changeset 3:8eec79d04747 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/qiime/ commit a831282140ce160035a4ce984f48cc20198ed0a1
author iuc
date Thu, 22 Jun 2017 06:58:11 -0400
parents 3e627f047a3f
children f34064a0d89b
files generate_test_data.sh macros.xml test-data/assign_taxonomy/mothur_id_to_taxonomy.txt test-data/assign_taxonomy/mothur_repr_set_seqs.fasta test-data/assign_taxonomy/sortmerna_input_seqs.fasta test-data/assign_taxonomy/sortmerna_map.blast test-data/assign_taxonomy/sortmerna_taxonomic_assignation.txt test-data/assign_taxonomy/uclust_taxonomic_assignation.txt
diffstat 8 files changed, 56 insertions(+), 76 deletions(-) [+]
line wrap: on
line diff
--- a/generate_test_data.sh	Fri May 19 04:09:45 2017 -0400
+++ b/generate_test_data.sh	Thu Jun 22 06:58:11 2017 -0400
@@ -92,9 +92,32 @@
     --similarity '0.9' \
     --uclust_max_accepts '3' \
     -o assign_taxonomy_uclust
-cp assign_taxonomy_uclust/uclust_input_seqs_tax_assignments.txt 'test-data/assign_taxonomy/uclust_taxonomic_assignation.txt'
+ls assign_taxonomy_uclust
+md5sum 'assign_taxonomy_uclust/uclust_input_seqs_tax_assignments.txt'
 rm -rf assign_taxonomy_uclust
 
+assign_taxonomy.py \
+    --input_fasta_fp 'test-data/assign_taxonomy/mothur_repr_set_seqs.fasta' \
+    --id_to_taxonomy_fp 'test-data/assign_taxonomy/mothur_id_to_taxonomy.txt' \
+    --assignment_method 'mothur' \
+    --reference_seqs_fp 'test-data/assign_taxonomy/mothur_ref_seq_set.fna' \
+    --confidence '0.5' \
+    -o assign_taxonomy_mothur
+ls assign_taxonomy_mothur
+md5sum 'assign_taxonomy_mothur/mothur_repr_set_seqs_tax_assignments.txt'
+rm -rf assign_taxonomy_mothur
+
+assign_taxonomy.py \
+    --input_fasta_fp 'test-data/assign_taxonomy/mothur_repr_set_seqs.fasta' \
+    --id_to_taxonomy_fp 'test-data/assign_taxonomy/mothur_id_to_taxonomy.txt' \
+    --assignment_method 'mothur' \
+    --reference_seqs_fp 'test-data/assign_taxonomy/mothur_ref_seq_set.fna' \
+    --blast_e_value '0.001' \
+    -o assign_taxonomy_blast
+ls assign_taxonomy_blast
+md5sum 'assign_taxonomy_blast/mothur_repr_set_seqs_tax_assignments.txt'
+rm -rf assign_taxonomy_blast
+
 #assign_taxonomy.py \
 #    --input_fasta_fp 'test-data/assign_taxonomy/rdp_input_seqs.fasta' \
 #    --id_to_taxonomy_fp 'test-data/assign_taxonomy/rdp_id_to_taxonomy.txt' \
@@ -116,14 +139,6 @@
 #    -o assign_taxonomy_rtax
 #ls assign_taxonomy_rtax
 
-#assign_taxonomy.py \
-#    --input_fasta_fp 'test-data/assign_taxonomy/mothur_ref_seq_set.fna' \
-#    --id_to_taxonomy_fp 'test-data/assign_taxonomy/mothur_id_to_taxonomy.txt' \
-#    --assignment_method 'mothur' \
-#    --confidence 0.5  \
-#    -o assign_taxonomy_mothur
-#ls assign_taxonomy_mothur
-
 assign_taxonomy.py \
     --input_fasta_fp 'test-data/assign_taxonomy/mothur_ref_seq_set.fna' \
     --assignment_method 'sortmerna' \
@@ -133,8 +148,9 @@
     --sortmerna_coverage "0.9" \
     --sortmerna_best_N_alignments "5" \
