Mercurial > repos > jackcurragh > ribogalaxy_samtools_sort_genome
changeset 0:76a4f74f3c09 draft
Uploaded
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/samtools_sort_genome/macros.xml Wed Mar 23 12:47:57 2022 +0000 @@ -0,0 +1,223 @@ +<macros> + <xml name="requirements"> + <requirements> + <requirement type="package" version="@TOOL_VERSION@">samtools</requirement> + <yield/> + </requirements> + </xml> + <token name="@TOOL_VERSION@">1.13</token> + <token name="@PROFILE@">20.05</token> + <token name="@FLAGS@"><![CDATA[ + #set $flags = 0 + #if $filter + #set $flags = sum(map(int, str($filter).split(','))) + #end if + ]]></token> + <token name="@PREPARE_IDX@"><![CDATA[ + ##prepare input and indices + ln -s '$input' infile && + #if $input.is_of_type('bam'): + #if str( $input.metadata.bam_index ) != "None": + ln -s '${input.metadata.bam_index}' infile.bai && + #else: + samtools index infile infile.bai && + #end if + #elif $input.is_of_type('cram'): + #if str( $input.metadata.cram_index ) != "None": + ln -s '${input.metadata.cram_index}' infile.crai && + #else: + samtools index infile infile.crai && + #end if + #end if + ]]></token> + <token name="@PREPARE_IDX_MULTIPLE@"><![CDATA[ + ##prepare input and indices + #for $i, $bam in enumerate( $input_bams ): + ln -s '$bam' '${i}' && + #if $bam.is_of_type('bam'): + #if str( $bam.metadata.bam_index ) != "None": + ln -s '${bam.metadata.bam_index}' '${i}.bai' && + #else: + samtools index '${i}' '${i}.bai' && + #end if + #elif $bam.is_of_type('cram'): + #if str( $bam.metadata.cram_index ) != "None": + ln -s '${bam.metadata.cram_index}' '${i}.crai' && + #else: + samtools index '${i}' '${i}.crai' && + #end if + #end if + #end for + ]]></token> + <token name="@PREPARE_FASTA_IDX@"><![CDATA[ + ##checks for reference data ($addref_cond.addref_select=="history" or =="cached") + ##and sets the -t/-T parameters accordingly: + ##- in case of history a symbolic link is used because samtools (view) will generate + ## the index which might not be possible in the directory containing the fasta file + ##- in case of cached the absolute path is used which allows to read the cram file + ## without specifying the reference + #if $addref_cond.addref_select == "history": + ln -s '${addref_cond.ref}' reference.fa && + samtools faidx reference.fa && + #set reffa="reference.fa" + #set reffai="reference.fa.fai" + #elif $addref_cond.addref_select == "cached": + #set reffa=str($addref_cond.ref.fields.path) + #set reffai=str($addref_cond.ref.fields.path)+".fai" + #else + #set reffa=None + #set reffai=None + #end if + ]]></token> + + <xml name="optional_reference"> + <conditional name="addref_cond"> + <param name="addref_select" type="select" label="Use a reference sequence"> + <help>@HELP@</help> + <option value="no">No</option> + <option value="history">Use a genome/index from the history</option> + <option value="cached">Use a built-in genome</option> + </param> + <when value="no"/> + <when value="history"> + <param name="ref" argument="@ARGUMENT@" type="data" format="fasta,fasta.gz" label="Reference"/> + </when> + <when value="cached"> + <param name="ref" argument="@ARGUMENT@" type="select" label="Reference"> + <options from_data_table="fasta_indexes"> + <filter type="data_meta" ref="input" key="dbkey" column="dbkey"/> + </options> + <validator type="no_options" message="No reference genome is available for the build associated with the selected input dataset"/> + </param> + </when> + </conditional> + </xml> + <xml