changeset 32:ce8f29efc0a1

fix tests
author Jan Kanis <jan.code@jankanis.nl>
date Thu, 15 May 2014 17:22:02 +0200
parents 344cd76f6fd2
children 3bb5da68305e
files test-data/Galaxy19-[blastn_EUginius_primers_probes.fasta_vs_EUginius_plasmid_insert.fasta_].blastxml test-data/Galaxy8-[blastn-short_EUginius_primers_probes.fasta_vs__EUginius_].blastxml test-data/blast xml example1.html test-data/blast xml example2.html test-data/blast xml example3.html test-data/blast xml example3.xml test-data/blast xml example4.html test-data/blast xml example4.xml tool_dependencies.xml
diffstat 9 files changed, 20591 insertions(+), 1803 deletions(-) [+]
line wrap: on
line diff
--- a/test-data/Galaxy19-[blastn_EUginius_primers_probes.fasta_vs_EUginius_plasmid_insert.fasta_].blastxml	Thu May 15 16:59:18 2014 +0200
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,1387 +0,0 @@
-<?xml version="1.0"?>
-<!DOCTYPE BlastOutput PUBLIC "-//NCBI//NCBI BlastOutput/EN" "http://www.ncbi.nlm.nih.gov/dtd/NCBI_BlastOutput.dtd">
-<BlastOutput>
-  <BlastOutput_program>blastn</BlastOutput_program>
-  <BlastOutput_version>BLASTN 2.2.29+</BlastOutput_version>
-  <BlastOutput_reference>Stephen F. Altschul, Thomas L. Madden, Alejandro A. Sch&amp;auml;ffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), &quot;Gapped BLAST and PSI-BLAST: a new generation of protein database search programs&quot;, Nucleic Acids Res. 25:3389-3402.</BlastOutput_reference>
-  <BlastOutput_db></BlastOutput_db>
-  <BlastOutput_query-ID>Query_1</BlastOutput_query-ID>
-  <BlastOutput_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</BlastOutput_query-def>
-  <BlastOutput_query-len>20</BlastOutput_query-len>
-  <BlastOutput_param>
-    <Parameters>
-      <Parameters_expect>0.001</Parameters_expect>
-      <Parameters_sc-match>2</Parameters_sc-match>
-      <Parameters_sc-mismatch>-3</Parameters_sc-mismatch>
-      <Parameters_gap-open>5</Parameters_gap-open>
-      <Parameters_gap-extend>2</Parameters_gap-extend>
-      <Parameters_filter>L;m;</Parameters_filter>
-    </Parameters>
-  </BlastOutput_param>
-<BlastOutput_iterations>
-<Iteration>
-  <Iteration_iter-num>1</Iteration_iter-num>
-  <Iteration_query-ID>Query_1</Iteration_query-ID>
-  <Iteration_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>2</Iteration_iter-num>
-  <Iteration_query-ID>Query_1</Iteration_query-ID>
-  <Iteration_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>3</Iteration_iter-num>
-  <Iteration_query-ID>Query_1</Iteration_query-ID>
-  <Iteration_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-<Hit>
-  <Hit_num>1</Hit_num>
-  <Hit_id>Subject_3</Hit_id>
-  <Hit_def>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</Hit_def>
-  <Hit_accession>Subject_3</Hit_accession>
-  <Hit_len>323</Hit_len>
-  <Hit_hsps>
-    <Hsp>
-      <Hsp_num>1</Hsp_num>
-      <Hsp_bit-score>37.3537</Hsp_bit-score>
-      <Hsp_score>40</Hsp_score>
-      <Hsp_evalue>7.01052e-08</Hsp_evalue>
-      <Hsp_query-from>1</Hsp_query-from>
-      <Hsp_query-to>20</Hsp_query-to>
-      <Hsp_hit-from>200</Hsp_hit-from>
-      <Hsp_hit-to>219</Hsp_hit-to>
-      <Hsp_query-frame>1</Hsp_query-frame>
-      <Hsp_hit-frame>1</Hsp_hit-frame>
-      <Hsp_identity>20</Hsp_identity>
-      <Hsp_positive>20</Hsp_positive>
-      <Hsp_gaps>0</Hsp_gaps>
-      <Hsp_align-len>20</Hsp_align-len>
-      <Hsp_qseq>AGCGCGCAAACTAGGATAAA</Hsp_qseq>
-      <Hsp_hseq>AGCGCGCAAACTAGGATAAA</Hsp_hseq>
-      <Hsp_midline>||||||||||||||||||||</Hsp_midline>
-    </Hsp>
-  </Hit_hsps>
-</Hit>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>4</Iteration_iter-num>
-  <Iteration_query-ID>Query_1</Iteration_query-ID>
-  <Iteration_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>5</Iteration_iter-num>
-  <Iteration_query-ID>Query_1</Iteration_query-ID>
-  <Iteration_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>6</Iteration_iter-num>
