Mercurial > repos > jankanis > blast2html
annotate test-data/blast xml example4.html @ 79:9fb1a7d67317 py2.6
remove unneeded encoding parameter
| author | Jan Kanis <jan.code@jankanis.nl> |
|---|---|
| date | Thu, 19 Jun 2014 16:43:22 +0200 |
| parents | 05500bdd7376 |
| children | 8b3c5d334a84 |
| rev | line source |
|---|---|
| 32 | 1 <!DOCTYPE html> |
| 2 <html> | |
| 3 <head> | |
| 4 <meta charset="UTF-8"> | |
|
33
3bb5da68305e
add test update script, add url to github page
Jan Kanis <jan.code@jankanis.nl>
parents:
32
diff
changeset
|
5 <meta name=generator content="blast2html; see https://github.com/thehyve/blast2html/"> |
| 32 | 6 |
| 7 <title>Blast output</title> | |
| 8 | |
| 9 <style> | |
| 10 body { | |
| 11 color: #333333; | |
| 12 font-family: Arial,Sans-Serif; | |
| 13 } | |
| 14 | |
| 15 :link { | |
| 16 color: #336699; | |
| 17 } | |
| 18 | |
| 19 .right { | |
| 20 float: right; | |
| 21 } | |
| 22 | |
| 23 /* Galaxy with html sanitization enabled strips the header of this html page. If so, show the user a warning.*/ | |
| 24 #strip_html_warning { | |
| 25 display: none; | |
| 26 } | |
| 27 | |
| 28 #content { | |
| 29 margin: 0 2em; | |
| 30 padding: 0.5em; | |
| 31 border: 1px solid #888888; | |
| 32 background-color: #d3dff5; | |
| 33 } | |
| 34 | |
| 35 h1, h2, h3, h4, h5, h6 { | |
| 36 color: #2A6979; | |
| 37 font-family: arial,verdana,sans-serif; | |
| 38 letter-spacing: -1px; | |
| 39 margin: 1.2em 0 0.3em; | |
| 40 } | |
| 41 | |
| 42 h1 { | |
| 43 border-bottom: 1px solid #CCCCCC; | |
| 44 font-size: 150%; | |
| 45 padding-bottom: 0.1em; | |
| 46 } | |
| 47 | |
| 48 h2 { | |
| 49 font-size: 120%; | |
| 50 font-weight: bold; | |
| 51 } | |
| 52 | |
| 53 h4.darkHeader { | |
| 54 color: #4D4D4D; | |
| 55 letter-spacing: 0; | |
| 56 font-weight: bold; | |
| 57 } | |
| 58 | |
| 59 #nodata { | |
| 60 font-weight: bold; | |
| 61 } | |
| 62 | |
| 63 .index { | |
| 64 margin-bottom: 3em; | |
| 65 } | |
| 66 .index div.indexentry { | |
| 67 margin: 1.2em 1.6em; | |
| 68 font-weight: bold; | |
| 69 font-size: 100%; | |
| 70 } | |
| 71 | |
| 72 .headerdata { | |
| 73 font-size: 90%; | |
| 74 } | |
| 75 .headerdata .param { | |
| 76 font-weight: bold; | |
| 77 text-align: right; | |
| 78 padding: 0 1em; | |
| 79 } | |
| 80 | |
| 81 .grey { | |
| 82 background-color: #eeeeee; | |
| 83 border: 1px solid #cccccc; | |
| 84 padding: 1em; | |
| 85 } | |
| 86 | |
| 87 .white { | |
| 88 background-color: white; | |
| 89 border: 1px solid #cccccc; | |
| 90 padding: 1.5em 2%; | |
| 91 } | |
| 92 | |
| 93 .graphicrow { | |
| 94 clear: left; | |
| 95 width: 100%; | |
| 96 } | |
| 97 | |
| 98 .graphicitem { | |
| 99 float: left; | |
| 100 } | |
| 101 | |
| 102 | |
| 103 | |
| 104 .graphics .grey { | |
| 105 text-align: center; | |
| 106 } | |
| 107 | |
| 108 .graphic { | |
| 109 background-color: white; | |
| 110 border: 2px solid black; | |
| 111 padding: 1.5em; | |
| 112 margin: auto; | |
| 113 } | |
| 114 | |
| 115 .centered, .defline, div.legend, div.tablewrapper { | |
| 116 margin-left: auto; | |
| 117 margin-right: auto; | |
| 118 } | |
| 119 | |
| 120 .defline { | |
| 121 background-color: white; | |
| 122 border: 1px solid black; | |
| 123 margin: .5em auto; | |
| 124 padding-left: .2em; | |
| 125 padding-right: .2em; | |
| 126 max-width: 50em; | |
| 127 text-align: left; | |
| 128 height: 2.8em; | |
| 59 | 129 overflow: hidden; |
| 32 | 130 } |
| 131 | |
| 132 div.legend { | |
| 133 max-width: 40em; | |
| 134 } | |
| 135 div.legend div { | |
| 136 width: 100%; | |
| 137 color: white; | |
| 138 font-weight: bold; | |
| 139 border-spacing: 0; | |
| 140 } | |
| 141 div.legend div .graphicitem { | |
| 142 width: 20%; | |
| 143 padding: 0; | |
| 144 margin: 0; | |
| 145 border: none; | |
| 146 } | |
| 147 | |
| 148 div.tablewrapper { | |
| 149 width: 50%; | |
| 150 min-width: 60em; | |
| 151 } | |
| 152 | |
| 153 /* For small widths we give the graphic 100% */ | |
| 154 @media (max-width: 72.5em) { | |
| 155 div.tablewrapper { | |
| 156 width: 100%; | |
| 157 min-width: 0px; | |
| 158 } | |
| 159 } | |
| 160 | |
| 161 .scale { | |
| 162 width: 100%; | |
| 163 margin: .5em 0; | |
| 164 font-weight: bold; | |
| 165 } | |
| 166 .scale div { | |
| 167 color: red; | |
| 168 text-align: left; | |
| 169 } | |
| 170 .scale .graphicrow { | |
| 171 margin: .5em 0 .5em 0; | |
| 172 color: white; | |
| 173 } | |
| 174 .scale .graphicitem { | |
| 175 position: relative; | |
| 176 } | |
| 177 .scale .graphicitem div { | |
| 178 margin: 0 1px; | |
| 179 padding: 0 2px; | |
| 180 text-align: right; | |
| 181 background-color: red; | |
| 182 color: white; | |
| 183 } | |
| 184 .scale .graphicitem:first-child div { | |
| 185 margin-left: 0px; | |
| 186 } | |
| 187 .scale .graphicitem:last-child div { | |
| 188 margin-right: 0px; | |
| 189 } | |
| 190 .scale .graphicitem .lastlabel { | |
| 191 position: absolute; | |
| 192 top: 0px; | |
| 193 left: 100%; | |
| 194 background-color: transparent; | |
| 195 color: red; | |
| 196 } | |
| 197 | |
| 198 a.matchresult { | |
| 199 display: block; | |
| 200 margin: 0; | |
| 201 padding: 0; | |
| 202 } | |
| 203 div.matchrow { | |
| 204 margin-top: 4px; | |
| 205 } | |
| 206 div.matchrow, div.matchitem { | |
| 207 height: 4px; | |
| 208 } | |
| 209 | |
| 210 | |
| 211 table.descriptiontable { | |
| 212 font-size: 85%; | |
| 213 border: 1px solid #97b0c8; | |
| 214 border-spacing: 0; | |
| 215 color: #222222; | |
| 216 line-height: 1.3em; | |
| 217 background-color: white; | |
| 218 } | |
| 219 table.descriptiontable col:first-child { | |
| 220 width: 100%; | |
| 221 } | |
| 222 table.descriptiontable tr:hover { | |
| 223 background-color: #D5DEE3; | |
| 224 } | |
| 225 table.descriptiontable th { | |
| 226 color: #14376C; | |
| 227 font-weight: normal; | |
| 228 background-color: #F0F0F0; | |
| 229 background: linear-gradient(#FFFFFF, #F0F0F0); | |
| 230 border-bottom: 1px solid #D4DFE9; | |
| 231 border-right: 1px solid #CFCFCF; | |
| 232 border-left: 0px solid black; | |
| 233 border-top: 0px solid black; | |
| 234 } | |
| 235 table.descriptiontable td { | |
| 236 overflow: hidden; | |
| 237 text-align: center; | |
| 238 padding: .4em .8em; | |
| 239 } | |
| 240 table.descriptiontable td div { | |
| 241 width: 1em; | |
| 242 overflow: visible; | |
| 243 white-space: nowrap; | |
| 244 text-align: left; | |
| 245 } | |
| 246 | |
| 247 | |
| 248 | |
| 249 .alignments .white { | |
| 250 padding: 1.5em 1em; | |
| 251 } | |
| 252 | |
| 253 .alignment { | |
| 254 border-top: 1px solid black; | |
| 255 padding-left: 1em; | |
| 256 padding-right: 1em; | |
| 257 } | |
| 258 | |
| 259 div.linkheader { | |
| 260 padding-top: .2em; | |
| 261 font-size: 85%; | |
| 262 color: #14376C; | |
| 263 } | |
| 264 div.linkheader a.linkheader { | |
