Mercurial > repos > iuc > stacks_populations

comparison stacks_populations.xml @ 8:f5115df39480 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/stacks commit dc23703c260d004a28fe24a2a7c00cb4371bc32e
author iuc
date Thu, 27 Apr 2017 04:18:58 -0400
parents d0b325dfe508
children d504d945a655
comparison
equal deleted inserted replaced
7:5830a37dfa76 8:f5115df39480
10 10
11 mkdir stacks_outputs 11 mkdir stacks_outputs
12 12
13 && 13 &&
14 14
15 #if str($options_usage.input_type) == 'stacks': 15 #if str($options_usage.input_type) == 'stacks'
16 #for $input_file in $options_usage.input_col: 16 #for $input_file in $options_usage.input_col
17 #set $filename = str($input_file.element_identifier) 17 #set $filename = str($input_file.element_identifier)
18 #if not $filename.endswith('.tsv'): 18 #if not $filename.endswith('.tsv')
19 #set $filename = $filename + ".tsv" 19 #set $filename = $filename + ".tsv"
20 #end if 20 #end if
21 #if re.search('\.(tags|snps|alleles|matches)(\.tsv)?$', $filename): 21 #if re.search('\.(tags|snps|alleles|matches)(\.tsv)?$', $filename)
22 ln -s "${input_file}" "stacks_outputs/${filename}" && 22 ln -s '${input_file}' 'stacks_outputs/${filename}' &&
23 #end if 23 #end if
24 #end for 24 #end for
25 #else if str($options_usage.input_type) == 'vcf'
26 ln -s '$options_usage.input_vcf' 'stacks_outputs/batch_1.vcf' &&
25 #end if 27 #end if
26 28
27 populations 29 populations
28 30
29 -t \${GALAXY_SLOTS:-1} 31 -t \${GALAXY_SLOTS:-1}
30 32
31 #if str($options_usage.input_type) == 'vcf': 33 #if str($options_usage.input_type) == 'vcf'
32 -V "$options_usage.input_vcf" 34 -V 'stacks_outputs/batch_1.vcf'
33 #else: 35 -O stacks_outputs
36 #else
34 -P stacks_outputs 37 -P stacks_outputs
35 -b $advanced_options.batchid 38 -b $advanced_options.batchid
36 #end if 39 #end if
37 40
38 -M "$options_usage.popmap" 41 -M '$options_usage.popmap'
39 42
40 ## Data filtering 43 ## Data filtering
41 $options_filtering.write_single_snp 44 $options_filtering.write_single_snp
42 $options_filtering.write_random_snp 45 $options_filtering.write_random_snp
43 46
44 #if str($options_filtering.lnl): 47 #if str($options_filtering.lnl)
45 --lnl_lim $options_filtering.lnl 48 --lnl_lim $options_filtering.lnl
46 #end if 49 #end if
47 50
48 -r $options_filtering.minperc 51 -r $options_filtering.minperc
49 -p $options_filtering.minpop 52 -p $options_filtering.minpop
50 -m $options_filtering.mindepth 53 -m $options_filtering.mindepth
51 54
52 #if str($options_filtering.max_obs_het): 55 #if str($options_filtering.max_obs_het)
53 --max_obs_het $options_filtering.max_obs_het 56 --max_obs_het $options_filtering.max_obs_het
54 #end if 57 #end if
55 58
56 --min_maf $options_filtering.minminor 59 --min_maf $options_filtering.minminor
57 #if str( $options_filtering.correction_select.correction ) != "no_corr": 60 #if str( $options_filtering.correction_select.correction ) != "no_corr"
58 -f $options_filtering.correction_select.correction 61 -f $options_filtering.correction_select.correction
59 --p_value_cutoff $options_filtering.correction_select.pcutoff 62 --p_value_cutoff $options_filtering.correction_select.pcutoff
60 #end if 63 #end if
61 64
62 ## Fstats 65 ## Fstats
63 $fstats 66 $fstats
64 67
65 #if $options_kernel.kernel: 68 #if $options_kernel.kernel
66 -k 69 -k
67 --window_size $options_kernel.window 70 --window_size $options_kernel.window
68 #end if 71 #end if
69 72
70 ## Bootstrap resampling options 73 ## Bootstrap resampling options
71 #if $bootstrap_resampling.bootstrap_resampling_mode.bootstrap_all: 74 #if $bootstrap_resampling.bootstrap_resampling_mode.bootstrap_all
72 --bootstrap 75 --bootstrap
73 #else: 76 #else
74 $bootstrap_resampling.bootstrap_resampling_mode.bootstrap_pifis 77 $bootstrap_resampling.bootstrap_resampling_mode.bootstrap_pifis
75 $bootstrap_resampling.bootstrap_resampling_mode.bootstrap_fst 78 $bootstrap_resampling.bootstrap_resampling_mode.bootstrap_fst
76 $bootstrap_resampling.bootstrap_resampling_mode.bootstrap_div 79 $bootstrap_resampling.bootstrap_resampling_mode.bootstrap_div
77 $bootstrap_resampling.bootstrap_resampling_mode.bootstrap_phist 80 $bootstrap_resampling.bootstrap_resampling_mode.bootstrap_phist
78 #end if 81 #end if
79 82
80 #if str($bootstrap_resampling.bootstrap_reps): 83 #if str($bootstrap_resampling.bootstrap_reps)
81 --bootstrap_reps $bootstrap_resampling.bootstrap_reps 84 --bootstrap_reps $bootstrap_resampling.bootstrap_reps
82 #end if 85 #end if
83 #if $bootstrap_resampling.bootstrap_wl: 86 #if $bootstrap_resampling.bootstrap_wl
84 --bootstrap_wl "$bootstrap_resampling.bootstrap_wl" 87 --bootstrap_wl '$bootstrap_resampling.bootstrap_wl'
85 #end if 88 #end if
86 89
87 ## output section 90 ## output section
88 $populations_output.ordered_export 91 $populations_output.ordered_export
89 $populations_output.vcf 92 $populations_output.vcf
101 $populations_output.phylip 104 $populations_output.phylip
102 $populations_output.phylip_var 105 $populations_output.phylip_var
103 $populations_output.phylip_var_all 106 $populations_output.phylip_var_all
104 $populations_output.treemix 107 $populations_output.treemix
105 108
106 #if $populations_output.options_genomic.genomic: 109 #if $populations_output.options_genomic.genomic
107 --genomic 110 --genomic
108 -e $populations_output.options_genomic.enzyme 111 -e $populations_output.options_genomic.enzyme
109 #end if 112 #end if
110 113
111 ## output SQL file (as denovo/refmap) and fst/phi components 114 ## output SQL file (as denovo/refmap) and fst/phi components
112 -s 115 -s
113 --log_fst_comp 116 --log_fst_comp
114 117
115 ## Advanced options 118 ## Advanced options
116 #if $advanced_options.blacklist: 119 #if $advanced_options.blacklist
117 -B "$advanced_options.blacklist" 120 -B '$advanced_options.blacklist'
118 #end if 121 #end if
119 #if $advanced_options.whitelist: 122 #if $advanced_options.whitelist
120 -W "$advanced_options.whitelist" 123 -W '$advanced_options.whitelist'
121 #end if 124 #end if
125
126 &&
127
128 stacks_summary.py --stacks-prog populations --res-dir stacks_outputs --summary stacks_outputs/summary.html --pop-map '$options_usage.popmap'
122 ]]></command> 129 ]]></command>
123 130
124 <inputs> 131 <inputs>
125 <conditional name="options_usage"> 132 <conditional name="options_usage">
126 <param name="input_type" type="select" label="Input type" help="select input file type" > 133 <param name="input_type" type="select" label="Input type" help="select input file type" >
127 <option value="stacks">Stacks output</option> 134 <option value="stacks">Stacks output</option>
128 <!--option value="vcf">VCF file</option--> <!-- broken in 1.42 --> 135 <option value="vcf">VCF file</option>
129 </param> 136 </param>
130 <when value="stacks"> 137 <when value="stacks">
131 <param name="input_col" format="tabular,txt" type="data_collection" collection_type="list" label="Output from previous Stacks pipeline steps (e.g. denovo_map or refmap)" argument="-P" /> 138 <param name="input_col" format="tabular,txt" type="data_collection" collection_type="list" label="Output from previous Stacks pipeline steps (e.g. denovo_map or refmap)" argument="-P" />
132 <param name="popmap" type="data" format="tabular,txt" label="Specify a population map" argument="-M" /> 139 <param name="popmap" type="data" format="tabular,txt" label="Specify a population map" argument="-M" />
133 </when> 140 </when>
150 <option value="no_corr">No correction</option> 157 <option value="no_corr">No correction</option>
151 <option value="p_value">p_value</option> 158 <option value="p_value">p_value</option>
152 <option value="bonferroni_win">bonferroni_win</option> 159 <option value="bonferroni_win">bonferroni_win</option>
153 <option value="bonferroni_gen">bonferroni_gen</option> 160 <option value="bonferroni_gen">bonferroni_gen</option>
154 </param> 161 </param>
155 <when value="no_corr"></when> 162 <when value="no_corr"/>
156 <when value="p_value"> 163 <when value="p_value">
157 <param name="pcutoff" type="float" value="0.05" label="P-value cutoff" help="required p-value to keep an Fst measurement (0.05 by default). Also used as base for Bonferroni correction" /> 164 <param name="pcutoff" type="float" value="0.05" label="P-value cutoff" help="required p-value to keep an Fst measurement (0.05 by default). Also used as base for Bonferroni correction" />
158 </when> 165 </when>
159 <when value="bonferroni_win"> 166 <when value="bonferroni_win">
160 <param name="pcutoff" type="float" value="0.05" label="P-value cutoff" help="required p-value to keep an Fst measurement (0.05 by default). Also used as base for Bonferroni correction" /> 167 <param name="pcutoff" type="float" value="0.05" label="P-value cutoff" help="required p-value to keep an Fst measurement (0.05 by default). Also used as base for Bonferroni correction" />
236 <param name="batchid" type="integer" value="1" label="Batch ID to examine when exporting from the catalog" help="Only useful if you analyse data that was processed outside galaxy" /> 243 <param name="batchid" type="integer" value="1" label="Batch ID to examine when exporting from the catalog" help="Only useful if you analyse data that was processed outside galaxy" />
237 </section> 244 </section>
238 </inputs> 245 </inputs>
239 <outputs> 246 <outputs>
240 <expand macro="populations_output_full"/> 247 <expand macro="populations_output_full"/>
248
249 <data format="html" name="output_summary" label="Summary from ${tool.name} on ${on_string}" from_work_dir="stacks_outputs/summary.html" />
241 </outputs> 250 </outputs>
242 251
243 <tests> 252 <tests>
244 <test> 253 <test>
245 <param name="options_usage|input_type" value="stacks" /> 254 <param name="options_usage|input_type" value="stacks" />
277 <param name="populations_output|phylip" value="true" /> 286 <param name="populations_output|phylip" value="true" />
278 <param name="populations_output|phylip_var" value="true" /> 287 <param name="populations_output|phylip_var" value="true" />
279 <param name="populations_output|phylip_var_all" value="true" /> 288 <param name="populations_output|phylip_var_all" value="true" />
280 <param name="populations_output|treemix" value="true" /> 289 <param name="populations_output|treemix" value="true" />
281 290
282 <param name="populations_output|options_genomic|genomic" value="true" /> 291 <param name="populations_output|options_genomic|genomic" value="false" />
283 <param name="populations_output|options_genomic|enzyme" value="ecoRI" /> 292 <param name="populations_output|options_genomic|enzyme" value="ecoRI" />
293
294 <output name="output_summary">
295 <assert_contents>
296 <has_text text="Stacks Statistics" />
297 </assert_contents>
298 </output>
284 299
285 <!-- populations --> 300 <!-- populations -->
286 <output name="out_haplotypes"> 301 <output name="out_haplotypes">
287 <assert_contents> 302 <assert_contents>
288 <has_text text="PopA_01" /> 303 <has_text text="PopA_01" />
322 <assert_contents> 337 <assert_contents>
323 <has_text text="AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC" /> 338 <has_text text="AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC" />
324 </assert_contents> 339 </assert_contents>
325 </output> 340 </output>
326 </test> 341 </test>
327 <!--test> 342 <test>
328 <param name="options_usage|input_type" value="vcf" /> 343 <param name="options_usage|input_type" value="vcf" />
329 <param name="options_usage|input_vcf" value="populations/batch_1.vcf" /> 344 <param name="options_usage|input_vcf" value="populations/batch_1.vcf" />
330 <param name="options_usage|popmap" ftype="tabular" value="denovo_map/popmap.tsv" /> 345 <param name="options_usage|popmap" ftype="tabular" value="denovo_map/popmap.tsv" />
331 <param name="options_filtering|correction_select|correction" value="p_value" /> 346 <param name="options_filtering|correction_select|correction" value="p_value" />
332 347
346 <param name="populations_output|phylip" value="true" /> 361 <param name="populations_output|phylip" value="true" />
347 <param name="populations_output|phylip_var" value="true" /> 362 <param name="populations_output|phylip_var" value="true" />
348 <param name="populations_output|phylip_var_all" value="true" /> 363 <param name="populations_output|phylip_var_all" value="true" />
349 <param name="populations_output|treemix" value="true" /> 364 <param name="populations_output|treemix" value="true" />
350 365
351 <param name="populations_output|options_genomic|genomic" value="true" /> 366 <param name="populations_output|options_genomic|genomic" value="false" />
352 <param name="populations_output|options_genomic|enzyme" value="ecoRI" /--> 367
368 <output name="output_summary">
369 <assert_contents>
370 <has_text text="Stacks Statistics" />
371 </assert_contents>
372 </output>
353 373
354 <!-- populations --> 374 <!-- populations -->
355 <!--output name="out_haplotypes"> 375 <output name="out_haplotypes">
356 <assert_contents> 376 <assert_contents>
357 <has_text text="PopA_01" /> 377 <has_text text="PopA_01" />
358 </assert_contents> 378 </assert_contents>
359 </output> 379 </output>
360 <output name="out_hapstats"> 380 <output name="out_hapstats">
387 <has_text text="TreeMix v1.1;" /> 407 <has_text text="TreeMix v1.1;" />
388 </assert_contents> 408 </assert_contents>
389 </output> 409 </output>
390 <output name="out_fasta"> 410 <output name="out_fasta">
391 <assert_contents> 411 <assert_contents>
392 <has_text text="AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC" /> 412 <has_text text="CLocus_0_Sample_1_Locus_0_Allele_1" />
393 </assert_contents> 413 </assert_contents>
394 </output> 414 </output>
395 </test--> <!-- broken in 1.42 --> 415 </test>
396 </tests> 416 </tests>
397 <help> 417 <help>
398 <![CDATA[ 418 <![CDATA[
399 .. class:: infomark 419 .. class:: infomark
400 420