-  <Iteration_query-ID>Query_1</Iteration_query-ID>
-  <Iteration_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-<Hit>
-  <Hit_num>1</Hit_num>
-  <Hit_id>Subject_6</Hit_id>
-  <Hit_def>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</Hit_def>
-  <Hit_accession>Subject_6</Hit_accession>
-  <Hit_len>2457</Hit_len>
-  <Hit_hsps>
-    <Hsp>
-      <Hsp_num>1</Hsp_num>
-      <Hsp_bit-score>37.3537</Hsp_bit-score>
-      <Hsp_score>40</Hsp_score>
-      <Hsp_evalue>7.01052e-08</Hsp_evalue>
-      <Hsp_query-from>1</Hsp_query-from>
-      <Hsp_query-to>20</Hsp_query-to>
-      <Hsp_hit-from>2119</Hsp_hit-from>
-      <Hsp_hit-to>2138</Hsp_hit-to>
-      <Hsp_query-frame>1</Hsp_query-frame>
-      <Hsp_hit-frame>1</Hsp_hit-frame>
-      <Hsp_identity>20</Hsp_identity>
-      <Hsp_positive>20</Hsp_positive>
-      <Hsp_gaps>0</Hsp_gaps>
-      <Hsp_align-len>20</Hsp_align-len>
-      <Hsp_qseq>AGCGCGCAAACTAGGATAAA</Hsp_qseq>
-      <Hsp_hseq>AGCGCGCAAACTAGGATAAA</Hsp_hseq>
-      <Hsp_midline>||||||||||||||||||||</Hsp_midline>
-    </Hsp>
-  </Hit_hsps>
-</Hit>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>7</Iteration_iter-num>
-  <Iteration_query-ID>Query_1</Iteration_query-ID>
-  <Iteration_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>8</Iteration_iter-num>
-  <Iteration_query-ID>Query_1</Iteration_query-ID>
-  <Iteration_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>9</Iteration_iter-num>
-  <Iteration_query-ID>Query_2</Iteration_query-ID>
-  <Iteration_query-def>Reverse_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>10</Iteration_iter-num>
-  <Iteration_query-ID>Query_2</Iteration_query-ID>
-  <Iteration_query-def>Reverse_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>11</Iteration_iter-num>
-  <Iteration_query-ID>Query_2</Iteration_query-ID>
-  <Iteration_query-def>Reverse_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>12</Iteration_iter-num>
-  <Iteration_query-ID>Query_2</Iteration_query-ID>
-  <Iteration_query-def>Reverse_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>13</Iteration_iter-num>
-  <Iteration_query-ID>Query_2</Iteration_query-ID>
-  <Iteration_query-def>Reverse_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>14</Iteration_iter-num>
-  <Iteration_query-ID>Query_2</Iteration_query-ID>
-  <Iteration_query-def>Reverse_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>15</Iteration_iter-num>
-  <Iteration_query-ID>Query_2</Iteration_query-ID>
-  <Iteration_query-def>Reverse_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>16</Iteration_iter-num>
-  <Iteration_query-ID>Query_2</Iteration_query-ID>
-  <Iteration_query-def>Reverse_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>17</Iteration_iter-num>
-  <Iteration_query-ID>Query_3</Iteration_query-ID>
-  <Iteration_query-def>Probe|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>18</Iteration_iter-num>
-  <Iteration_query-ID>Query_3</Iteration_query-ID>
-  <Iteration_query-def>Probe|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-<Hit>
-  <Hit_num>1</Hit_num>
-  <Hit_id>Subject_2</Hit_id>
-  <Hit_def>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3&apos;UTR/plant_junction_region.|-9105899556052450000</Hit_def>
-  <Hit_accession>Subject_2</Hit_accession>
-  <Hit_len>1045</Hit_len>
-  <Hit_hsps>
-    <Hsp>
-      <Hsp_num>1</Hsp_num>
-      <Hsp_bit-score>31.9436</Hsp_bit-score>
-      <Hsp_score>34</Hsp_score>
-      <Hsp_evalue>2.98095e-06</Hsp_evalue>
-      <Hsp_query-from>4</Hsp_query-from>
-      <Hsp_query-to>20</Hsp_query-to>
-      <Hsp_hit-from>2</Hsp_hit-from>
-      <Hsp_hit-to>18</Hsp_hit-to>
-      <Hsp_query-frame>1</Hsp_query-frame>
-      <Hsp_hit-frame>1</Hsp_hit-frame>
-      <Hsp_identity>17</Hsp_identity>
-      <Hsp_positive>17</Hsp_positive>
-      <Hsp_gaps>0</Hsp_gaps>
-      <Hsp_align-len>17</Hsp_align-len>
-      <Hsp_qseq>GCGCGGTGTCATCTATG</Hsp_qseq>
-      <Hsp_hseq>GCGCGGTGTCATCTATG</Hsp_hseq>
-      <Hsp_midline>|||||||||||||||||</Hsp_midline>
-    </Hsp>
-  </Hit_hsps>
-</Hit>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>19</Iteration_iter-num>
-  <Iteration_query-ID>Query_3</Iteration_query-ID>
-  <Iteration_query-def>Probe|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-<Hit>
-  <Hit_num>1</Hit_num>
-  <Hit_id>Subject_3</Hit_id>
-  <Hit_def>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</Hit_def>
-  <Hit_accession>Subject_3</Hit_accession>
-  <Hit_len>323</Hit_len>
-  <Hit_hsps>
-    <Hsp>
-      <Hsp_num>1</Hsp_num>
-      <Hsp_bit-score>37.3537</Hsp_bit-score>
-      <Hsp_score>40</Hsp_score>
-      <Hsp_evalue>7.01052e-08</Hsp_evalue>
-      <Hsp_query-from>1</Hsp_query-from>
-      <Hsp_query-to>20</Hsp_query-to>
-      <Hsp_hit-from>224</Hsp_hit-from>
-      <Hsp_hit-to>243</Hsp_hit-to>
-      <Hsp_query-frame>1</Hsp_query-frame>
-      <Hsp_hit-frame>1</Hsp_hit-frame>
-      <Hsp_identity>20</Hsp_identity>
-      <Hsp_positive>20</Hsp_positive>
-      <Hsp_gaps>0</Hsp_gaps>
-      <Hsp_align-len>20</Hsp_align-len>
-      <Hsp_qseq>CGCGCGCGGTGTCATCTATG</Hsp_qseq>
-      <Hsp_hseq>CGCGCGCGGTGTCATCTATG</Hsp_hseq>
-      <Hsp_midline>||||||||||||||||||||</Hsp_midline>
-    </Hsp>
-  </Hit_hsps>
-</Hit>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>20</Iteration_iter-num>
-  <Iteration_query-ID>Query_3</Iteration_query-ID>
-  <Iteration_query-def>Probe|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>21</Iteration_iter-num>
-  <Iteration_query-ID>Query_3</Iteration_query-ID>
-  <Iteration_query-def>Probe|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>22</Iteration_iter-num>
-  <Iteration_query-ID>Query_3</Iteration_query-ID>
-  <Iteration_query-def>Probe|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-<Hit>
-  <Hit_num>1</Hit_num>
-  <Hit_id>Subject_6</Hit_id>
-  <Hit_def>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</Hit_def>
-  <Hit_accession>Subject_6</Hit_accession>
-  <Hit_len>2457</Hit_len>
-  <Hit_hsps>
-    <Hsp>
-      <Hsp_num>1</Hsp_num>
-      <Hsp_bit-score>37.3537</Hsp_bit-score>
-      <Hsp_score>40</Hsp_score>
-      <Hsp_evalue>7.01052e-08</Hsp_evalue>
-      <Hsp_query-from>1</Hsp_query-from>
-      <Hsp_query-to>20</Hsp_query-to>
-      <Hsp_hit-from>2143</Hsp_hit-from>
-      <Hsp_hit-to>2162</Hsp_hit-to>
-      <Hsp_query-frame>1</Hsp_query-frame>
-      <Hsp_hit-frame>1</Hsp_hit-frame>
-      <Hsp_identity>20</Hsp_identity>
-      <Hsp_positive>20</Hsp_positive>
-      <Hsp_gaps>0</Hsp_gaps>
-      <Hsp_align-len>20</Hsp_align-len>
-      <Hsp_qseq>CGCGCGCGGTGTCATCTATG</Hsp_qseq>
-      <Hsp_hseq>CGCGCGCGGTGTCATCTATG</Hsp_hseq>
-      <Hsp_midline>||||||||||||||||||||</Hsp_midline>
-    </Hsp>
-  </Hit_hsps>
-</Hit>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>23</Iteration_iter-num>
-  <Iteration_query-ID>Query_3</Iteration_query-ID>
-  <Iteration_query-def>Probe|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>24</Iteration_iter-num>
-  <Iteration_query-ID>Query_3</Iteration_query-ID>
-  <Iteration_query-def>Probe|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>25</Iteration_iter-num>
-  <Iteration_query-ID>Query_4</Iteration_query-ID>
-  <Iteration_query-def>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>24</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>9</Statistics_hsp-len>
-      <Statistics_eff-space>15375</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>26</Iteration_iter-num>
-  <Iteration_query-ID>Query_4</Iteration_query-ID>
-  <Iteration_query-def>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>24</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>9</Statistics_hsp-len>
-      <Statistics_eff-space>15375</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>27</Iteration_iter-num>
-  <Iteration_query-ID>Query_4</Iteration_query-ID>
-  <Iteration_query-def>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>24</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>9</Statistics_hsp-len>
-      <Statistics_eff-space>15375</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>28</Iteration_iter-num>
-  <Iteration_query-ID>Query_4</Iteration_query-ID>
-  <Iteration_query-def>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>24</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>9</Statistics_hsp-len>
-      <Statistics_eff-space>15375</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>29</Iteration_iter-num>
-  <Iteration_query-ID>Query_4</Iteration_query-ID>
-  <Iteration_query-def>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>24</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>9</Statistics_hsp-len>
-      <Statistics_eff-space>15375</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>30</Iteration_iter-num>
-  <Iteration_query-ID>Query_4</Iteration_query-ID>
-  <Iteration_query-def>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>24</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>9</Statistics_hsp-len>
-      <Statistics_eff-space>15375</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>31</Iteration_iter-num>
-  <Iteration_query-ID>Query_4</Iteration_query-ID>
-  <Iteration_query-def>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>24</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>9</Statistics_hsp-len>
-      <Statistics_eff-space>15375</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>32</Iteration_iter-num>
-  <Iteration_query-ID>Query_4</Iteration_query-ID>
-  <Iteration_query-def>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>24</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>9</Statistics_hsp-len>
-      <Statistics_eff-space>15375</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>33</Iteration_iter-num>
-  <Iteration_query-ID>Query_5</Iteration_query-ID>
-  <Iteration_query-def>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>34</Iteration_iter-num>
-  <Iteration_query-ID>Query_5</Iteration_query-ID>
-  <Iteration_query-def>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>35</Iteration_iter-num>
-  <Iteration_query-ID>Query_5</Iteration_query-ID>
-  <Iteration_query-def>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>36</Iteration_iter-num>
-  <Iteration_query-ID>Query_5</Iteration_query-ID>
-  <Iteration_query-def>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>37</Iteration_iter-num>
-  <Iteration_query-ID>Query_5</Iteration_query-ID>
-  <Iteration_query-def>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>38</Iteration_iter-num>
-  <Iteration_query-ID>Query_5</Iteration_query-ID>
-  <Iteration_query-def>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>39</Iteration_iter-num>
-  <Iteration_query-ID>Query_5</Iteration_query-ID>
-  <Iteration_query-def>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>40</Iteration_iter-num>
-  <Iteration_query-ID>Query_5</Iteration_query-ID>
-  <Iteration_query-def>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>12312</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>41</Iteration_iter-num>
-  <Iteration_query-ID>Query_6</Iteration_query-ID>
-  <Iteration_query-def>Probe|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>25</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>9</Statistics_hsp-len>
-      <Statistics_eff-space>16400</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>42</Iteration_iter-num>
-  <Iteration_query-ID>Query_6</Iteration_query-ID>
-  <Iteration_query-def>Probe|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>25</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>9</Statistics_hsp-len>
-      <Statistics_eff-space>16400</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>43</Iteration_iter-num>
-  <Iteration_query-ID>Query_6</Iteration_query-ID>
-  <Iteration_query-def>Probe|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>25</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>9</Statistics_hsp-len>
-      <Statistics_eff-space>16400</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>44</Iteration_iter-num>
-  <Iteration_query-ID>Query_6</Iteration_query-ID>
-  <Iteration_query-def>Probe|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>25</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>9</Statistics_hsp-len>
-      <Statistics_eff-space>16400</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>45</Iteration_iter-num>
-  <Iteration_query-ID>Query_6</Iteration_query-ID>
-  <Iteration_query-def>Probe|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>25</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>9</Statistics_hsp-len>
-      <Statistics_eff-space>16400</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>46</Iteration_iter-num>
-  <Iteration_query-ID>Query_6</Iteration_query-ID>
-  <Iteration_query-def>Probe|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>25</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>9</Statistics_hsp-len>
-      <Statistics_eff-space>16400</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>47</Iteration_iter-num>
-  <Iteration_query-ID>Query_6</Iteration_query-ID>
-  <Iteration_query-def>Probe|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>25</Iteration_query-len>
-<Iteration_hits>
-<Hit>
-  <Hit_num>1</Hit_num>
-  <Hit_id>Subject_7</Hit_id>
-  <Hit_def>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</Hit_def>
-  <Hit_accession>Subject_7</Hit_accession>
-  <Hit_len>4180</Hit_len>
-  <Hit_hsps>
-    <Hsp>
-      <Hsp_num>1</Hsp_num>
-      <Hsp_bit-score>37.3537</Hsp_bit-score>
-      <Hsp_score>40</Hsp_score>
-      <Hsp_evalue>9.33825e-08</Hsp_evalue>
-      <Hsp_query-from>1</Hsp_query-from>
-      <Hsp_query-to>25</Hsp_query-to>
-      <Hsp_hit-from>1541</Hsp_hit-from>
-      <Hsp_hit-to>1565</Hsp_hit-to>
-      <Hsp_query-frame>1</Hsp_query-frame>
-      <Hsp_hit-frame>1</Hsp_hit-frame>
-      <Hsp_identity>23</Hsp_identity>
-      <Hsp_positive>23</Hsp_positive>
-      <Hsp_gaps>0</Hsp_gaps>
-      <Hsp_align-len>25</Hsp_align-len>
-      <Hsp_qseq>ACATGAACAGCGCCTTGACCACAGC</Hsp_qseq>
-      <Hsp_hseq>ACATGAACAGCGCCCTGACCACCGC</Hsp_hseq>
-      <Hsp_midline>|||||||||||||| ||||||| ||</Hsp_midline>
-    </Hsp>
-  </Hit_hsps>
-</Hit>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>9</Statistics_hsp-len>
-      <Statistics_eff-space>16400</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>48</Iteration_iter-num>
-  <Iteration_query-ID>Query_6</Iteration_query-ID>
-  <Iteration_query-def>Probe|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>25</Iteration_query-len>
-<Iteration_hits>
-<Hit>
-  <Hit_num>1</Hit_num>
-  <Hit_id>Subject_8</Hit_id>
-  <Hit_def>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</Hit_def>
-  <Hit_accession>Subject_8</Hit_accession>
-  <Hit_len>4983</Hit_len>
-  <Hit_hsps>
-    <Hsp>
-      <Hsp_num>1</Hsp_num>
-      <Hsp_bit-score>37.3537</Hsp_bit-score>
-      <Hsp_score>40</Hsp_score>
-      <Hsp_evalue>9.33825e-08</Hsp_evalue>
-      <Hsp_query-from>1</Hsp_query-from>
-      <Hsp_query-to>25</Hsp_query-to>
-      <Hsp_hit-from>2344</Hsp_hit-from>
-      <Hsp_hit-to>2368</Hsp_hit-to>
-      <Hsp_query-frame>1</Hsp_query-frame>
-      <Hsp_hit-frame>1</Hsp_hit-frame>
-      <Hsp_identity>23</Hsp_identity>
-      <Hsp_positive>23</Hsp_positive>
-      <Hsp_gaps>0</Hsp_gaps>
-      <Hsp_align-len>25</Hsp_align-len>
-      <Hsp_qseq>ACATGAACAGCGCCTTGACCACAGC</Hsp_qseq>
-      <Hsp_hseq>ACATGAACAGCGCCCTGACCACCGC</Hsp_hseq>
-      <Hsp_midline>|||||||||||||| ||||||| ||</Hsp_midline>
-    </Hsp>
-  </Hit_hsps>
-</Hit>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>9</Statistics_hsp-len>