     -o assign_taxonomy_sortmerna
-cp assign_taxonomy_sortmerna/sortmerna_map.blast 'test-data/assign_taxonomy/sortmerna_map.blast'
-cp assign_taxonomy_sortmerna/mothur_ref_seq_set_tax_assignments.txt 'test-data/assign_taxonomy/sortmerna_taxonomic_assignation.txt'
+ls assign_taxonomy_sortmerna
+md5sum 'assign_taxonomy_sortmerna/mothur_ref_seq_set_tax_assignments.txt'
+md5sum 'assign_taxonomy_sortmerna/sortmerna_map.blast'
 rm -rf assign_taxonomy_sortmerna
 
 #beta_diversity
@@ -1105,22 +1121,3 @@
 cp validate_mapping_file_output/*.log 'test-data/validate_mapping_file/map.tsv.log'
 cp validate_mapping_file_output/*corrected.txt 'test-data/validate_mapping_file/map.tsv_corrected.txt'
 rm -rf validate_mapping_file_output
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
--- a/macros.xml	Fri May 19 04:09:45 2017 -0400
+++ b/macros.xml	Thu Jun 22 06:58:11 2017 -0400
@@ -29,6 +29,22 @@
             </when>
         </conditional>
     </xml>
+    <xml name="assign_taxonomy_reference_source">
+        <conditional name="references">
+            <param name="source_selector" type="select" label="Select a reference sequence file from">
+                <option value="cached">The local cache</option>
+                <option value="history">The active history</option>
+            </param>
+            <when value="cached">
+                <param argument="--reference_seqs_fp" label="Reference sequences either used to generate a blast database (Blast) or used as training sequences for the selected classifier (RDP, Mothur)" type="select">
+                    <options from_data_table="qiime_rep_set"/>
+                </param>
+            </when>
+            <when value="history">
+                <param argument="--reference_seqs_fp" type="data" format="fasta" label="Reference sequences to search against"/>
+            </when>
+        </conditional>
+    </xml>
     <xml name="pick_otus_similarity">
         <param argument="--similarity" type="float" value="0.97" label="Sequence similarity threshold"/>
     </xml>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/assign_taxonomy/mothur_id_to_taxonomy.txt	Thu Jun 22 06:58:11 2017 -0400
@@ -0,0 +1,7 @@
+X67228	Bacteria;Proteobacteria;Alphaproteobacteria;Rhizobiales;Rhizobiaceae;Rhizobium
+X73443	Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiaceae;Clostridium
+AB004750	Bacteria;Proteobacteria;Gammaproteobacteria;Enterobacteriales;Enterobacteriaceae;Enterobacter
+xxxxxx	Bacteria;Proteobacteria;Gammaproteobacteria;Pseudomonadales;Pseudomonadaceae;Pseudomonas
+AB004748	Bacteria;Proteobacteria;Gammaproteobacteria;Enterobacteriales;Enterobacteriaceae;Enterobacter
+AB000278	Bacteria;Proteobacteria;Gammaproteobacteria;Vibrionales;Vibrionaceae;Photobacterium
+AB000390	Bacteria;Proteobacteria;Gammaproteobacteria;Vibrionales;Vibrionaceae;Vibrio
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/assign_taxonomy/mothur_repr_set_seqs.fasta	Thu Jun 22 06:58:11 2017 -0400