name="mandatory_reference" token_help="" token_argument=""> + <conditional name="addref_cond"> + <param name="addref_select" type="select" label="Use a reference sequence"> + <help>@HELP@</help> + <option value="history">Use a genome/index from the history</option> + <option value="cached">Use a built-in genome</option> + </param> + <when value="history"> + <param name="ref" argument="@ARGUMENT@" type="data" format="fasta,fasta.gz" label="Reference"/> + </when> + <when value="cached"> + <param name="ref" argument="@ARGUMENT@" type="select" label="Reference"> + <options from_data_table="fasta_indexes"> + <filter type="data_meta" ref="input" key="dbkey" column="dbkey"/> + <validator message="No reference genome is available for the build associated with the selected input dataset" type="no_options" /> + </options> + </param> + </when> + </conditional> + </xml> + + + <token name="@ADDTHREADS@"><![CDATA[ + ##compute the number of ADDITIONAL threads to be used by samtools (-@) + addthreads=\${GALAXY_SLOTS:-1} && (( addthreads-- )) && + ]]></token> + <token name="@ADDMEMORY@"><![CDATA[ + ##compute the number of memory available to samtools sort (-m) + ##use only 75% of available: https://github.com/samtools/samtools/issues/831 + addmemory=\${GALAXY_MEMORY_MB_PER_SLOT:-768} && + ((addmemory=addmemory*75/100)) && + ]]></token> + <xml name="seed_input"> + <param name="seed" type="integer" optional="True" label="Seed for random number generator" help="If empty a random seed is used." /> + </xml> + <xml name="flag_options" token_s1="false" token_s2="false" token_s4="false" token_s8="false" token_s16="false" token_s32="false" token_s64="false" token_s128="false" token_s256="false" token_s512="false" token_s1024="false" token_s2048="false"> + <option value="1" selected="@S1@">Read is paired</option> + <option value="2" selected="@S2@">Read is mapped in a proper pair</option> + <option value="4" selected="@S4@">Read is unmapped</option> + <option value="8" selected="@S8@">Mate is unmapped</option> + <option value="16" selected="@S16@">Read is mapped to the reverse strand of the reference</option> + <option value="32" selected="@S32@">Mate is mapped to the reverse strand of the reference</option> + <option value="64" selected="@S64@">Read is the first in a pair</option> + <option value="128" selected="@S128@">Read is the second in a pair</option> + <option value="256" selected="@S256@">Alignment of the read is not primary</option> + <option value="512" selected="@S512@">Read fails platform/vendor quality checks</option> + <option value="1024" selected="@S1024@">Read is a PCR or optical duplicate</option> + <option value="2048" selected="@S2048@">Alignment is supplementary</option> + </xml> + + <!-- region specification macros and tokens for tools that allow the specification + of region by bed file / space separated list of regions --> + <token name="@REGIONS_FILE@"><![CDATA[ + #if $cond_region.select_region == 'tab': + -t '$cond_region.targetregions' + #end if + ]]></token> + <token name="@REGIONS_MANUAL@"><![CDATA[ + #if $cond_region.select_region == 'text': + #for $i, $x in enumerate($cond_region.regions_repeat): + '${x.region}' + #end for + #end if + ]]></token> + <xml name="regions_macro"> + <conditional name="cond_region"> + <param name="select_region" type="select" label="Filter by regions" help="restricts output to only those alignments which overlap the specified region(s)"> + <option value="no" selected="True">No</option> + <option