Mercurial > repos > iuc > unicycler

diff unicycler.xml @ 8:9e3e80cc4ad4 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/unicycler commit d7f4eb848136b02ae1cf121a5cfb2e6175d35406"
author iuc
date Wed, 18 Nov 2020 20:26:04 +0000
parents 88c240872a65
children 6e26c9afd301
line wrap: on
line diff
--- a/unicycler.xml	Tue Oct 08 02:47:44 2019 -0400
+++ b/unicycler.xml	Wed Nov 18 20:26:04 2020 +0000
@@ -1,4 +1,4 @@
-<tool id="unicycler" name="Create assemblies with Unicycler" version="@VERSION@.0">
+<tool id="unicycler" name="Create assemblies with Unicycler" version="@VERSION@.0" profile="20.09">
     <macros>
         <token name="@VERSION@">0.4.8</token>
     </macros>
@@ -204,7 +204,7 @@
         </section>
     </inputs>
     <outputs>
-        <data name="assembly_graph" format="tabular" from_work_dir="assembly.gfa" label="${tool.name} on ${on_string}: Final Assembly Graph" />
+        <data name="assembly_graph" format="gfa1" from_work_dir="assembly.gfa" label="${tool.name} on ${on_string}: Final Assembly Graph" />
         <data name="assembly" format="fasta" from_work_dir="assembly.fasta" label="${tool.name} on ${on_string}: Final Assembly"/>
     </outputs>
     <tests>
@@ -240,9 +240,9 @@
             <section name="lr_align">
                 <param name="scores" value="3,-6,-5,-2"/>
             </section>
-            <output name="assembly_graph" ftype="tabular">
+            <output name="assembly_graph" ftype="gfa1">
                 <assert_contents>
-                    <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC"/>
+                    <has_line_matching expression="S\t1\t[ATCG]{5386,5386}\tLN:i:5386\tdp:f:1.0"/>
                 </assert_contents>
             </output>
             <output name="assembly" ftype="fasta">
@@ -295,9 +295,9 @@
             <section name="lr_align">
                 <param name="scores" value="3,-6,-5,-2"/>
             </section>
-            <output name="assembly_graph" ftype="tabular">
+            <output name="assembly_graph" ftype="gfa1">
                 <assert_contents>
-                    <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC" />
+                    <has_line_matching expression="S\t1\t[ATCG]{5386,5386}\tLN:i:5386\tdp:f:1.0"/>
                 </assert_contents>
             </output>
             <output name="assembly" ftype="fasta">
@@ -342,9 +342,9 @@
             <section name="lr_align">
                 <param name="scores" value="3,-6,-5,-2"/>
             </section>
-            <output name="assembly_graph" ftype="tabular">
+            <output name="assembly_graph" ftype="gfa1">
                 <assert_contents>
-                    <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC" />
+                    <has_line_matching expression="S\t1\t[ATCG]{5386,5386}\tLN:i:5386\tdp:f:1.0"/>
                 </assert_contents>
             </output>
             <output name="assembly" ftype="fasta">
@@ -362,7 +362,7 @@
                 <param name="kmers" value="21,23"/>
             </section>
             <param name="long" value="only_long.fasta" ftype="fasta" />
-            <output name="assembly_graph" ftype="tabular">
+            <output name="assembly_graph" ftype="gfa1">
                 <assert_contents>
                     <has_text text="S" />
                 </assert_contents>