Mercurial > repos > iuc > mothur_corr_axes

view test-data/sample2.fa @ 10:b030bd08117b draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 7599ef16dc8b83ee49236ed5bb229260c969b0ab
author iuc
date Mon, 17 Jun 2024 12:26:18 +0000
parents 9961b707d075
children
line wrap: on
line source

> seq1 This is the description of my first and only sequence in sample 2.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC