#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3198:100082#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1964:1931#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3088:100091#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1840:1948#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3105:100094#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1958:1952#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3190:100106#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:1993:1999#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3117:100110#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2159:1798#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3147:100111#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2152:1838#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3065:100152#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2180:1843#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3154:100159#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2125:1861#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3198:100173#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2076:1911#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3166:100190#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2196:1920#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3225:100207#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2115:1927#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3019:100219#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2179:1937#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3202:100230#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2149:1945#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3211:100242#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2169:1964#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3168:100244#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3005:100246#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2313:1789#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3253:100014#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2361:1794#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2337:1794#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3284:100039#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2477:1795#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3310:100056#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2355:1821#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3420:100060#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2418:1834#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3267:100061#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2378:1838#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3416:100083#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2481:1853#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3411:100111#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3258:100128#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2252:1856#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3428:100129#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2394:1871#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3387:100138#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2269:1904#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3444:100163#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2259:1943#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3371:100179#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2371:1957#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3311:100186#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2394:1961#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3438:100192#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2333:1962#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3479:100209#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2459:1990#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3417:100210#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2372:1994#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3452:100214#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2677:1830#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3354:100219#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2603:1846#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:3600:100019#/2
+
+***** No hits found ******
+
+Query= XXXXXXXXXX:7:1101:2535:1848#/2
+
+***** No hits found ******
+
+EOF
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/contaminants.txt	Wed Nov 24 21:52:14 2021 +0000
@@ -0,0 +1,12 @@
+Illumina Single End Adapter 1					ACACTCTTTCCCTACACGACGCTGTTCCATCT
+Illumina Single End Adapter 2					CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
+Illumina Single End PCR Primer 1				AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
+Illumina Single End PCR Primer 2				CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
+Illumina Single End Sequencing Primer			ACACTCTTTCCCTACACGACGCTCTTCCGATCT
+
+Illumina Paired End Adapter 1					ACACTCTTTCCCTACACGACGCTCTTCCGATCT
+Illumina Paired End Adapter 2					CTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
+Illumina Paried End PCR Primer 1				AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
