Mercurial > repos > iuc > multiqc

comparison test-data/porechop.log @ 27:7591bce96601 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/multiqc commit 327834d2ea9b16f0f0264fa4e9b675a2277f2fee
author iuc
date Tue, 18 Feb 2025 23:18:25 +0000
parents
children
comparison
equal deleted inserted replaced
26:d2aaac19f42f 27:7591bce96601
1
2 Loading reads
3 /tmp/tmp4zxnky4h/files/5/c/1/dataset_5c125cad-e633-41bc-8f37-36d6af3f5f0f.dat
4 9 reads loaded
5
6
7 Looking for known adapter sets
8
9 0 / 9 (0.0%)
10 9 / 9 (100.0%)
11 9 / 9 (100.0%)
12 Best 
13 read Best 
14 start read end
15 Set %ID %ID 
16 SQK-NSK007 96.4 95.5
17 Rapid 62.5 0.0
18 RBK004_upstream 72.7 0.0
19 SQK-MAP006 62.2 63.6
20 SQK-MAP006 short 60.7 60.0
21 PCR adapters 1 66.7 73.9
22 PCR adapters 2 66.7 63.6
23 PCR adapters 3 68.0 72.0
24 1D^2 part 1 62.1 58.8
25 1D^2 part 2 79.4 68.8
26 cDNA SSP 57.1 61.4
27 Barcode 1 (reverse) 59.4 66.7
28 Barcode 2 (reverse) 66.7 63.0
29 Barcode 3 (reverse) 69.2 72.0
30 Barcode 4 (reverse) 66.7 63.3
31 Barcode 5 (reverse) 62.5 66.7
32 Barcode 6 (reverse) 73.1 62.5
33 Barcode 7 (reverse) 65.4 65.5
34 Barcode 8 (reverse) 69.2 58.3
35 Barcode 9 (reverse) 75.0 66.7
36 Barcode 10 (reverse) 62.5 60.0
37 Barcode 11 (reverse) 69.2 60.5
38 Barcode 12 (reverse) 65.6 64.0
39 Barcode 1 (forward) 65.4 61.5
40 Barcode 2 (forward) 69.2 70.4
41 Barcode 3 (forward) 73.1 68.0
42 Barcode 4 (forward) 73.1 64.3
43 Barcode 5 (forward) 62.5 66.7
44 Barcode 6 (forward) 65.5 65.6
45 Barcode 7 (forward) 73.1 66.7
46 Barcode 8 (forward) 62.1 60.7
47 Barcode 9 (forward) 68.0 70.8
48 Barcode 10 (forward) 69.2 66.7
49 Barcode 11 (forward) 65.4 60.7
50 Barcode 12 (forward) 64.3 66.7
51 Barcode 13 (forward) 64.3 69.2
52 Barcode 14 (forward) 63.3 66.7
53 Barcode 15 (forward) 66.7 66.7
54 Barcode 16 (forward) 70.8 65.5
55 Barcode 17 (forward) 69.2 66.7
56 Barcode 18 (forward) 70.4 70.4
57 Barcode 19 (forward) 65.5 64.0
58 Barcode 20 (forward) 65.5 64.0
59 Barcode 21 (forward) 64.3 66.7
60 Barcode 22 (forward) 69.2 68.0
61 Barcode 23 (forward) 61.5 66.7
62 Barcode 24 (forward) 66.7 65.4
63 Barcode 25 (forward) 64.0 65.5
64 Barcode 26 (forward) 72.0 72.0
65 Barcode 27 (forward) 77.8 60.7
66 Barcode 28 (forward) 65.5 66.7
67 Barcode 29 (forward) 62.5 66.7
68 Barcode 30 (forward) 68.0 65.4
69 Barcode 31 (forward) 62.5 69.2
70 Barcode 32 (forward) 68.0 70.8
71 Barcode 33 (forward) 62.5 70.4
72 Barcode 34 (forward) 64.0 62.5
73 Barcode 35 (forward) 65.5 65.4
74 Barcode 36 (forward) 63.0 63.0
75 Barcode 37 (forward) 67.9 64.3
76 Barcode 38 (forward) 64.0 62.1
77 Barcode 39 (forward) 64.0 69.2
78 Barcode 40 (forward) 62.5 64.0