| 265 margin-right: 1em; | |
| 266 } | |
| 267 div.linkheader .right a { | |
| 268 text-decoration: none; | |
| 269 } | |
| 270 | |
| 271 .title .hittitle { | |
| 272 color: #222222; | |
| 273 margin-bottom: .3em; | |
| 274 } | |
| 275 .title .titleinfo { | |
| 276 font-size: 80%; | |
| 277 margin-top: 0; | |
| 278 margin-bottom: .3em; | |
| 279 } | |
| 280 .title .titleinfo .b { | |
| 281 color: #606060; | |
| 282 font-weight: bold; | |
| 283 font-size: 90%; | |
| 284 } | |
| 285 | |
| 286 .moretitles { | |
| 287 margin: 1.2em; | |
| 288 } | |
| 289 .moretitles .titleinfo { | |
| 290 margin: 0; | |
| 291 padding: 0; | |
| 292 } | |
| 293 .moretitles .hittitle { | |
| 294 margin: .4em 0 .2em 0; | |
| 295 padding: 0; | |
| 296 } | |
| 297 | |
| 298 a.showmoretitles { | |
| 299 font-size: 75%; | |
| 300 color: #336699; | |
| 301 font-weight: bold; | |
| 302 margin-top: 0; | |
| 303 } | |
| 304 a.showmoretitles:hover { | |
| 305 } | |
| 306 | |
| 307 .hotspot { | |
| 308 color: #606060; | |
| 309 font-family: verdana, arial, sans-serif; | |
| 310 margin-bottom: 2.5em; | |
| 311 } | |
| 312 | |
| 313 .hotspot p.range { | |
| 314 font-size: 70%; | |
| 315 margin-top: 0; | |
| 316 margin-top: 1em; | |
| 317 margin-bottom: .2em; | |
| 318 } | |
| 319 .hotspot p.range span.range { | |
| 320 font-weight: bold; | |
| 321 } | |
| 322 .hotspot p.range a.range { | |
| 323 margin-left: .5em; | |
| 324 } | |
| 325 | |
| 326 table.hotspotstable { | |
| 327 border-top: 1px solid; | |
| 328 border-bottom: 1px solid; | |
| 329 text-align: left; | |
| 330 border-collapse: collapse; | |
| 331 } | |
| 332 table.hotspotstable th, table.hotspotstable td { | |
| 333 padding: .1em 1em; | |
| 334 } | |
| 335 table.hotspotstable th { | |
| 336 font-size: 70%; | |
| 337 } | |
| 338 table.hotspotstable td { | |
| 339 min-width: 7em; | |
| 340 color: #222222; | |
| 341 font-size: 80%; | |
| 342 } | |
| 343 | |
| 344 pre.alignmentgraphic { | |
| 345 color: #222222; | |
| 346 } | |
| 347 | |
| 348 footer { | |
| 349 text-align: center; | |
| 350 color: #cccccc; | |
| 351 font-size: 70%; | |
| 352 margin-top: 1em; | |
| 353 } | |
| 354 footer :link { | |
| 355 color: #5588cc; | |
| 356 } | |
| 357 | |
| 358 </style> | |
| 359 | |
| 360 <script type="text/javascript"> | |
| 361 function toggle_visibility(id) { | |
| 362 var e = document.getElementById(id); | |
| 363 if(e.style.display != 'block') | |
| 364 e.style.display = 'block'; | |
| 365 else | |
| 366 e.style.display = 'none'; | |
| 367 } | |
| 368 </script> | |
| 369 | |
| 370 </head> | |
| 371 | |
| 372 | |
| 373 <body> | |
| 374 | |
| 375 <div id="strip_html_warning"> | |
| 376 <!-- This div should be hidden by the header css block. Galaxy | |
| 377 strips all css, breaking this page but making this warning | |
| 378 visible. This warning contains some ugly old skool tabular html | |
| 379 layout that is not stripped. --> | |
| 380 <table bgcolor="#FFE5C9"><tr><td><font color="red"><b> | |
| 381 <font size=5><center>This html page seems to have been stripped by Galaxy.</center></font> | |
| 382 Disable Galaxy's html sanitization feature to view the full page (see <font face=monospace>sanitize_all_html</font> in your galaxy's universe_wsgi.ini), or download this page instead of viewing it in Galaxy. | |
| 383 </b></font></td></tr></table> | |
| 384 </div> | |
| 385 | |
| 386 <div id=content> | |
| 387 | |
| 388 | |
| 389 <section class=index> | |
| 390 <h1>Queries</h1> | |
| 391 | |
| 392 <div class=indexentry><a href="#match1"> | |
| 393 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 394 (20 letters, 2 hits) | |
| 395 </a></div> | |
| 396 <div class=indexentry><a href="#match2"> | |
| 397 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 398 (20 letters, 0 hits) | |
| 399 </a></div> | |
| 400 <div class=indexentry><a href="#match3"> | |
| 401 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 402 (20 letters, 3 hits) | |
| 403 </a></div> | |
| 404 <div class=indexentry><a href="#match4"> | |
| 405 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 406 (24 letters, 0 hits) | |
| 407 </a></div> | |
| 408 <div class=indexentry><a href="#match5"> | |
| 409 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 410 (20 letters, 0 hits) | |
| 411 </a></div> | |
| 412 <div class=indexentry><a href="#match6"> | |
| 413 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 414 (25 letters, 2 hits) | |
| 415 </a></div> | |
| 416 <div class=indexentry><a href="#match7"> | |
| 417 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 418 (74 letters, 2 hits) | |
| 419 </a></div> | |
| 420 | |
| 421 </section> | |
| 422 | |
| 423 | |
| 424 <section class=match id=match1> | |
| 425 | |
| 426 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 427 | |
| 428 <section class=header> | |
| 429 | |
| 430 <table class=headerdata> | |
| 431 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 432 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 433 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 434 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 435 <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr> | |
| 436 </table> | |
| 437 | |
| 438 </section> | |
| 439 | |
| 440 | |
| 441 <section class=graphics> | |
| 442 <h2>Graphic Summary</h2> | |
| 443 | |
| 444 <div class=grey> | |
| 445 <h3 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h3> | |
| 446 | |
| 447 <div class=defline id=defline1> | |
| 448 Mouse-over to show defline and scores, click to show alignments | |
| 449 </div> | |
| 450 | |
| 451 <div class=graphic> | |
| 452 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 453 <div class=legend><div class=graphicrow> | |
| 454 <div class=graphicitem style="background-color: black"><40</div> | |
| 455 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 456 <div class=graphicitem style="background-color: green">50–80</div> | |
| 457 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 458 <div class=graphicitem style="background-color: red">200≤</div> | |
| 459 </div></div> | |
| 460 <div style="clear: left"></div> | |
| 461 | |
| 462 <div class=tablewrapper> | |
| 463 | |
| 464 <div class=scale> | |
| 465 <div>query:</div> | |
| 466 <div class=graphicrow> | |
| 467 <div> | |
| 77 | 468 <div class=graphicitem style="width: 10%"> |
| 32 | 469 <div>2</div> |
| 470 </div> | |
| 77 | 471 <div class=graphicitem style="width: 10%"> |
| 32 | 472 <div>4</div> |
| 473 </div> | |
| 77 | 474 <div class=graphicitem style="width: 10%"> |
| 32 | 475 <div>6</div> |
| 476 </div> | |
| 77 | 477 <div class=graphicitem style="width: 10%"> |
| 32 | 478 <div>8</div> |
| 479 </div> | |
| 77 | 480 <div class=graphicitem style="width: 10%"> |
| 32 | 481 <div>10</div> |
| 482 </div> | |
| 77 | 483 <div class=graphicitem style="width: 10%"> |