value="text">Manualy specify regions</option> + <option value="tab">Regions from tabular file</option> + </param> + <when value="no"/> + <when value="text"> + <repeat name="regions_repeat" min="1" default="1" title="Regions"> + <param name="region" type="text" label="region" help="format chr:from-to"> + <validator type="regex" message="Required format: CHR[:FROM[-TO]]; where CHR: string containing any character except quotes, whitespace and colon; FROM and TO: any integer">^[^\s'\":]+(:\d+(-\d+){0,1}){0,1}$</validator> + </param> + </repeat> + </when> + <when value="tab"> + <param name="targetregions" argument="-t/--target-regions" type="data" format="tabular" label="Target regions file" help="Do stats in these regions only. Tab-delimited file chr,from,to (1-based, inclusive)" /> + </when> + </conditional> + </xml> + + <xml name="citations"> + <citations> + <citation type="bibtex"> + @misc{SAM_def, + title={Definition of SAM/BAM format}, + url = {https://samtools.github.io/hts-specs/},} + </citation> + <citation type="doi">10.1093/bioinformatics/btp352</citation> + <citation type="doi">10.1093/bioinformatics/btr076</citation> + <citation type="doi">10.1093/bioinformatics/btr509</citation> + <citation type="bibtex"> + @misc{Danecek_et_al, + Author={Danecek, P., Schiffels, S., Durbin, R.}, + title={Multiallelic calling model in bcftools (-m)}, + url = {http://samtools.github.io/bcftools/call-m.pdf},} + </citation> + <citation type="bibtex"> + @misc{Durbin_VCQC, + Author={Durbin, R.}, + title={Segregation based metric for variant call QC}, + url = {http://samtools.github.io/bcftools/rd-SegBias.pdf},} + </citation> + <citation type="bibtex"> + @misc{Li_SamMath, + Author={Li, H.}, + title={Mathematical Notes on SAMtools Algorithms}, + url = {http://www.broadinstitute.org/gatk/media/docs/Samtools.pdf},} + </citation> + <citation type="bibtex"> + @misc{SamTools_github, + title={SAMTools GitHub page}, + url = {https://github.com/samtools/samtools},} + </citation> + </citations> + </xml> + <xml name="version_command"> + <version_command><![CDATA[samtools 2>&1 | grep Version]]></version_command> + </xml> + <xml name="stdio"> + <stdio> + <exit_code range="1:" level="fatal" description="Error" /> + </stdio> + </xml> +</macros>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/samtools_sort_genome/samtools_sort.xml Wed Mar 23 12:47:57 2022 +0000 @@ -0,0 +1,173 @@ +<tool id="samtools_sort" name="Samtools sort" version="2.0.4" profile="@PROFILE@"> + <description>order of storing aligned sequences</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <expand macro="stdio"/> + <expand macro="version_command"/> + <command><![CDATA[ + @ADDTHREADS@ + @ADDMEMORY@ + samtools sort + -@ \$addthreads + -m \$addmemory"M" + ###if str(compression): + ## -l '$compression' + ###end if + $prim_key_cond.prim_key_select + #if $prim_key_cond.prim_key_select == '-t': + $prim_key_cond.tag + $prim_key_cond.sec_key_select + #end if + $minhash + -O bam + -T "\${TMPDIR:-.}" + '${input1}' + > '${output1}' + ]]></command> + <inputs> + <param name="input1" type="data" format="sam,unsorted.bam,cram" label="BAM File" /> + <conditional name="prim_key_cond"> + <param name="prim_key_select" type="select" label="Primary sort key"> + <option value="" selected="True">coordinate</option> + <option value="-n">name (-n)</option> + <option value="-t">tag (-t)</option> + </param> + <when value=""/> + <when value="-n"/> + <when value="-t"> + <param name="tag" type="text" optional="false" argument="-t" label="Alignment tag"/> + <param name="sec_key_select" type="select" label="Secondary sort key"> + <option value="">coordinate</option> + <option value="-n">name (-n)</option> + </param> + </when> + </conditional> + <param name="minhash" type="boolean" argument="-M" truevalue="-M" falsevalue="" checked="false" label="Minhash collation" help="Use minimiser for clustering unaligned/unplaced reads."/> + <!--<param name="compression" type="integer" argument="-l" optional="True" min="0" max="9" label="compression level" help="0 (uncompressed) to 9 (best)"/>--> + </inputs> + <outputs> + <data name="output1" format="bam"> + <change_format> + <when input="prim_key_cond.prim_key_select" value="" format="bam" /> + <when input="prim_key_cond.prim_key_select" value="-n" format="qname_sorted.bam" /> + <when input="prim_key_cond.prim_key_select" value="-t" format="unsorted.bam" /> + </change_format> + </data> + </outputs> + <tests> + <!-- tests from https://github.com/samtools/samtools/blob/9ce8c64493f7ea3fa69bc5c1ac980b1a8e3dcf1f/test/test.pl#L2464 --> + <!-- 1) # Pos sort --> + <test> + <param name="input1" value="test_input_1_a.bam" ftype="bam" /> + <output name="output1" file="pos.sort.expected.bam" ftype="bam" lines_diff="4" /> + </test> + <!-- test_cmd($opts, out=>"sort/pos.sort.expected.sam", cmd=>"$$opts{bin}/samtools sort${threads} $$opts{path}/dat/test_input_1_a.bam -O SAM -o -"); --> + <!-- 2) # Name sort --> + <test> + <param name="input1" value="test_input_1_a.bam" ftype="bam" /> + <conditional name="prim_key_cond"> + <param name="prim_key_select" value="-n"/> + </conditional> + <output name="output1" file="name.sort.expected.bam" ftype="qname_sorted.bam" lines_diff="4"/> + </test> + <!-- test_cmd($opts, out=>"sort/name.sort.expected.sam", cmd=>"$$opts{bin}/samtools sort${threads} -n $$opts{path}/dat/test_input_1_a.bam -O SAM -o -");--> + <!-- 3) # Tag sort (RG) (considers output and name sorted) --> + <test> + <param name="input1" value="test_input_1_a.bam" ftype="bam" /> + <conditional name="prim_key_cond"> + <param name="prim_key_select" value="-t"/> + <param name="tag" value="RG"/> + </conditional> + <output name="output1" file="tag.rg.sort.expected.bam" ftype="unsorted.bam" lines_diff="4"/> + </test> + <!--test_cmd($opts, out=>"sort/tag.rg.sort.expected.sam", cmd=>"$$opts{bin}/samtools sort${threads} -t RG $$opts{path}/dat/test_input_1_a.bam -O SAM -o -");--> + <!-- 4) # Tag sort (RG); secondary by name --> + <test> + <param name="input1" value="test_input_1_a.bam" ftype="bam" /> + <conditional name="prim_key_cond"> + <param name="prim_key_select" value="-t"/> + <param name="tag" value="RG"/> + <param name="sec_key_select" value="-n"/> + </conditional> + <output name="output1" file="tag.rg.n.sort.expected.bam" ftype="unsorted.bam" lines_diff="4"/> + </test> + <!--test_cmd($opts, out=>"sort/tag.rg.n.sort.expected.sam", cmd=>"$$opts{bin}/samtools sort${threads} -n -t RG $$opts{path}/dat/test_input_1_a.bam -O SAM -o -");--> + <!-- 5) # Tag sort (AS) --> + <test> + <param name="input1" value="test_input_1_a.bam" ftype="bam" /> + <conditional name="prim_key_cond"> + <param name="prim_key_select" value="-t"/> + <param name="tag" value="AS"/> + <param name="sec_key_select" value=""/> + </conditional> + <output name="output1" file="tag.as.sort.expected.bam" ftype="unsorted.bam" lines_diff="4"/> + </test> + <!--test_cmd($opts, out=>"sort/tag.as.sort.expected.sam", cmd=>"$$opts{bin}/samtools sort${threads} -t AS $$opts{path}/dat/test_input_1_d.sam -O SAM -o -");--> + <!-- 6) # Tag sort (FI) --> + <test> + <param name="input1" value="test_input_1_a.bam" ftype="bam" /> + <conditional name="prim_key_cond"> + <param name="prim_key_select" value="-t"/> + <param name="tag" value="FI"/> + </conditional> + <output name="output1" file="tag.fi.sort.expected.bam" ftype="unsorted.bam" lines_diff="4"/> + </test> + <!--test_cmd($opts, out=>"sort/tag.fi.sort.expected.sam", cmd=>"$$opts{bin}/samtools sort${threads} -t FI $$opts{path}/dat/test_input_1_d.sam -O SAM -o -");--> + <!-- 7) tests from old version --> + <test> + <param name="input1" value="1.bam" ftype="bam" /> + <output name="output1" file="1_sort.bam" ftype="bam" sort="True" lines_diff="4"/> + </test> + <test> + <param name="input1" value="1.bam" ftype="bam" /> + <conditional name="prim_key_cond"> + <param name="prim_key_select" value="-n"/> + </conditional> + <output name="output1" file="1_sort_read_names.bam" ftype="qname_sorted.bam" lines_diff="4"/> + </test> + <!-- 8) test minhash sorting --> + <test> + <param name="input1" value="test_input_1_a.bam" ftype="bam" /> + <param name="minhash" value="true" /> + <output name="output1" file="minhash.expected.bam" ftype="bam" lines_diff="4" /> + </test> + </tests> + <help> +**What it does** + +Sort alignments by leftmost coordinates, or by read name when -n is used. +An appropriate @HD-SO sort order header tag will be added or an existing +one updated if necessary. + +**Ordering Rules** + +The following rules are used for ordering records. + +If option -t is in use, records are first sorted by the value of the given +alignment tag, and then by position or name (if using -n). For example, “-t RG” +will make read group the primary sort key. The rules for ordering by tag are: + +- Records that do not have the tag are sorted before ones that do. +- If the types of the tags are different, they will be sorted so that single + character tags (type A) come before array tags (type B), then string tags + (types H and Z), then numeric tags (types f and i). +- Numeric tags (types f and i) are compared by value. Note that comparisons of + floating-point values are subject to issues of rounding and precision. +- String tags (types H and Z) are compared based on the binary contents of the + tag using the C strcmp(3) function. +- Character tags (type A) are compared by binary character value. +- No attempt is made to compare tags of other types — notably type B array values will not be compared. + +When the -n option is present, records are sorted by name. Names are compared so as to give a “natural” ordering — i.e. sections consisting of digits are compared numerically while all other sections are compared based on their binary representation. This means “a1” will come before “b1” and “a9” will come before “a10”. Records with the same name will be ordered according to the values of the READ1 and READ2 flags (see flags). + +When the -n option is not present, reads are sorted by reference (according to the order of the @SQ header records), then by position in the reference, and then by the REVERSE flag. + +This has now been removed. The previous out.prefix argument (and -f option, if any) should be changed to an appropriate combination of -T PREFIX and -o FILE. The previous -o option should be removed, as output defaults to standard output. + +When the -M (minash collation) option is present, then samtools sort groups