Mercurial > repos > iuc > stacks_populations
changeset 8:f5115df39480 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/stacks commit dc23703c260d004a28fe24a2a7c00cb4371bc32e
| author | iuc |
|---|---|
| date | Thu, 27 Apr 2017 04:18:58 -0400 |
| parents | 5830a37dfa76 |
| children | 45db1ba16163 |
| files | macros.xml stacks_populations.xml test-data/demultiplexed/PopA_01.1.fq.gzip test-data/denovo_map/popmap_cstacks.tsv test-data/procrad/R1.fq.gzip test-data/ustacks/ustacks.out |
| diffstat | 6 files changed, 111 insertions(+), 35 deletions(-) [+] |
line wrap: on
line diff
--- a/macros.xml Fri Apr 07 11:48:24 2017 -0400 +++ b/macros.xml Thu Apr 27 04:18:58 2017 -0400 @@ -2,14 +2,14 @@ <macros> <xml name="requirements"> <requirements> - <requirement type="package" version="1.42">stacks</requirement> + <requirement type="package" version="1.46">stacks</requirement> <requirement type="package" version="1.2.10">velvet</requirement> - <container type="docker">quay.io/biocontainers/stacks:1.42--2</container> + <requirement type="package" version="1.1">stacks_summary</requirement> <yield/> </requirements> </xml> - <token name="@WRAPPER_VERSION@">1.42</token> + <token name="@WRAPPER_VERSION@">1.46</token> <xml name="stdio"> <stdio> @@ -90,6 +90,7 @@ <option value="bsaHI">bsaHI</option> <option value="hpaII">hpaII</option> <option value="ncoI">ncoI</option> + <option value="ApaLI">ApaLI</option> </xml> <xml name="cross_types"> @@ -100,6 +101,19 @@ <option value="GEN">GEN (generic, unspecific to any map type)</option> </xml> + <token name="@CLEAN_EXT@"> + <![CDATA[ + #from os.path import splitext + #import re + #def clean_ext($identifier) + #while $identifier.endswith(('.1', '.fa', '.fq', '.fasta', '.fastq', '.gz', '.gzip', '.sam', '.bam')) + #set $identifier = splitext($identifier)[0] + #end while +$identifier#slurp + #end def + ]]> + </token> + <token name="@NORM_GENOTYPES_OUTPUT_LIGHT@"> <![CDATA[ ## We need to do this as the output file names contains the value of an option (min progeny)
--- a/stacks_populations.xml Fri Apr 07 11:48:24 2017 -0400 +++ b/stacks_populations.xml Thu Apr 27 04:18:58 2017 -0400 @@ -12,36 +12,39 @@ && - #if str($options_usage.input_type) == 'stacks': - #for $input_file in $options_usage.input_col: + #if str($options_usage.input_type) == 'stacks' + #for $input_file in $options_usage.input_col #set $filename = str($input_file.element_identifier) - #if not $filename.endswith('.tsv'): + #if not $filename.endswith('.tsv') #set $filename = $filename + ".tsv" #end if - #if re.search('\.(tags|snps|alleles|matches)(\.tsv)?$', $filename): - ln -s "${input_file}" "stacks_outputs/${filename}" && + #if re.search('\.(tags|snps|alleles|matches)(\.tsv)?$', $filename) + ln -s '${input_file}' 'stacks_outputs/${filename}' && #end if #end for + #else if str($options_usage.input_type) == 'vcf' + ln -s '$options_usage.input_vcf' 'stacks_outputs/batch_1.vcf' && #end if populations -t \${GALAXY_SLOTS:-1} - #if str($options_usage.input_type) == 'vcf': - -V "$options_usage.input_vcf" - #else: + #if str($options_usage.input_type) == 'vcf' + -V 'stacks_outputs/batch_1.vcf' + -O stacks_outputs + #else -P stacks_outputs -b $advanced_options.batchid #end if - -M "$options_usage.popmap" + -M '$options_usage.popmap' ## Data filtering $options_filtering.write_single_snp $options_filtering.write_random_snp - #if str($options_filtering.lnl): + #if str($options_filtering.lnl) --lnl_lim $options_filtering.lnl #end if @@ -49,12 +52,12 @@ -p $options_filtering.minpop -m $options_filtering.mindepth - #if str($options_filtering.max_obs_het): + #if str($options_filtering.max_obs_het) --max_obs_het $options_filtering.max_obs_het #end if --min_maf $options_filtering.minminor - #if str( $options_filtering.correction_select.correction ) != "no_corr": + #if str( $options_filtering.correction_select.correction ) != "no_corr" -f $options_filtering.correction_select.correction --p_value_cutoff $options_filtering.correction_select.pcutoff #end if @@ -62,26 +65,26 @@ ## Fstats $fstats - #if $options_kernel.kernel: + #if $options_kernel.kernel -k --window_size $options_kernel.window #end if ## Bootstrap resampling options - #if $bootstrap_resampling.bootstrap_resampling_mode.bootstrap_all: + #if $bootstrap_resampling.bootstrap_resampling_mode.bootstrap_all --bootstrap - #else: + #else $bootstrap_resampling.bootstrap_resampling_mode.bootstrap_pifis $bootstrap_resampling.bootstrap_resampling_mode.bootstrap_fst $bootstrap_resampling.bootstrap_resampling_mode.bootstrap_div $bootstrap_resampling.bootstrap_resampling_mode.bootstrap_phist #end if - #if str($bootstrap_resampling.bootstrap_reps): + #if str($bootstrap_resampling.bootstrap_reps) --bootstrap_reps $bootstrap_resampling.bootstrap_reps #end if - #if $bootstrap_resampling.bootstrap_wl: - --bootstrap_wl "$bootstrap_resampling.bootstrap_wl" + #if $bootstrap_resampling.bootstrap_wl + --bootstrap_wl '$bootstrap_resampling.bootstrap_wl' #end if ## output section @@ -103,7 +106,7 @@ $populations_output.phylip_var_all $populations_output.treemix - #if $populations_output.options_genomic.genomic: + #if $populations_output.options_genomic.genomic --genomic -e $populations_output.options_genomic.enzyme #end if @@ -113,19 +116,23 @@ --log_fst_comp ## Advanced options - #if $advanced_options.blacklist: - -B "$advanced_options.blacklist" + #if $advanced_options.blacklist + -B '$advanced_options.blacklist' #end if - #if $advanced_options.whitelist: - -W "$advanced_options.whitelist" + #if $advanced_options.whitelist + -W '$advanced_options.whitelist' #end if + + && + + stacks_summary.py --stacks-prog populations --res-dir stacks_outputs --summary stacks_outputs/summary.html --pop-map '$options_usage.popmap' ]]></command> <inputs> <conditional name="options_usage"> <param name="input_type" type="select" label="Input type" help="select input file type" > <option value="stacks">Stacks output</option> - <!--option value="vcf">VCF file</option--> <!-- broken in 1.42 --> + <option value="vcf">VCF file</option> </param> <when value="stacks"> <param name="input_col" format="tabular,txt" type="data_collection" collection_type="list" label="Output from previous Stacks pipeline steps (e.g. denovo_map or refmap)" argument="-P" /> @@ -152,7 +159,7 @@ <option value="bonferroni_win">bonferroni_win</option> <option value="bonferroni_gen">bonferroni_gen</option> </param> - <when value="no_corr"></when> + <when value="no_corr"/> <when value="p_value"> <param name="pcutoff" type="float" value="0.05" label="P-value cutoff" help="required p-value to keep an Fst measurement (0.05 by default). Also used as base for Bonferroni correction" /> </when> @@ -238,6 +245,8 @@ </inputs> <outputs> <expand macro="populations_output_full"/> + + <data format="html" name="output_summary" label="Summary from ${tool.name} on ${on_string}" from_work_dir="stacks_outputs/summary.html" /> </outputs> <tests> @@ -279,9 +288,15 @@ <param name="populations_output|phylip_var_all" value="true" /> <param name="populations_output|treemix" value="true" /> - <param name="populations_output|options_genomic|genomic" value="true" /> + <param name="populations_output|options_genomic|genomic" value="false" /> <param name="populations_output|options_genomic|enzyme" value="ecoRI" /> + <output name="output_summary"> + <assert_contents> + <has_text text="Stacks Statistics" /> + </assert_contents> + </output> + <!