| 32 | 484 <div>12</div> |
| 485 </div> | |
| 77 | 486 <div class=graphicitem style="width: 10%"> |
| 32 | 487 <div>14</div> |
| 488 </div> | |
| 77 | 489 <div class=graphicitem style="width: 10%"> |
| 32 | 490 <div>16</div> |
| 491 </div> | |
| 77 | 492 <div class=graphicitem style="width: 10%"> |
| 32 | 493 <div>18</div> |
| 494 </div> | |
| 77 | 495 <div class=graphicitem style="width: 10%"> |
| 32 | 496 <div>20</div> |
| 497 </div> | |
| 498 </div> | |
| 499 </div> | |
| 500 <div style="clear: left"></div> | |
| 501 </div> | |
| 502 | |
| 503 <a class=matchresult | |
| 59 | 504 href="#hit1-1" |
| 32 | 505 onmouseover='document.getElementById("defline1").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' |
| 506 onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 507 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> | |
| 508 <div class="matchrow graphicrow"> | |
| 509 <div class="matchitem graphicitem" | |
| 77 | 510 style="background-color: black; width: 100%"></div> |
| 32 | 511 </div> |
| 512 </a> | |
| 513 | |
| 514 <a class=matchresult | |
| 59 | 515 href="#hit1-2" |
| 32 | 516 onmouseover='document.getElementById("defline1").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' |
| 517 onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 518 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> | |
| 519 <div class="matchrow graphicrow"> | |
| 520 <div class="matchitem graphicitem" | |
| 77 | 521 style="background-color: black; width: 100%"></div> |
| 32 | 522 </div> |
| 523 </a> | |
| 524 | |
| 525 </div> | |
| 526 </div> | |
| 527 </div> | |
| 528 </section> | |
| 529 | |
| 530 | |
| 531 | |
| 532 <section class=descriptions> | |
| 533 <h2>Descriptions</h2> | |
| 534 | |
| 535 <div class=grey><div class=white> | |
| 536 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 537 | |
| 538 <table class=descriptiontable> | |
| 539 <col/><col/><col/><col/><col/><col/><col/> | |
| 540 <tr> | |
| 541 <th>Description</th> | |
| 542 <th>Max score</th> | |
| 543 <th>Total score</th> | |
| 544 <th>Query cover</th> | |
| 545 <th>E value</th> | |
| 546 <th>Ident</th> | |
| 547 <th>Accession</th> | |
| 548 </tr> | |
| 549 <tr> | |
| 59 | 550 <td><div><a href="#hit1-1" |
| 32 | 551 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" |
| 59 | 552 id="description1-1"> |
| 32 | 553 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 |
| 554 </a></div></td> | |
| 555 <td>40.1</td> | |
| 556 <td>40.1</td> | |
| 557 <td>100%</td> | |
| 558 <td>1.513e-07</td> | |
| 559 <td>100%</td> | |
| 560 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">5</a></td> | |
| 561 </tr> | |
| 562 <tr> | |
| 59 | 563 <td><div><a href="#hit1-2" |
| 32 | 564 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" |
| 59 | 565 id="description1-2"> |
| 32 | 566 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 |
| 567 </a></div></td> | |
| 568 <td>40.1</td> | |
| 569 <td>40.1</td> | |
| 570 <td>100%</td> | |
| 571 <td>1.513e-07</td> | |
| 572 <td>100%</td> | |
| 573 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">2</a></td> | |
| 574 </tr> | |
| 575 </table> | |
| 576 | |
| 577 </div></div> | |
| 578 </section> | |
| 579 | |
| 580 | |
| 581 | |
| 582 <section class=alignments> | |
| 583 <h2>Alignments</h2> | |
| 584 | |
| 585 <div class=grey><div class=white> | |
| 59 | 586 <div class=alignment id=hit1-1> |
| 32 | 587 |
| 588 <div class=linkheader> | |
| 59 | 589 <div class=right><a href="#description1-1">Descriptions</a></div> |
| 32 | 590 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
| 591 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | |
| 592 </div> | |
| 593 | |
| 594 <div class=title> | |
| 595 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> | |
| 596 <p class=titleinfo> | |
| 597 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">5</a> | |
| 598 <span class=b>Length:</span> 2457 | |
| 599 <span class=b>Number of Matches:</span> 1 | |
| 600 </p> | |
| 601 </div> | |
| 602 | |
| 603 | |
| 59 | 604 <div class=hotspot id=hotspot1-1-1> |
| 32 | 605 <p class=range> |
| 606 <span class=range>Range 1: 2119 to 2138</span> | |
| 607 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=2119&to=2138">GenBank</a> | |
| 608 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=2119&to=2138">Graphics</a> | |
| 609 </p> | |
| 610 | |
| 611 <table class=hotspotstable> | |
| 612 <tr> | |
| 613 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 614 </tr> | |
| 615 <tr> | |
| 616 <td>40.1 bits(20)</td> | |
| 617 <td>0.0</td> | |
| 618 <td>20/20(100%)</td> | |
| 619 <td>0/20(0%)</td> | |
| 620 <td>Plus/Plus</td> | |
| 621 </tr> | |
| 622 </table> | |
| 623 | |
| 624 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 | |
| 625 |||||||||||||||||||| | |
| 626 Subject 2119 AGCGCGCAAACTAGGATAAA 2138</pre> | |
| 627 </div> | |
| 628 | |
| 629 </div> | |
| 630 | |
| 59 | 631 <div class=alignment id=hit1-2> |
| 32 | 632 |
| 633 <div class=linkheader> | |
| 59 | 634 <div class=right><a href="#description1-2">Descriptions</a></div> |
| 32 | 635 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
| 636 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | |
| 637 </div> | |
| 638 | |
| 639 <div class=title> | |
| 640 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> | |
| 641 <p class=titleinfo> | |
| 642 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">2</a> | |
| 643 <span class=b>Length:</span> 323 | |
| 644 <span class=b>Number of Matches:</span> 1 | |
| 645 </p> | |
| 646 </div> | |
| 647 | |
| 648 | |
| 59 | 649 <div class=hotspot id=hotspot1-2-1> |
| 32 | 650 <p class=range> |
| 651 <span class=range>Range 1: 200 to 219</span> | |
| 652 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=200&to=219">GenBank</a> | |
| 653 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=200&to=219">Graphics</a> | |
| 654 </p> | |
| 655 | |
| 656 <table class=hotspotstable> | |
| 657 <tr> | |
| 658 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 659 </tr> | |
| 660 <tr> | |
| 661 <td>40.1 bits(20)</td> | |
| 662 <td>0.0</td> | |
| 663 <td>20/20(100%)</td> | |
| 664 <td>0/20(0%)</td> | |
| 665 <td>Plus/Plus</td> | |
| 666 </tr> | |
| 667 </table> | |
| 668 | |
| 669 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 | |
| 670 |||||||||||||||||||| | |
| 671 Subject 200 AGCGCGCAAACTAGGATAAA 219</pre> | |
| 672 </div> | |
| 673 | |
| 674 </div> | |
| 675 | |
| 676 </div></div> | |
| 677 </section> | |
| 678 </section> | |
| 679 | |
| 680 <section class=match id=match2> | |
| 681 | |
| 682 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 683 | |
| 684 <section class=header> | |
| 685 | |
| 686 <table class=headerdata> | |