79 Barcode 41 (forward) 68.0 65.5
80 Barcode 42 (forward) 70.4 69.2
81 Barcode 43 (forward) 63.3 63.3
82 Barcode 44 (forward) 60.0 66.7
83 Barcode 45 (forward) 73.1 65.4
84 Barcode 46 (forward) 65.4 60.7
85 Barcode 47 (forward) 65.5 64.0
86 Barcode 48 (forward) 71.4 62.1
87 Barcode 49 (forward) 69.2 62.1
88 Barcode 50 (forward) 66.7 63.0
89 Barcode 51 (forward) 69.2 64.3
90 Barcode 52 (forward) 66.7 64.0
91 Barcode 53 (forward) 67.9 69.0
92 Barcode 54 (forward) 69.2 64.0
93 Barcode 55 (forward) 66.7 73.1
94 Barcode 56 (forward) 66.7 72.0
95 Barcode 57 (forward) 69.0 60.0
96 Barcode 58 (forward) 70.4 72.0
97 Barcode 59 (forward) 56.7 66.7
98 Barcode 60 (forward) 66.7 66.7
99 Barcode 61 (forward) 70.8 65.5
100 Barcode 62 (forward) 66.7 68.0
101 Barcode 63 (forward) 66.7 60.7
102 Barcode 64 (forward) 69.2 66.7
103 Barcode 65 (forward) 61.5 69.0
104 Barcode 66 (forward) 64.3 63.0
105 Barcode 67 (forward) 66.7 67.9
106 Barcode 68 (forward) 67.9 69.2
107 Barcode 69 (forward) 69.2 75.0
108 Barcode 70 (forward) 64.3 73.1
109 Barcode 71 (forward) 64.0 71.4
110 Barcode 72 (forward) 66.7 62.1
111 Barcode 73 (forward) 67.7 64.0
112 Barcode 74 (forward) 64.5 68.0
113 Barcode 75 (forward) 65.4 65.5
114 Barcode 76 (forward) 70.4 70.8
115 Barcode 77 (forward) 65.4 64.3
116 Barcode 78 (forward) 67.7 63.0
117 Barcode 79 (forward) 70.8 69.2
118 Barcode 80 (forward) 71.4 72.0
119 Barcode 81 (forward) 68.0 66.7
120 Barcode 82 (forward) 64.7 66.7
121 Barcode 83 (forward) 69.2 68.0
122 Barcode 84 (forward) 70.8 67.9
123 Barcode 85 (forward) 61.5 60.0
124 Barcode 86 (forward) 64.3 65.4
125 Barcode 87 (forward) 66.7 65.4
126 Barcode 88 (forward) 63.3 60.7
127 Barcode 89 (forward) 69.2 66.7
128 Barcode 90 (forward) 66.7 64.0
129 Barcode 91 (forward) 68.0 64.3
130 Barcode 92 (forward) 65.5 68.0
131 Barcode 93 (forward) 69.2 73.1
132 Barcode 94 (forward) 63.0 68.0
133 Barcode 95 (forward) 64.0 63.3
134 Barcode 96 (forward) 69.0 68.0
135
136
137 Trimming adapters from read ends
138 SQK-NSK007_Y_Top: AATGTACTTCGTTCAGTTACGTATTGCT
139 SQK-NSK007_Y_Bottom: GCAATACGTAACTGAACGAAGT
140
141
142 0 / 9 (0.0%)
143 9 / 9 (100.0%)
144 9 / 9 (100.0%)
145
146 4 / 9 reads had adapters trimmed from their start (74 bp removed)
147 3 / 9 reads had adapters trimmed from their end (49 bp removed)
148
149
150 Splitting reads containing middle adapters
151
152 0 / 9 (0.0%)
153 9 / 9 (100.0%)
154 10 / 9 (111.1%)
155 9 / 9 (100.0%)
156
157 4 / 9 reads were split based on middle adapters
158
159
160 Saving trimmed reads to file
161
162 Saved result to /tmp/tmp4zxnky4h/job_working_directory/000/2/working/out.fasta
163