+Illumina Paired End PCR Primer 2				CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
+Illumina Paried End Sequencing Primer 1			ACACTCTTTCCCTACACGACGCTCTTCCGATCT
+Illumina Paired End Sequencing Primer 2			CGGTCTCGGCATTCCTACTGAACCGCTCTTCCGATCT
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/kegg_output.txt	Wed Nov 24 21:52:14 2021 +0000
@@ -0,0 +1,100 @@
+XXXXXXXXXX:7:1101:1582:1835#/1; ;
+XXXXXXXXXX:7:1101:1610:1859#/1; ;
+XXXXXXXXXX:7:1101:1743:1871#/1; ;
+XXXXXXXXXX:7:1101:1536:1878#/1; ;
+XXXXXXXXXX:7:1101:2990:100153#/1; ;
+XXXXXXXXXX:7:1101:1624:1906#/1; ;
+XXXXXXXXXX:7:1101:1666:1926#/1; ;
+XXXXXXXXXX:7:1101:2921:100163#/1; ;
+XXXXXXXXXX:7:1101:1513:1929#/1; ;
+XXXXXXXXXX:7:1101:2759:100170#/1; ;
+XXXXXXXXXX:7:1101:1708:1937#/1; ;
+XXXXXXXXXX:7:1101:2981:100211#/1; ;
+XXXXXXXXXX:7:1101:1688:1946#/1; ;
+XXXXXXXXXX:7:1101:2767:100225#/1; ;
+XXXXXXXXXX:7:1101:1536:1959#/1; ;
+XXXXXXXXXX:7:1101:2797:100234#/1; ;
+XXXXXXXXXX:7:1101:1552:1976#/1; ;
+XXXXXXXXXX:7:1101:1748:1978#/1; ;
+XXXXXXXXXX:7:1101:2779:100239#/1; ;
+XXXXXXXXXX:7:1101:1593:1980#/1; ;
+XXXXXXXXXX:7:1101:2946:100242#/1; ;
+XXXXXXXXXX:7:1101:1987:1781#/1; ;
+XXXXXXXXXX:7:1101:3046:100006#/1; ;
+XXXXXXXXXX:7:1101:1900:1788#/1; ;
+XXXXXXXXXX:7:1101:3214:100027#/1; ;
+XXXXXXXXXX:7:1101:1848:1879#/1; ;
+XXXXXXXXXX:7:1101:3237:100032#/1; ;
+XXXXXXXXXX:7:1101:3027:100049#/1; ;
+XXXXXXXXXX:7:1101:1756:1891#/1; ;
+XXXXXXXXXX:7:1101:3238:100065#/1; ;
+XXXXXXXXXX:7:1101:1915:1901#/1; ;
+XXXXXXXXXX:7:1101:3198:100082#/1; ;
+XXXXXXXXXX:7:1101:1964:1931#/1; ;
+XXXXXXXXXX:7:1101:3088:100091#/1; ;
+XXXXXXXXXX:7:1101:1840:1948#/1; ;
+XXXXXXXXXX:7:1101:3105:100094#/1; ;
+XXXXXXXXXX:7:1101:1958:1952#/1; ;
+XXXXXXXXXX:7:1101:3190:100106#/1; ;
+XXXXXXXXXX:7:1101:1993:1999#/1; ;
+XXXXXXXXXX:7:1101:3117:100110#/1; ;
+XXXXXXXXXX:7:1101:2159:1798#/1; ;
+XXXXXXXXXX:7:1101:3147:100111#/1; ;
+XXXXXXXXXX:7:1101:2152:1838#/1; ;
+XXXXXXXXXX:7:1101:3065:100152#/1; ;
+XXXXXXXXXX:7:1101:2180:1843#/1; ;
+XXXXXXXXXX:7:1101:3154:100159#/1; ;
+XXXXXXXXXX:7:1101:2125:1861#/1; ;
+XXXXXXXXXX:7:1101:3198:100173#/1; ;
+XXXXXXXXXX:7:1101:2076:1911#/1; ;
+XXXXXXXXXX:7:1101:3166:100190#/1; ;
+XXXXXXXXXX:7:1101:2196:1920#/1; ;
+XXXXXXXXXX:7:1101:3225:100207#/1; ;
+XXXXXXXXXX:7:1101:2115:1927#/1; ;
+XXXXXXXXXX:7:1101:3019:100219#/1; ;
+XXXXXXXXXX:7:1101:2179:1937#/1; ;
+XXXXXXXXXX:7:1101:3202:100230#/1; ;
+XXXXXXXXXX:7:1101:2149:1945#/1; ;
+XXXXXXXXXX:7:1101:3211:100242#/1; ;
+XXXXXXXXXX:7:1101:2169:1964#/1; ;
+XXXXXXXXXX:7:1101:3168:100244#/1; ;
+XXXXXXXXXX:7:1101:3005:100246#/1; ;
+XXXXXXXXXX:7:1101:2313:1789#/1; ;
+XXXXXXXXXX:7:1101:3253:100014#/1; ;
+XXXXXXXXXX:7:1101:2361:1794#/1; ;
+XXXXXXXXXX:7:1101:2337:1794#/1; ;
+XXXXXXXXXX:7:1101:3284:100039#/1; ;
+XXXXXXXXXX:7:1101:2477:1795#/1; ;
+XXXXXXXXXX:7:1101:3310:100056#/1; ;
+XXXXXXXXXX:7:1101:2355:1821#/1; ;
+XXXXXXXXXX:7:1101:3420:100060#/1; ;
+XXXXXXXXXX:7:1101:2418:1834#/1; ;
+XXXXXXXXXX:7:1101:3267:100061#/1; ;
+XXXXXXXXXX:7:1101:2378:1838#/1; ;
+XXXXXXXXXX:7:1101:3416:100083#/1; ;
+XXXXXXXXXX:7:1101:2481:1853#/1; ;
+XXXXXXXXXX:7:1101:3411:100111#/1; ;
+XXXXXXXXXX:7:1101:3258:100128#/1; ;
+XXXXXXXXXX:7:1101:2252:1856#/1; ;
+XXXXXXXXXX:7:1101:3428:100129#/1; ;
+XXXXXXXXXX:7:1101:2394:1871#/1; ;
+XXXXXXXXXX:7:1101:3387:100138#/1; ;
+XXXXXXXXXX:7:1101:2269:1904#/1; ;
+XXXXXXXXXX:7:1101:3444:100163#/1; ;
+XXXXXXXXXX:7:1101:2259:1943#/1; ;
+XXXXXXXXXX:7:1101:3371:100179#/1; ;
+XXXXXXXXXX:7:1101:2371:1957#/1; ;
+XXXXXXXXXX:7:1101:3311:100186#/1; ;
+XXXXXXXXXX:7:1101:2394:1961#/1; ;
+XXXXXXXXXX:7:1101:3438:100192#/1; ;
+XXXXXXXXXX:7:1101:2333:1962#/1; ;
+XXXXXXXXXX:7:1101:3479:100209#/1; ;
+XXXXXXXXXX:7:1101:2459:1990#/1; ;
+XXXXXXXXXX:7:1101:3417:100210#/1; ;
+XXXXXXXXXX:7:1101:2372:1994#/1; ;
+XXXXXXXXXX:7:1101:3452:100214#/1; ;
+XXXXXXXXXX:7:1101:2677:1830#/1; ;
+XXXXXXXXXX:7:1101:3354:100219#/1; ;
+XXXXXXXXXX:7:1101:2603:1846#/1; ;
+XXXXXXXXXX:7:1101:3600:100019#/1; ;
+XXXXXXXXXX:7:1101:2535:1848#/1; ;
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/taxonomy_output.txt	Wed Nov 24 21:52:14 2021 +0000
@@ -0,0 +1,100 @@
+XXXXXXXXXX:7:1101:1582:1835#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:1610:1859#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:1743:1871#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:1536:1878#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2990:100153#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:1624:1906#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:1666:1926#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2921:100163#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:1513:1929#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2759:100170#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:1708:1937#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2981:100211#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:1688:1946#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2767:100225#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:1536:1959#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2797:100234#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:1552:1976#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:1748:1978#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2779:100239#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:1593:1980#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2946:100242#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:1987:1781#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3046:100006#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:1900:1788#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3214:100027#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:1848:1879#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3237:100032#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3027:100049#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:1756:1891#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3238:100065#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:1915:1901#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3198:100082#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:1964:1931#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3088:100091#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:1840:1948#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3105:100094#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:1958:1952#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3190:100106#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:1993:1999#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3117:100110#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2159:1798#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3147:100111#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2152:1838#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3065:100152#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2180:1843#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3154:100159#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2125:1861#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3198:100173#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2076:1911#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3166:100190#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2196:1920#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3225:100207#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2115:1927#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3019:100219#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2179:1937#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3202:100230#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2149:1945#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3211:100242#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2169:1964#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3168:100244#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3005:100246#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2313:1789#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3253:100014#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2361:1794#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2337:1794#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3284:100039#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2477:1795#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3310:100056#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2355:1821#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3420:100060#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2418:1834#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3267:100061#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2378:1838#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3416:100083#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2481:1853#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3411:100111#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3258:100128#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2252:1856#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3428:100129#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2394:1871#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3387:100138#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2269:1904#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3444:100163#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2259:1943#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3371:100179#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2371:1957#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3311:100186#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2394:1961#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3438:100192#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2333:1962#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3479:100209#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2459:1990#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3417:100210#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2372:1994#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3452:100214#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2677:1830#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3354:100219#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2603:1846#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:3600:100019#/1; ; No hits; 100;
+XXXXXXXXXX:7:1101:2535:1848#/1; ; No hits; 100;