| 687 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 688 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 689 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 690 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 691 <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr> | |
| 692 </table> | |
| 693 | |
| 694 </section> | |
| 695 | |
| 696 <section> | |
| 697 <h2>No Hits</h2> | |
| 698 <div class=grey> | |
| 699 <table class=headerdata> | |
| 700 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 701 </table> | |
| 702 </div> | |
| 703 </section> | |
| 704 </section> | |
| 705 | |
| 706 <section class=match id=match3> | |
| 707 | |
| 708 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 709 | |
| 710 <section class=header> | |
| 711 | |
| 712 <table class=headerdata> | |
| 713 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 714 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 715 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 716 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 717 <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr> | |
| 718 </table> | |
| 719 | |
| 720 </section> | |
| 721 | |
| 722 | |
| 723 <section class=graphics> | |
| 724 <h2>Graphic Summary</h2> | |
| 725 | |
| 726 <div class=grey> | |
| 727 <h3 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h3> | |
| 728 | |
| 729 <div class=defline id=defline3> | |
| 730 Mouse-over to show defline and scores, click to show alignments | |
| 731 </div> | |
| 732 | |
| 733 <div class=graphic> | |
| 734 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 735 <div class=legend><div class=graphicrow> | |
| 736 <div class=graphicitem style="background-color: black"><40</div> | |
| 737 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 738 <div class=graphicitem style="background-color: green">50–80</div> | |
| 739 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 740 <div class=graphicitem style="background-color: red">200≤</div> | |
| 741 </div></div> | |
| 742 <div style="clear: left"></div> | |
| 743 | |
| 744 <div class=tablewrapper> | |
| 745 | |
| 746 <div class=scale> | |
| 747 <div>query:</div> | |
| 748 <div class=graphicrow> | |
| 749 <div> | |
| 77 | 750 <div class=graphicitem style="width: 10%"> |
| 32 | 751 <div>2</div> |
| 752 </div> | |
| 77 | 753 <div class=graphicitem style="width: 10%"> |
| 32 | 754 <div>4</div> |
| 755 </div> | |
| 77 | 756 <div class=graphicitem style="width: 10%"> |
| 32 | 757 <div>6</div> |
| 758 </div> | |
| 77 | 759 <div class=graphicitem style="width: 10%"> |
| 32 | 760 <div>8</div> |
| 761 </div> | |
| 77 | 762 <div class=graphicitem style="width: 10%"> |
| 32 | 763 <div>10</div> |
| 764 </div> | |
| 77 | 765 <div class=graphicitem style="width: 10%"> |
| 32 | 766 <div>12</div> |
| 767 </div> | |
| 77 | 768 <div class=graphicitem style="width: 10%"> |
| 32 | 769 <div>14</div> |
| 770 </div> | |
| 77 | 771 <div class=graphicitem style="width: 10%"> |
| 32 | 772 <div>16</div> |
| 773 </div> | |
| 77 | 774 <div class=graphicitem style="width: 10%"> |
| 32 | 775 <div>18</div> |
| 776 </div> | |
| 77 | 777 <div class=graphicitem style="width: 10%"> |
| 32 | 778 <div>20</div> |
| 779 </div> | |
| 780 </div> | |
| 781 </div> | |
| 782 <div style="clear: left"></div> | |
| 783 </div> | |
| 784 | |
| 785 <a class=matchresult | |
| 59 | 786 href="#hit3-1" |
| 32 | 787 onmouseover='document.getElementById("defline3").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' |
| 788 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 789 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> | |
| 790 <div class="matchrow graphicrow"> | |
| 791 <div class="matchitem graphicitem" | |
| 77 | 792 style="background-color: black; width: 100%"></div> |
| 32 | 793 </div> |
| 794 </a> | |
| 795 | |
| 796 <a class=matchresult | |
| 59 | 797 href="#hit3-2" |
| 32 | 798 onmouseover='document.getElementById("defline3").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' |
| 799 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 800 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> | |
| 801 <div class="matchrow graphicrow"> | |
| 802 <div class="matchitem graphicitem" | |
| 77 | 803 style="background-color: black; width: 100%"></div> |
| 32 | 804 </div> |
| 805 </a> | |
| 806 | |
| 807 <a class=matchresult | |
| 59 | 808 href="#hit3-3" |
| 32 | 809 onmouseover='document.getElementById("defline3").innerHTML="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3\u0027UTR/plant_junction_region.|-9105899556052450000"' |
| 810 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 811 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000"> | |
| 812 <div class="matchrow graphicrow"> | |
| 813 <div class="matchitem graphicitem" | |
| 77 | 814 style="background-color: transparent; width: 15%"></div> |
| 32 | 815 <div class="matchitem graphicitem" |
| 77 | 816 style="background-color: black; width: 85%"></div> |
| 32 | 817 </div> |
| 818 </a> | |
| 819 | |
| 820 </div> | |
| 821 </div> | |
| 822 </div> | |
| 823 </section> | |
| 824 | |
| 825 | |
| 826 | |
| 827 <section class=descriptions> | |
| 828 <h2>Descriptions</h2> | |
| 829 | |
| 830 <div class=grey><div class=white> | |
| 831 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 832 | |
| 833 <table class=descriptiontable> | |
| 834 <col/><col/><col/><col/><col/><col/><col/> | |
| 835 <tr> | |
| 836 <th>Description</th> | |
| 837 <th>Max score</th> | |
| 838 <th>Total score</th> | |
| 839 <th>Query cover</th> | |
| 840 <th>E value</th> | |
| 841 <th>Ident</th> | |
| 842 <th>Accession</th> | |
| 843 </tr> | |
| 844 <tr> | |
| 59 | 845 <td><div><a href="#hit3-1" |
| 32 | 846 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" |
| 59 | 847 id="description3-1"> |
| 32 | 848 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 |
| 849 </a></div></td> | |
| 850 <td>40.1</td> | |
| 851 <td>40.1</td> | |
| 852 <td>100%</td> | |
| 853 <td>1.513e-07</td> | |
| 854 <td>100%</td> | |
| 855 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">5</a></td> | |
| 856 </tr> | |
| 857 <tr> | |
| 59 | 858 <td><div><a href="#hit3-2" |
| 32 | 859 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" |
| 59 | 860 id="description3-2"> |
| 32 | 861 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 |
| 862 </a></div></td> | |
| 863 <td>40.1</td> | |
| 864 <td>40.1</td> | |
| 865 <td>100%</td> | |
| 866 <td>1.513e-07</td> | |
| 867 <td>100%</td> | |
| 868 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">2</a></td> | |
| 869 </tr> | |
| 870 <tr> | |
| 59 | 871 <td><div><a href="#hit3-3" |
| 32 | 872 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000" |
| 59 | 873 id="description3-3"> |
| 32 | 874 AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000 |
| 875 </a></div></td> | |
| 876 <td>34.2</td> | |
| 877 <td>34.2</td> | |
| 878 <td>85%</td> | |
| 879 <td>9.334e-06</td> | |
| 880 <td>100%</td> | |
| 881 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">1</a></td> | |
| 882 </tr> | |
| 883 </table> | |
| 884 | |
| 885 </div></div> | |
| 886 </section> | |
| 887 | |
| 888 | |
| 889 | |
| 890 <section class=alignments> | |
| 891 <h2>Alignments</h2> | |
| 892 | |
| 893 <div class=grey><div class=white> | |
| 59 | 894 <div class=alignment id=hit3-1> |
| 32 | 895 |
| 896 <div class=linkheader> | |
| 59 | 897 <div class=right><a href="#description3-1">Descriptions</a></div> |
| 32 | 898 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
| 899 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | |
| 900 </div> | |
| 901 | |
| 902 <div class=title> | |
| 903 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> | |
| 904 <p class=titleinfo> | |
| 905 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">5</a> | |
| 906 <span class=b>Length:</span> 2457 | |
| 907 <span class=b>Number of Matches:</span> 1 | |
| 908 </p> | |
| 909 </div> | |
| 910 | |
| 911 | |
| 59 | 912 <div class=hotspot id=hotspot3-1-1> |
| 32 | 913 <p class=range> |
| 914 <span class=range>Range 1: 2143 to 2162</span> | |
| 915 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=2143&to=2162">GenBank</a> | |
| 916 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=2143&to=2162">Graphics</a> | |
| 917 </p> | |
| 918 | |
| 919 <table class=hotspotstable> | |
| 920 <tr> | |
| 921 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 922 </tr> | |
| 923 <tr> | |
| 924 <td>40.1 bits(20)</td> | |
| 925 <td>0.0</td> | |
| 926 <td>20/20(100%)</td> | |
| 927 <td>0/20(0%)</td> | |
| 928 <td>Plus/Plus</td> | |
| 929 </tr> | |
| 930 </table> | |
| 931 | |
| 932 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 | |
| 933 |||||||||||||||||||| | |
| 934 Subject 2143 CGCGCGCGGTGTCATCTATG 2162</pre> | |
| 935 </div> | |
| 936 | |
| 937 </div> | |
| 938 | |
| 59 | 939 <div class=alignment id=hit3-2> |
| 32 | 940 |
| 941 <div class=linkheader> | |
| 59 | 942 <div class=right><a href="#description3-2">Descriptions</a></div> |
| 32 | 943 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
| 944 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | |
| 945 </div> | |
| 946 | |
| 947 <div class=title> | |
| 948 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> | |
| 949 <p class=titleinfo> | |
| 950 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">2</a> | |
| 951 <span class=b>Length:</span> 323 | |
| 952 <span class=b>Number of Matches:</span> 1 | |
| 953 </p> | |
| 954 </div> | |
| 955 | |
| 956 | |
| 59 | 957 <div class=hotspot id=hotspot3-2-1> |
| 32 | 958 <p class=range> |
| 959 <span class=range>Range 1: 224 to 243</span> | |
| 960 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=224&to=243">GenBank</a> | |
| 961 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=224&to=243">Graphics</a> | |
| 962 </p> | |
| 963 | |
| 964 <table class=hotspotstable> | |
| 965 <tr> | |
| 966 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 967 </tr> | |
| 968 <tr> | |
| 969 <td>40.1 bits(20)</td> | |
| 970 <td>0.0</td> | |
| 971 <td>20/20(100%)</td> | |
| 972 <td>0/20(0%)</td> | |
| 973 <td>Plus/Plus</td> | |
| 974 </tr> | |
| 975 </table> | |
| 976 | |
| 977 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 | |
| 978 |||||||||||||||||||| | |
| 979 Subject 224 CGCGCGCGGTGTCATCTATG 243</pre> | |
| 980 </div> | |
| 981 | |
| 982 </div> | |
| 983 | |
| 59 | 984 <div class=alignment id=hit3-3> |
| 32 | 985 |
| 986 <div class=linkheader> | |
| 59 | 987 <div class=right><a href="#description3-3">Descriptions</a></div> |
| 32 | 988 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
| 989 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | |
| 990 </div> | |
| 991 | |
| 992 <div class=title> | |
| 993 <p class=hittitle>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000</p> | |
| 994 <p class=titleinfo> | |
| 995 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">1</a> | |
| 996 <span class=b>Length:</span> 1045 | |
| 997 <span class=b>Number of Matches:</span> 1 | |
| 998 </p> | |
| 999 </div> | |
| 1000 | |
| 1001 | |
| 59 | 1002 <div class=hotspot id=hotspot3-3-1> |
| 32 | 1003 <p class=range> |
| 1004 <span class=range>Range 1: 2 to 18</span> | |
| 1005 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=2&to=18">GenBank</a> | |
| 1006 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=2&to=18">Graphics</a> | |
| 1007 </p> | |
| 1008 | |
| 1009 <table class=hotspotstable> | |
| 1010 <tr> | |
| 1011 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1012 </tr> | |
| 1013 <tr> | |
| 1014 <td>34.2 bits(17)</td> | |
| 1015 <td>0.0</td> | |
| 1016 <td>17/17(100%)</td> | |
| 1017 <td>0/17(0%)</td> | |
| 1018 <td>Plus/Plus</td> | |
| 1019 </tr> | |
| 1020 </table> | |
| 1021 | |
| 1022 <pre class=alignmentgraphic>Query 4 GCGCGGTGTCATCTATG 20 | |
| 1023 ||||||||||||||||| | |
| 1024 Subject 2 GCGCGGTGTCATCTATG 18</pre> | |
| 1025 </div> | |
| 1026 | |
| 1027 </div> | |
| 1028 | |
| 1029 </div></div> | |
| 1030 </section> | |
| 1031 </section> | |
| 1032 | |
| 1033 <section class=match id=match4> | |
| 1034 | |
| 1035 <h1>Nucleotide Sequence (24 letters)</h1> | |
| 1036 | |
| 1037 <section class=header> | |
| 1038 | |
| 1039 <table class=headerdata> | |
| 1040 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1041 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1042 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1043 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1044 <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr> | |
| 1045 </table> | |
| 1046 | |
| 1047 </section> | |
| 1048 | |
| 1049 <section> | |
| 1050 <h2>No Hits</h2> | |
| 1051 <div class=grey> | |
| 1052 <table class=headerdata> | |
| 1053 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1054 </table> | |
| 1055 </div> | |
| 1056 </section> | |
| 1057 </section> | |
| 1058 | |
| 1059 <section class=match id=match5> | |
| 1060 | |
| 1061 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1062 | |
| 1063 <section class=header> | |
| 1064 | |
| 1065 <table class=headerdata> | |
| 1066 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1067 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1068 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1069 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1070 <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr> | |
| 1071 </table> | |
| 1072 | |
| 1073 </section> | |
| 1074 | |
| 1075 <section> | |
| 1076 <h2>No Hits</h2> | |
| 1077 <div class=grey> | |
| 1078 <table class=headerdata> | |
| 1079 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1080 </table> | |
| 1081 </div> | |
| 1082 </section> | |
| 1083 </section> | |
| 1084 | |
| 1085 <section class=match id=match6> | |
| 1086 | |
| 1087 <h1>Nucleotide Sequence (25 letters)</h1> | |
| 1088 | |
| 1089 <section class=header> | |
| 1090 | |
| 1091 <table class=headerdata> | |
| 1092 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1093 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1094 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1095 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1096 <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr> | |
| 1097 </table> | |
| 1098 | |
| 1099 </section> | |
| 1100 | |
| 1101 | |
| 1102 <section class=graphics> | |
| 1103 <h2>Graphic Summary</h2> | |
| 1104 | |
| 1105 <div class=grey> | |
| 1106 <h3 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h3> | |
| 1107 | |
| 1108 <div class=defline id=defline6> | |
| 1109 Mouse-over to show defline and scores, click to show alignments | |
| 1110 </div> | |
| 1111 | |
| 1112 <div class=graphic> | |
| 1113 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 1114 <div class=legend><div class=graphicrow> | |
| 1115 <div class=graphicitem style="background-color: black"><40</div> | |
| 1116 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 1117 <div class=graphicitem style="background-color: green">50–80</div> | |
| 1118 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 1119 <div class=graphicitem style="background-color: red">200≤</div> | |
| 1120 </div></div> | |
| 1121 <div style="clear: left"></div> | |
| 1122 | |
| 1123 <div class=tablewrapper> | |
| 1124 | |
| 1125 <div class=scale> | |
| 1126 <div>query:</div> | |
| 1127 <div class=graphicrow> | |
| 1128 <div> | |
| 77 | 1129 <div class=graphicitem style="width: 12%"> |
| 32 | 1130 <div>3</div> |
| 1131 </div> | |
| 77 | 1132 <div class=graphicitem style="width: 12%"> |
| 32 | 1133 <div>6</div> |
| 1134 </div> | |
| 77 | 1135 <div class=graphicitem style="width: 12%"> |
| 32 | 1136 <div>9</div> |
| 1137 </div> | |
| 77 | 1138 <div class=graphicitem style="width: 12%"> |
| 32 | 1139 <div>12</div> |
| 1140 </div> | |
| 77 | 1141 <div class=graphicitem style="width: 12%"> |
| 32 | 1142 <div>15</div> |
| 1143 </div> | |
| 77 | 1144 <div class=graphicitem style="width: 12%"> |
| 32 | 1145 <div>18</div> |
| 1146 </div> | |
| 77 | 1147 <div class=graphicitem style="width: 12%"> |
| 32 | 1148 <div>21</div> |
| 1149 </div> | |
| 77 | 1150 <div class=graphicitem style="width: 12%"> |
| 32 | 1151 <div>24</div> |
| 1152 </div> | |
| 77 | 1153 <div class=graphicitem style="width: 4%"> |
| 32 | 1154 <div>25</div> |
| 1155 </div> | |
| 1156 </div> | |
| 1157 </div> | |
| 1158 <div style="clear: left"></div> | |
| 1159 </div> | |
| 1160 | |
| 1161 <a class=matchresult | |
| 59 | 1162 href="#hit6-1" |
| 32 | 1163 onmouseover='document.getElementById("defline6").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' |
| 1164 onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1165 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> | |
| 1166 <div class="matchrow graphicrow"> | |
| 1167 <div class="matchitem graphicitem" | |
| 77 | 1168 style="background-color: black; width: 88%"></div> |
| 32 | 1169 <div class="matchitem graphicitem" |
| 77 | 1170 style="background-color: transparent; width: 12%"></div> |
| 32 | 1171 </div> |
| 1172 </a> | |
| 1173 | |
| 1174 <a class=matchresult | |
| 59 | 1175 href="#hit6-2" |
| 32 | 1176 onmouseover='document.getElementById("defline6").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' |
| 1177 onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1178 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> | |
| 1179 <div class="matchrow graphicrow"> | |
| 1180 <div class="matchitem graphicitem" | |
| 77 | 1181 style="background-color: black; width: 88%"></div> |
| 32 | 1182 <div class="matchitem graphicitem" |
| 77 | 1183 style="background-color: transparent; width: 12%"></div> |
| 32 | 1184 </div> |
| 1185 </a> | |
| 1186 | |
| 1187 </div> | |
| 1188 </div> | |
| 1189 </div> | |
| 1190 </section> | |
| 1191 | |
| 1192 | |
| 1193 | |
| 1194 <section class=descriptions> | |
| 1195 <h2>Descriptions</h2> | |
| 1196 | |
| 1197 <div class=grey><div class=white> | |
| 1198 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 1199 | |
| 1200 <table class=descriptiontable> | |
| 1201 <col/><col/><col/><col/><col/><col/><col/> | |
| 1202 <tr> | |
| 1203 <th>Description</th> | |
| 1204 <th>Max score</th> | |
| 1205 <th>Total score</th> | |
| 1206 <th>Query cover</th> | |
| 1207 <th>E value</th> | |
| 1208 <th>Ident</th> | |
| 1209 <th>Accession</th> | |
| 1210 </tr> | |
| 1211 <tr> | |
| 59 | 1212 <td><div><a href="#hit6-1" |
| 32 | 1213 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" |
| 59 | 1214 id="description6-1"> |
| 32 | 1215 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 |
| 1216 </a></div></td> | |
| 1217 <td>36.2</td> | |
| 1218 <td>36.2</td> | |
| 1219 <td>88%</td> | |
| 1220 <td>3.148e-06</td> | |
| 1221 <td>95%</td> | |
| 1222 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">7</a></td> | |
| 1223 </tr> | |
| 1224 <tr> | |
| 59 | 1225 <td><div><a href="#hit6-2" |
| 32 | 1226 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" |
| 59 | 1227 id="description6-2"> |
| 32 | 1228 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 |
| 1229 </a></div></td> | |
| 1230 <td>36.2</td> | |
| 1231 <td>36.2</td> | |
| 1232 <td>88%</td> | |
| 1233 <td>3.148e-06</td> | |
| 1234 <td>95%</td> | |
| 1235 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">6</a></td> | |
| 1236 </tr> | |
| 1237 </table> | |
| 1238 | |
| 1239 </div></div> | |
| 1240 </section> | |
| 1241 | |
| 1242 | |
| 1243 | |
| 1244 <section class=alignments> | |
| 1245 <h2>Alignments</h2> | |
| 1246 | |
| 1247 <div class=grey><div class=white> | |
| 59 | 1248 <div class=alignment id=hit6-1> |
| 32 | 1249 |
| 1250 <div class=linkheader> | |
| 59 | 1251 <div class=right><a href="#description6-1">Descriptions</a></div> |
| 32 | 1252 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
| 1253 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | |
| 1254 </div> | |
| 1255 | |
| 1256 <div class=title> | |
| 1257 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> | |
| 1258 <p class=titleinfo> | |
| 1259 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">7</a> | |
| 1260 <span class=b>Length:</span> 4983 | |
| 1261 <span class=b>Number of Matches:</span> 1 | |
| 1262 </p> | |
| 1263 </div> | |
| 1264 | |
| 1265 | |
| 59 | 1266 <div class=hotspot id=hotspot6-1-1> |
| 32 | 1267 <p class=range> |
| 1268 <span class=range>Range 1: 2344 to 2365</span> | |
| 1269 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=2344&to=2365">GenBank</a> | |
| 1270 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=2344&to=2365">Graphics</a> | |
| 1271 </p> | |