unmapped reads with similar sequence together. This can sometimes significantly reduce the file size. + + </help> + <expand macro="citations"/> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/samtools_sort_genome/test-data/name.sort.expected.sam Wed Mar 23 12:47:57 2022 +0000 @@ -0,0 +1,28 @@ +@HD VN:1.4 SO:queryname +@SQ SN:insert LN:599 +@SQ SN:ref1 LN:45 +@SQ SN:ref2 LN:40 +@SQ SN:ref3 LN:4 +@RG ID:fish PG:donkey +@RG ID:cow PU:13_&^&&*(:332 +@RG PU:*9u8jkjjkjd: ID:colt +@PG ID:bull PP:donkey +@PG ID:donkey +@PG ID:moose +@PG PP:moose ID:cow +@CO +r000 99 insert 50 30 10M = 80 30 ATTTAGCTAC AAAAAAAAAA RG:Z:cow PG:Z:bull +r000 211 insert 80 30 10M = 50 -30 CCCAATCATT AAAAAAAAAA RG:Z:cow PG:Z:bull +r001 83 ref1 37 30 9M = 7 -39 CAGCGCCAT * RG:Z:fish PG:Z:colt +r001 163 ref1 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 YY:i:100 RG:Z:fish PG:Z:colt +r002 0 ref1 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * XA:Z:abc XB:i:-10 PG:Z:colt +r003 0 ref1 9 30 5H6M * 0 0 AGCTAA * RG:Z:cow +r003 16 ref1 29 30 6H5M * 0 0 TAGGC * RG:Z:cow PG:Z:colt +r004 0 ref1 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * RG:Z:colt PG:Z:colt +u1 4 * 0 30 23M * 0 0 TAATTAAGTCTACAGAAAAAAAA ??????????????????????? +x1 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA * RG:Z:colt PG:Z:bull +x2 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ????????????????????? RG:Z:colt PG:Z:bull +x3 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ?????????????????????????? RG:Z:fish PG:Z:bull +x4 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ????????????????????????? RG:Z:fish PG:Z:bull +x5 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ???????????????????????? RG:Z:fish PG:Z:bull +x6 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ??????????????????????? RG:Z:cow
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/samtools_sort_genome/test-data/pos.sort.expected.sam Wed Mar 23 12:47:57 2022 +0000 @@ -0,0 +1,28 @@ +@HD VN:1.4 SO:coordinate +@SQ SN:insert LN:599 +@SQ SN:ref1 LN:45 +@SQ SN:ref2 LN:40 +@SQ SN:ref3 LN:4 +@RG ID:fish PG:donkey +@RG ID:cow PU:13_&^&&*(:332 +@RG PU:*9u8jkjjkjd: ID:colt +@PG ID:bull PP:donkey +@PG ID:donkey +@PG ID:moose +@PG PP:moose ID:cow +@CO +r000 99 insert 50 30 10M = 80 30 ATTTAGCTAC AAAAAAAAAA RG:Z:cow PG:Z:bull +r000 211 insert 80 30 10M = 50 -30 CCCAATCATT AAAAAAAAAA RG:Z:cow PG:Z:bull +r001 163 ref1 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 YY:i:100 RG:Z:fish PG:Z:colt +r002 0 ref1 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * XA:Z:abc XB:i:-10 PG:Z:colt +r003 0 ref1 9 30 5H6M * 0 0 AGCTAA * RG:Z:cow +r004 0 ref1 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * RG:Z:colt PG:Z:colt +r003 16 ref1 29 30 6H5M * 0 0 TAGGC * RG:Z:cow PG:Z:colt +r001 83 ref1 37 30 9M = 7 -39 CAGCGCCAT * RG:Z:fish PG:Z:colt +x1 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA * RG:Z:colt PG:Z:bull +x2 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ????????????????????? RG:Z:colt PG:Z:bull +x3 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ?????????????????????????? RG:Z:fish PG:Z:bull +x4 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ????????????????????????? RG:Z:fish PG:Z:bull +x5 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ???????????????????????? RG:Z:fish PG:Z:bull +x6 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ??????????????????????? RG:Z:cow +u1 4 * 0 30 23M * 0 0 TAATTAAGTCTACAGAAAAAAAA ???????????????????????