-- populations --> <output name="out_haplotypes"> <assert_contents> @@ -324,7 +339,7 @@ </assert_contents> </output> </test> - <!--test> + <test> <param name="options_usage|input_type" value="vcf" /> <param name="options_usage|input_vcf" value="populations/batch_1.vcf" /> <param name="options_usage|popmap" ftype="tabular" value="denovo_map/popmap.tsv" /> @@ -348,11 +363,16 @@ <param name="populations_output|phylip_var_all" value="true" /> <param name="populations_output|treemix" value="true" /> - <param name="populations_output|options_genomic|genomic" value="true" /> - <param name="populations_output|options_genomic|enzyme" value="ecoRI" /--> + <param name="populations_output|options_genomic|genomic" value="false" /> + + <output name="output_summary"> + <assert_contents> + <has_text text="Stacks Statistics" /> + </assert_contents> + </output> <!-- populations --> - <!--output name="out_haplotypes"> + <output name="out_haplotypes"> <assert_contents> <has_text text="PopA_01" /> </assert_contents> @@ -389,10 +409,10 @@ </output> <output name="out_fasta"> <assert_contents> - <has_text text="AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC" /> + <has_text text="CLocus_0_Sample_1_Locus_0_Allele_1" /> </assert_contents> </output> - </test--> <!-- broken in 1.42 --> + </test> </tests> <help> <![CDATA[
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/denovo_map/popmap_cstacks.tsv Thu Apr 27 04:18:58 2017 -0400 @@ -0,0 +1,1 @@ +PopA_01 myPopA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/ustacks/ustacks.out Thu Apr 27 04:18:58 2017 -0400 @@ -0,0 +1,41 @@ +ustacks parameters selected: + Sample ID: 1 + Min depth of coverage to create a stack: 2 + Max distance allowed between stacks: 2 + Max distance allowed to align secondary reads: 4 + Max number of stacks allowed per de novo locus: 3 + Deleveraging algorithm: disabled + Removal algorithm: enabled + Model type: SNP + Alpha significance level for model: 0.05 + Gapped alignments: disabled +Parsing stacks_inputs/PopA_01.fq +Loading RAD-Tags...done +Loaded 66 RAD-Tags. + Inserted 7 elements into the RAD-Tags hash map. + 0 reads contained uncalled nucleotides that were modified. +4 initial stacks were populated; 3 stacks were set aside as secondary reads. +Initial coverage mean: 15.75; Std Dev: 7.46241; Max: 27 +Deleveraging trigger: 23; Removal trigger: 31 +Calculating distance for removing repetitive stacks. + Distance allowed between stacks: 1; searching with a k-mer length of 47 (48 k-mers per read); 1 k-mer hits required. +Removing repetitive stacks. + Removed 0 stacks. + 4 stacks remain for merging. +Post-Repeat Removal, coverage depth Mean: 15.75; Std Dev: 7.46241; Max: 27 +Calculating distance between stacks... + Distance allowed between stacks: 2; searching with a k-mer length of 31 (64 k-mers per read); 2 k-mer hits required. +Merging stacks, maximum allowed distance: 2 nucleotide(s) + 4 stacks merged into 3 loci; deleveraged 0 loci; blacklisted 0 loci. +After merging, coverage depth Mean: 21; Std Dev: 4.24264; Max: 27 +Merging remainder radtags + 3 remainder sequences left to merge. + Distance allowed between stacks: 4; searching with a k-mer length of 17 (78 k-mers per read); 10 k-mer hits required. + Matched 3 remainder reads; unable to match 0 remainder reads. +After remainders merged, coverage depth Mean: 22; Std Dev: 4.32049; Max: 28 +Calling final consensus sequences, invoking SNP-calling model... +Number of utilized reads: 66 +Writing loci, SNPs, and alleles to 'stacks_outputs/'... + Refetching sequencing IDs from stacks_inputs/PopA_01.fq... read 66 sequence IDs. +done. +ustacks is done.