| 1272 | |
| 1273 <table class=hotspotstable> | |
| 1274 <tr> | |
| 1275 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1276 </tr> | |
| 1277 <tr> | |
| 1278 <td>36.2 bits(18)</td> | |
| 1279 <td>0.0</td> | |
| 1280 <td>21/22(95%)</td> | |
| 1281 <td>0/22(0%)</td> | |
| 1282 <td>Plus/Plus</td> | |
| 1283 </tr> | |
| 1284 </table> | |
| 1285 | |
| 1286 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCAC 22 | |
| 1287 |||||||||||||| ||||||| | |
| 1288 Subject 2344 ACATGAACAGCGCCCTGACCAC 2365</pre> | |
| 1289 </div> | |
| 1290 | |
| 1291 </div> | |
| 1292 | |
| 59 | 1293 <div class=alignment id=hit6-2> |
| 32 | 1294 |
| 1295 <div class=linkheader> | |
| 59 | 1296 <div class=right><a href="#description6-2">Descriptions</a></div> |
| 32 | 1297 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
| 1298 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | |
| 1299 </div> | |
| 1300 | |
| 1301 <div class=title> | |
| 1302 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> | |
| 1303 <p class=titleinfo> | |
| 1304 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">6</a> | |
| 1305 <span class=b>Length:</span> 4180 | |
| 1306 <span class=b>Number of Matches:</span> 1 | |
| 1307 </p> | |
| 1308 </div> | |
| 1309 | |
| 1310 | |
| 59 | 1311 <div class=hotspot id=hotspot6-2-1> |
| 32 | 1312 <p class=range> |
| 1313 <span class=range>Range 1: 1541 to 1562</span> | |
| 1314 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=1541&to=1562">GenBank</a> | |
| 1315 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=1541&to=1562">Graphics</a> | |
| 1316 </p> | |
| 1317 | |
| 1318 <table class=hotspotstable> | |
| 1319 <tr> | |
| 1320 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1321 </tr> | |
| 1322 <tr> | |
| 1323 <td>36.2 bits(18)</td> | |
| 1324 <td>0.0</td> | |
| 1325 <td>21/22(95%)</td> | |
| 1326 <td>0/22(0%)</td> | |
| 1327 <td>Plus/Plus</td> | |
| 1328 </tr> | |
| 1329 </table> | |
| 1330 | |
| 1331 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCAC 22 | |
| 1332 |||||||||||||| ||||||| | |
| 1333 Subject 1541 ACATGAACAGCGCCCTGACCAC 1562</pre> | |
| 1334 </div> | |
| 1335 | |
| 1336 </div> | |
| 1337 | |
| 1338 </div></div> | |
| 1339 </section> | |
| 1340 </section> | |
| 1341 | |
| 1342 <section class=match id=match7> | |
| 1343 | |
| 1344 <h1>Nucleotide Sequence (74 letters)</h1> | |
| 1345 | |
| 1346 <section class=header> | |
| 1347 | |
| 1348 <table class=headerdata> | |
| 1349 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1350 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1351 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1352 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1353 <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr> | |
| 1354 </table> | |
| 1355 | |
| 1356 </section> | |
| 1357 | |
| 1358 | |
| 1359 <section class=graphics> | |
| 1360 <h2>Graphic Summary</h2> | |
| 1361 | |
| 1362 <div class=grey> | |
| 1363 <h3 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h3> | |
| 1364 | |
| 1365 <div class=defline id=defline7> | |
| 1366 Mouse-over to show defline and scores, click to show alignments | |
| 1367 </div> | |
| 1368 | |
| 1369 <div class=graphic> | |
| 1370 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 1371 <div class=legend><div class=graphicrow> | |
| 1372 <div class=graphicitem style="background-color: black"><40</div> | |
| 1373 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 1374 <div class=graphicitem style="background-color: green">50–80</div> | |
| 1375 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 1376 <div class=graphicitem style="background-color: red">200≤</div> | |
| 1377 </div></div> | |
| 1378 <div style="clear: left"></div> | |
| 1379 | |
| 1380 <div class=tablewrapper> | |
| 1381 | |
| 1382 <div class=scale> | |
| 1383 <div>query:</div> | |
| 1384 <div class=graphicrow> | |
| 1385 <div> | |
| 77 | 1386 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 1387 <div>8</div> |
| 1388 </div> | |
| 77 | 1389 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 1390 <div>16</div> |
| 1391 </div> | |
| 77 | 1392 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 1393 <div>24</div> |
| 1394 </div> | |
| 77 | 1395 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 1396 <div>32</div> |
| 1397 </div> | |
| 77 | 1398 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 1399 <div>40</div> |
| 1400 </div> | |
| 77 | 1401 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 1402 <div>48</div> |
| 1403 </div> | |
| 77 | 1404 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 1405 <div>56</div> |
| 1406 </div> | |
| 77 | 1407 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 1408 <div>64</div> |
| 1409 </div> | |
| 77 | 1410 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 1411 <div>72</div> |
| 1412 </div> | |
| 77 | 1413 <div class=graphicitem style="width: 2.7027027027%"> |
| 32 | 1414 <div> </div> |
| 1415 <div class=lastlabel>74</div> | |
| 1416 </div> | |
| 1417 </div> | |
| 1418 </div> | |
| 1419 <div style="clear: left"></div> | |
| 1420 </div> | |
| 1421 | |
| 1422 <a class=matchresult | |
| 59 | 1423 href="#hit7-1" |
| 32 | 1424 onmouseover='document.getElementById("defline7").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' |
| 1425 onmouseout='document.getElementById("defline7").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1426 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> | |
| 1427 <div class="matchrow graphicrow"> | |
| 1428 <div class="matchitem graphicitem" | |
| 77 | 1429 style="background-color: green; width: 100%"></div> |
| 32 | 1430 </div> |
| 1431 </a> | |
| 1432 | |
| 1433 <a class=matchresult | |
| 59 | 1434 href="#hit7-2" |
| 32 | 1435 onmouseover='document.getElementById("defline7").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' |
| 1436 onmouseout='document.getElementById("defline7").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1437 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> | |
| 1438 <div class="matchrow graphicrow"> | |
| 1439 <div class="matchitem graphicitem" | |
| 77 | 1440 style="background-color: green; width: 100%"></div> |
| 32 | 1441 </div> |
| 1442 </a> | |
| 1443 | |
| 1444 </div> | |
| 1445 </div> | |
| 1446 </div> | |
| 1447 </section> | |
| 1448 | |
| 1449 | |
| 1450 | |
| 1451 <section class=descriptions> | |
| 1452 <h2>Descriptions</h2> | |
| 1453 | |
| 1454 <div class=grey><div class=white> | |
| 1455 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 1456 | |
| 1457 <table class=descriptiontable> | |
| 1458 <col/><col/><col/><col/><col/><col/><col/> | |
| 1459 <tr> | |
| 1460 <th>Description</th> | |
| 1461 <th>Max score</th> | |
| 1462 <th>Total score</th> | |
| 1463 <th>Query cover</th> | |
| 1464 <th>E value</th> | |