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/samtools_sort_genome/test-data/tag.as.sort.expected.sam Wed Mar 23 12:47:57 2022 +0000 @@ -0,0 +1,24 @@ +@HD VN:1.4 SO:unknown +@SQ SN:insert LN:599 +@SQ SN:ref1 LN:45 +@SQ SN:ref2 LN:40 +@SQ SN:ref3 LN:4 +@PG ID:llama +@RG ID:fish PG:llama +@RG ID:cow PU:13_&^&&*(:332 PG:donkey +@RG PU:*9u8jkjjkjd: ID:colt +@PG ID:bull PP:donkey +@PG ID:donkey +@CO Do you know? +r006 16 ref1 29 30 6H5M * 0 0 TAGGC * RG:Z:colt PG:Z:donkey FI:i:3 +x11 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ???????????????????????? RG:Z:cow PG:Z:bull FI:Z:a +r007 0 ref1 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * RG:Z:colt PG:Z:donkey AS:i:-5 FI:f:3.5 +x10 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ????????????????????????? RG:Z:cow PG:Z:bull AS:i:0 FI:A:b +r007 0 ref1 9 30 5H6M * 0 0 AGCTAA * RG:Z:colt PG:Z:donkey AS:i:1 FI:i:4 +r005 163 ref1 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 YY:i:100 RG:Z:colt PG:Z:donkey AS:i:10 FI:i:5 +x8 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ????????????????????? RG:Z:cow PG:Z:bull AS:i:10 FI:f:1.5 +r006 0 ref1 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * XA:Z:abc XB:i:-10 RG:Z:colt PG:Z:donkey AS:i:20 FI:f:4.5 +x9 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ?????????????????????????? RG:Z:cow PG:Z:bull AS:i:20 FI:i:1 +x7 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA * RG:Z:cow PG:Z:bull AS:i:50 FI:i:2 +r005 83 ref1 37 30 9M = 7 -39 CAGCGCCAT * RG:Z:colt PG:Z:donkey AS:i:100 FI:f:2.5 +x12 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ??????????????????????? RG:Z:cow PG:Z:bull AS:i:65100
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/samtools_sort_genome/test-data/tag.fi.sort.expected.sam Wed Mar 23 12:47:57 2022 +0000 @@ -0,0 +1,24 @@ +@HD VN:1.4 SO:unknown +@SQ SN:insert LN:599 +@SQ SN:ref1 LN:45 +@SQ SN:ref2 LN:40 +@SQ SN:ref3 LN:4 +@PG ID:llama +@RG ID:fish PG:llama +@RG ID:cow PU:13_&^&&*(:332 PG:donkey +@RG PU:*9u8jkjjkjd: ID:colt +@PG ID:bull PP:donkey +@PG ID:donkey +@CO Do you know? +x12 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ??????????????????????? RG:Z:cow PG:Z:bull AS:i:65100 +x10 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ????????????????????????? RG:Z:cow PG:Z:bull AS:i:0 FI:A:b +x11 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ???????????????????????? RG:Z:cow PG:Z:bull FI:Z:a +x9 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ?????????????????????????? RG:Z:cow PG:Z:bull AS:i:20 FI:i:1 +x8 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ????????????????????? RG:Z:cow PG:Z:bull AS:i:10 FI:f:1.5 +x7 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA * RG:Z:cow PG:Z:bull AS:i:50 FI:i:2 +r005 83 ref1 37 30 9M = 7 -39 CAGCGCCAT * RG:Z:colt PG:Z:donkey AS:i:100 FI:f:2.5 +r006 16 ref1 29 30 6H5M * 0 0 TAGGC * RG:Z:colt PG:Z:donkey FI:i:3 +r007 0 ref1 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * RG:Z:colt PG:Z:donkey AS:i:-5 FI:f:3.5 +r007 0 ref1 9 30 5H6M * 0 0 AGCTAA * RG:Z:colt PG:Z:donkey AS:i:1 FI:i:4 +r006 0 ref1 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * XA:Z:abc XB:i:-10 RG:Z:colt PG:Z:donkey AS:i:20 FI:f:4.5 +r005 163 ref1 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 YY:i:100 RG:Z:colt PG:Z:donkey AS:i:10 FI:i:5