@@ -0,0 +1,4 @@
+>X67228 some description
+aacgaacgctggcggcaggcttaacacatgcaagtcgaacgctccgcaaggagagtggcagacgggtgagtaacgcgtgggaatctacccaaccctgcggaatagctctgggaaactggaattaataccgcatacgccctacgggggaaagatttatcggggatggatgagcccgcgttggattagctagttggtggggtaaaggcctaccaaggcgacgatccatagctggtctgagaggatgatcagccacattgggactgagacacggcccaaa
+>EF503697
+TAAAATGACTAGCCTGCGAGTCACGCCGTAAGGCGTGGCATACAGGCTCAGTAACACGTAGTCAACATGCCCAAAGGACGTGGATAACCTCGGGAAACTGAGGATAAACCGCGATAGGCCAAGGTTTCTGGAATGAGCTATGGCCGAAATCTATATGGCCTTTGGATTGGACTGCGGCCGATCAGGCTGTTGGTGAGGTAATGGCCCACCAAACCTGTAACCGGTACGGGCTTTGAGAGAAGTAGCCCGGAGATGGGCACTGAGACAAGGGCCCAGGCCCTATGGGGCGCAGCAGGCGCGAAACCTCTGCAATAGGCGAAAGCCTGACAGGGTTACTCTGAGTGATGCCCGCTAAGGGTATCTTTTGGCACCTCTAAAAATGGTGCAGAATAAGGGGTGGGCAAGTCTGGTGTCAGCCGCCGCGGTAATACCAGCACCCCGAGTTGTCGGGACGATTATTGGGCCTAAAGCATCCGTAGCCTGTTCTGCAAGTCCTCCGTTAAATCCACCTGCTCAACGGATGGGCTGCGGAGGATACCGCAGAGCTAGGAGGCGGGAGAGGCAAACGGTACTCAGTGGGTAGGGGTAAAATCCATTGATCTACTGAAGACCACCAGTGGCGAAGGCGGTTTGCCAGAACGCGCTCGACGGTGAGGGATGAAAGCTGGGGGAGCAAACCGGATTAGATACCCGGGGTAGTCCCAGCTGTAAACGGATGCAGACTCGGGTGATGGGGTTGGCTTCCGGCCCAACCCCAATTGCCCCCAGGCGAAGCCCGTTAAGATCTTGCCGCCCTGTCAGATGTCAGGGCCGCCAATACTCGAAACCTTAAAAGGAAATTGGGCGCGGGAAAAGTCACCAAAAGGGGGTTGAAACCCTGCGGGTTATATATTGTAAACC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/assign_taxonomy/sortmerna_input_seqs.fasta	Thu Jun 22 06:58:11 2017 -0400
@@ -0,0 +1,2 @@
+>X67228
+aacgaacgctggcggcaggcttaacacatgcaagtcgaacgctccgcaaggagagtggcagacgggtgagtaacgcgtgggaatctacccaaccctgcggaatagctctgggaaactggaattaataccgcatacgccctacgggggaaagatttatcggggatggatgagcccgcgttggattagctagttggtggggtaaaggcctaccaaggcgacgatccatagctggtctgagaggatgatcagccacattgggactgagacacggcccaaa
--- a/test-data/assign_taxonomy/sortmerna_map.blast	Fri May 19 04:09:45 2017 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,28 +0,0 @@
-X67228	152350	98.6	277	4	0	1	277	22	298	5.76e-129	464	277M	100	
-X67228	558499	97.1	275	8	0	1	275	2	276	1.05e-122	443	275M2S	99.3	
-X67228	553706	97.5	277	7	0	1	277	1	277	4.7e-125	451	277M	100	
-X67228	553981	95.7	277	12	0	1	277	2	278	1.55e-118	429	277M	100	
-X67228	4423084	98.6	277	4	0	1	277	21	297	5.76e-129	464	277M	100	
-X73443	179865	96.3	269	2	8	8	276	2	268	2.31e-114	415	7S3M1I28M1I3M1I7M1D8M1D20M1I26M1I115M1D54M	97.5	
-X73443	181718	96	269	3	8	8	276	2	268	4.66e-113	411	7S3M1I28M1I3M1I7M1D8M1D20M1I26M1I115M1D54M	97.5	
-X73443	193551	96.3	269	2	8	8	276	2	268	2.31e-114	415	7S3M1I28M1I3M1I7M1D8M1D21M1I26M1I114M1D54M	97.5	
-X73443	212341	96.3	269	2	8	8	276	2	268	2.31e-114	415	7S3M1I28M1I3M1I7M1D8M1D21M1I26M1I114M1D54M	97.5	
-X73443	175883	96	269	3	8	8	276	2	268	4.66e-113	411	7S3M1I28M1I3M1I7M1D8M1D21M1I26M1I114M1D54M	97.5	
-AB004750	3888577	100	339	0	0	1	339	26	364	1.61e-166	588	339M	100	
-AB004750	581782	97.6	339	8	0	1	339	27	365	4.36e-156	554	339M	100	
-AB004750	1108679	97.9	339	7	0	1	339	26	364	2.16e-157	558	339M	100	
-AB004750	1109844	97.9	339	7	0	1	339	26	364	2.16e-157	558	339M	100	
-AB004750	4418165	99.7	339	1	0	1	339	28	366	3.25e-165	584	339M	100	
-xxxxxx	1102995	97.5	361	8	1	1	361	22	383	2.94e-166	588	174M1D187M	100	
-xxxxxx	340031	95.6	361	13	3	1	361	23	386	1.07e-158	562	169M3D192M	100	
-xxxxxx	340031	95.6	361	13	3	1	361	23	386	1.07e-158	562	169M3D192M	100	
-AB004748	581782	98	396	8	0	1	396	27	422	8.13e-186	653	396M	100	
-AB004748	1108679	98.2	396	7	0	1	396	26	421	4.04e-187	657	396M	100	
-AB004748	1109844	98.2	396	7	0	1	396	26	421	4.04e-187	657	396M	100	
-AB004748	3888577	100	396	0	0	1	396	26	421	3.01e-196	687	396M	100	
-AB004748	561327	97.5	396	10	0	1	396	1	396	3.3e-183	644	396M	100	
-AB000278	554346	98.6	368	5	0	1	368	6	373	4e-175	617	368M	100	
-AB000278	160928	97	368	7	4	1	368	33	400	2.94e-166	588	33M1D5M1I8M1I2M1D318M	100	
-AB000390	4433053	98.1	317	6	0	1	317	13	329	3.2e-147	524	317M	100	
-AB000390	19456	94.4	317	14	4	1	317	12	328	4.28e-132	474	77M2D4M2I234M	100	
-AB000390	4432126	94.4	317	14	4	1	317	13	329	4.28e-132	474	77M2D4M2I234M	100	
--- a/test-data/assign_taxonomy/sortmerna_taxonomic_assignation.txt	Fri May 19 04:09:45 2017 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,8 +0,0 @@
-#OTU ID	taxonomy	confidence	num hits
-AB004750	k__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__; s__	0.60	5
-AB000390	k__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Vibrionales; f__Vibrionaceae	1.00	3
-xxxxxx	k__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Alteromonadales; f__Alteromonadaceae; g__Marinobacter; s__	1.00	3
-X67228	k__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__Rhizobiaceae	0.60	5
-AB000278	k__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Vibrionales; f__Vibrionaceae; g__Photobacterium	1.00	2
-AB004748	k__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__; s__	0.60	5
-X73443	k__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Lachnospiraceae	1.00	5
--- a/test-data/assign_taxonomy/uclust_taxonomic_assignation.txt	Fri May 19 04:09:45 2017 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,10 +0,0 @@
-11469739	k__Bacteria; p__OP9; c__JS1; o__SB-45; f__; g__; s__	1.00	3
-11480235	k__Bacteria; p__OD1; c__; o__; f__; g__; s__	1.00	1
-11460543	k__Bacteria; p__OP9; c__JS1; o__SB-45; f__; g__; s__	1.00	3
-11460523	k__Bacteria; p__Proteobacteria; c__Deltaproteobacteria; o__Desulfobacterales; f__Desulfobulbaceae; g__; s__	1.00	3
-11472286	k__Bacteria; p__WS5; c__; o__; f__; g__; s__	1.00	1
-11458037	k__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Peptococcaceae; g__Desulfosporosinus; s__meridiei	1.00	3
-11472384	k__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Burkholderiaceae; g__Burkholderia; s__	0.67	3
-11469752	k__Bacteria; p__TM7; c__TM7-1; o__; f__; g__; s__	1.00	3
-11480408	k__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__; g__; s__	1.00	3
-11468680	k__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Burkholderiaceae; g__Burkholderia; s__	1.00	3