| 1465 <th>Ident</th> | |
| 1466 <th>Accession</th> | |
| 1467 </tr> | |
| 1468 <tr> | |
| 59 | 1469 <td><div><a href="#hit7-1" |
| 32 | 1470 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" |
| 59 | 1471 id="description7-1"> |
| 32 | 1472 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 |
| 1473 </a></div></td> | |
| 1474 <td>67.9</td> | |
| 1475 <td>67.9</td> | |
| 1476 <td>100%</td> | |
| 1477 <td>3.564e-15</td> | |
| 1478 <td>86%</td> | |
| 1479 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">7</a></td> | |
| 1480 </tr> | |
| 1481 <tr> | |
| 59 | 1482 <td><div><a href="#hit7-2" |
| 32 | 1483 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" |
| 59 | 1484 id="description7-2"> |
| 32 | 1485 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 |
| 1486 </a></div></td> | |
| 1487 <td>67.9</td> | |
| 1488 <td>67.9</td> | |
| 1489 <td>100%</td> | |
| 1490 <td>3.564e-15</td> | |
| 1491 <td>86%</td> | |
| 1492 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">6</a></td> | |
| 1493 </tr> | |
| 1494 </table> | |
| 1495 | |
| 1496 </div></div> | |
| 1497 </section> | |
| 1498 | |
| 1499 | |
| 1500 | |
| 1501 <section class=alignments> | |
| 1502 <h2>Alignments</h2> | |
| 1503 | |
| 1504 <div class=grey><div class=white> | |
| 59 | 1505 <div class=alignment id=hit7-1> |
| 32 | 1506 |
| 1507 <div class=linkheader> | |
| 59 | 1508 <div class=right><a href="#description7-1">Descriptions</a></div> |
| 32 | 1509 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
| 1510 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | |
| 1511 </div> | |
| 1512 | |
| 1513 <div class=title> | |
| 1514 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> | |
| 1515 <p class=titleinfo> | |
| 1516 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">7</a> | |
| 1517 <span class=b>Length:</span> 4983 | |
| 1518 <span class=b>Number of Matches:</span> 1 | |
| 1519 </p> | |
| 1520 </div> | |
| 1521 | |
| 1522 | |
| 59 | 1523 <div class=hotspot id=hotspot7-1-1> |
| 32 | 1524 <p class=range> |
| 1525 <span class=range>Range 1: 2319 to 2392</span> | |
| 1526 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=2319&to=2392">GenBank</a> | |
| 1527 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=2319&to=2392">Graphics</a> | |
| 1528 </p> | |
| 1529 | |
| 1530 <table class=hotspotstable> | |
| 1531 <tr> | |
| 1532 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1533 </tr> | |
| 1534 <tr> | |
| 1535 <td>67.9 bits(34)</td> | |
| 1536 <td>0.0</td> | |
| 1537 <td>64/74(86%)</td> | |
| 1538 <td>0/74(0%)</td> | |
| 1539 <td>Plus/Plus</td> | |
| 1540 </tr> | |
| 1541 </table> | |
| 1542 | |
|
68
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1543 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 |
|
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1544 ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | |
|
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1545 Subject 2319 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 2378</pre> |
|
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1546 <pre class=alignmentgraphic>Query 61 TTCGCAGTCCAGAA 74 |
|
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1547 ||||| |||||||| |
|
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1548 Subject 2379 TTCGCCGTCCAGAA 2392</pre> |
| 32 | 1549 </div> |
| 1550 | |
| 1551 </div> | |
| 1552 | |
| 59 | 1553 <div class=alignment id=hit7-2> |
| 32 | 1554 |
| 1555 <div class=linkheader> | |
| 59 | 1556 <div class=right><a href="#description7-2">Descriptions</a></div> |
| 32 | 1557 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
| 1558 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | |
| 1559 </div> | |
| 1560 | |
| 1561 <div class=title> | |
| 1562 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> | |
| 1563 <p class=titleinfo> | |
| 1564 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">6</a> | |
| 1565 <span class=b>Length:</span> 4180 | |
| 1566 <span class=b>Number of Matches:</span> 1 | |
| 1567 </p> | |
| 1568 </div> | |
| 1569 | |
| 1570 | |
| 59 | 1571 <div class=hotspot id=hotspot7-2-1> |
| 32 | 1572 <p class=range> |
|
70
0ef071bba164
Modify test data to include a negative frame sequence that is split in multiple lines
Jan Kanis <jan.code@jankanis.nl>
parents:
68
diff
changeset
|
1573 <span class=range>Range 1: 1589 to 1516</span> |
|
0ef071bba164
Modify test data to include a negative frame sequence that is split in multiple lines
Jan Kanis <jan.code@jankanis.nl>
parents:
68
diff
changeset
|
1574 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=1589&to=1516">GenBank</a> |
|
0ef071bba164
Modify test data to include a negative frame sequence that is split in multiple lines
Jan Kanis <jan.code@jankanis.nl>
parents:
68
diff
changeset
|
1575 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=1589&to=1516">Graphics</a> |
| 32 | 1576 </p> |
| 1577 | |
| 1578 <table class=hotspotstable> | |
| 1579 <tr> | |
| 1580 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1581 </tr> | |
| 1582 <tr> | |
| 1583 <td>67.9 bits(34)</td> | |
| 1584 <td>0.0</td> | |
| 1585 <td>64/74(86%)</td> | |
| 1586 <td>0/74(0%)</td> | |
|
70
0ef071bba164
Modify test data to include a negative frame sequence that is split in multiple lines
Jan Kanis <jan.code@jankanis.nl>
parents:
68
diff
changeset
|
1587 <td>Plus/Minus</td> |
| 32 | 1588 </tr> |
| 1589 </table> | |
| 1590 | |
|
68
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1591 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 |
|
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1592 ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | |
|
70
0ef071bba164
Modify test data to include a negative frame sequence that is split in multiple lines
Jan Kanis <jan.code@jankanis.nl>
parents:
68
diff
changeset
|
1593 Subject 1589 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 1530</pre> |
|
68
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1594 <pre class=alignmentgraphic>Query 61 TTCGCAGTCCAGAA 74 |
|
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1595 ||||| |||||||| |
|
70
0ef071bba164
Modify test data to include a negative frame sequence that is split in multiple lines
Jan Kanis <jan.code@jankanis.nl>
parents:
68
diff
changeset
|
1596 Subject 1529 TTCGCCGTCCAGAA 1516</pre> |
| 32 | 1597 </div> |
| 1598 | |
| 1599 </div> | |
| 1600 | |
| 1601 </div></div> | |
| 1602 </section> | |
| 1603 </section> | |
| 1604 | |
| 1605 </div> | |
| 1606 | |
| 1607 <footer> | |
|
33
3bb5da68305e
add test update script, add url to github page
Jan Kanis <jan.code@jankanis.nl>
parents:
32
diff
changeset
|
1608 This page was generated by <a href="https://github.com/thehyve/blast2html/">blast2html</a>. |
| 32 | 1609 </footer> |
| 1610 </body> | |
| 1611 </html> | |
| 1612 |