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/samtools_sort_genome/test-data/tag.rg.n.sort.expected.sam Wed Mar 23 12:47:57 2022 +0000 @@ -0,0 +1,28 @@ +@HD VN:1.4 SO:unknown +@SQ SN:insert LN:599 +@SQ SN:ref1 LN:45 +@SQ SN:ref2 LN:40 +@SQ SN:ref3 LN:4 +@RG ID:fish PG:donkey +@RG ID:cow PU:13_&^&&*(:332 +@RG PU:*9u8jkjjkjd: ID:colt +@PG ID:bull PP:donkey +@PG ID:donkey +@PG ID:moose +@PG PP:moose ID:cow +@CO +r002 0 ref1 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * XA:Z:abc XB:i:-10 PG:Z:colt +u1 4 * 0 30 23M * 0 0 TAATTAAGTCTACAGAAAAAAAA ??????????????????????? +r004 0 ref1 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * RG:Z:colt PG:Z:colt +x1 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA * RG:Z:colt PG:Z:bull +x2 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ????????????????????? RG:Z:colt PG:Z:bull +r000 99 insert 50 30 10M = 80 30 ATTTAGCTAC AAAAAAAAAA RG:Z:cow PG:Z:bull +r000 211 insert 80 30 10M = 50 -30 CCCAATCATT AAAAAAAAAA RG:Z:cow PG:Z:bull +r003 0 ref1 9 30 5H6M * 0 0 AGCTAA * RG:Z:cow +r003 16 ref1 29 30 6H5M * 0 0 TAGGC * RG:Z:cow PG:Z:colt +x6 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ??????????????????????? RG:Z:cow +r001 83 ref1 37 30 9M = 7 -39 CAGCGCCAT * RG:Z:fish PG:Z:colt +r001 163 ref1 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 YY:i:100 RG:Z:fish PG:Z:colt +x3 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ?????????????????????????? RG:Z:fish PG:Z:bull +x4 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ????????????????????????? RG:Z:fish PG:Z:bull +x5 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ???????????????????????? RG:Z:fish PG:Z:bull
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/samtools_sort_genome/test-data/tag.rg.sort.expected.sam Wed Mar 23 12:47:57 2022 +0000 @@ -0,0 +1,28 @@ +@HD VN:1.4 SO:unknown +@SQ SN:insert LN:599 +@SQ SN:ref1 LN:45 +@SQ SN:ref2 LN:40 +@SQ SN:ref3 LN:4 +@RG ID:fish PG:donkey +@RG ID:cow PU:13_&^&&*(:332 +@RG PU:*9u8jkjjkjd: ID:colt +@PG ID:bull PP:donkey +@PG ID:donkey +@PG ID:moose +@PG PP:moose ID:cow +@CO +r002 0 ref1 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * XA:Z:abc XB:i:-10 PG:Z:colt +u1 4 * 0 30 23M * 0 0 TAATTAAGTCTACAGAAAAAAAA ??????????????????????? +r004 0 ref1 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * RG:Z:colt PG:Z:colt +x1 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA * RG:Z:colt PG:Z:bull +x2 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ????????????????????? RG:Z:colt PG:Z:bull +r000 99 insert 50 30 10M = 80 30 ATTTAGCTAC AAAAAAAAAA RG:Z:cow PG:Z:bull +r000 211 insert 80 30 10M = 50 -30 CCCAATCATT AAAAAAAAAA RG:Z:cow PG:Z:bull +r003 0 ref1 9 30 5H6M * 0 0 AGCTAA * RG:Z:cow +r003 16 ref1 29 30 6H5M * 0 0 TAGGC * RG:Z:cow PG:Z:colt +x6 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ??????????????????????? RG:Z:cow +r001 163 ref1 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 YY:i:100 RG:Z:fish PG:Z:colt +r001 83 ref1 37 30 9M = 7 -39 CAGCGCCAT * RG:Z:fish PG:Z:colt +x3 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ?????????????????????????? RG:Z:fish PG:Z:bull +x4 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ????????????????????????? RG:Z:fish PG:Z:bull +x5 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ???????????????????????? RG:Z:fish PG:Z:bull