-      <Statistics_eff-space>16400</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>49</Iteration_iter-num>
-  <Iteration_query-ID>Query_7</Iteration_query-ID>
-  <Iteration_query-def>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>74</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>11</Statistics_hsp-len>
-      <Statistics_eff-space>64449</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>50</Iteration_iter-num>
-  <Iteration_query-ID>Query_7</Iteration_query-ID>
-  <Iteration_query-def>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>74</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>11</Statistics_hsp-len>
-      <Statistics_eff-space>64449</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>51</Iteration_iter-num>
-  <Iteration_query-ID>Query_7</Iteration_query-ID>
-  <Iteration_query-def>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>74</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>11</Statistics_hsp-len>
-      <Statistics_eff-space>64449</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>52</Iteration_iter-num>
-  <Iteration_query-ID>Query_7</Iteration_query-ID>
-  <Iteration_query-def>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>74</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>11</Statistics_hsp-len>
-      <Statistics_eff-space>64449</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>53</Iteration_iter-num>
-  <Iteration_query-ID>Query_7</Iteration_query-ID>
-  <Iteration_query-def>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>74</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>11</Statistics_hsp-len>
-      <Statistics_eff-space>64449</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>54</Iteration_iter-num>
-  <Iteration_query-ID>Query_7</Iteration_query-ID>
-  <Iteration_query-def>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>74</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>11</Statistics_hsp-len>
-      <Statistics_eff-space>64449</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>55</Iteration_iter-num>
-  <Iteration_query-ID>Query_7</Iteration_query-ID>
-  <Iteration_query-def>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>74</Iteration_query-len>
-<Iteration_hits>
-<Hit>
-  <Hit_num>1</Hit_num>
-  <Hit_id>Subject_7</Hit_id>
-  <Hit_def>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</Hit_def>
-  <Hit_accession>Subject_7</Hit_accession>
-  <Hit_len>4180</Hit_len>
-  <Hit_hsps>
-    <Hsp>
-      <Hsp_num>1</Hsp_num>
-      <Hsp_bit-score>89.6514</Hsp_bit-score>
-      <Hsp_score>98</Hsp_score>
-      <Hsp_evalue>6.62923e-23</Hsp_evalue>
-      <Hsp_query-from>1</Hsp_query-from>
-      <Hsp_query-to>74</Hsp_query-to>
-      <Hsp_hit-from>1516</Hsp_hit-from>
-      <Hsp_hit-to>1589</Hsp_hit-to>
-      <Hsp_query-frame>1</Hsp_query-frame>
-      <Hsp_hit-frame>1</Hsp_hit-frame>
-      <Hsp_identity>64</Hsp_identity>
-      <Hsp_positive>64</Hsp_positive>
-      <Hsp_gaps>0</Hsp_gaps>
-      <Hsp_align-len>74</Hsp_align-len>
-      <Hsp_qseq>GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTGTTCGCAGTCCAGAA</Hsp_qseq>
-      <Hsp_hseq>GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA</Hsp_hseq>
-      <Hsp_midline>||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | ||||| ||||||||</Hsp_midline>
-    </Hsp>
-  </Hit_hsps>
-</Hit>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>11</Statistics_hsp-len>
-      <Statistics_eff-space>64449</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>56</Iteration_iter-num>
-  <Iteration_query-ID>Query_7</Iteration_query-ID>
-  <Iteration_query-def>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>74</Iteration_query-len>
-<Iteration_hits>
-<Hit>
-  <Hit_num>1</Hit_num>
-  <Hit_id>Subject_8</Hit_id>
-  <Hit_def>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</Hit_def>
-  <Hit_accession>Subject_8</Hit_accession>
-  <Hit_len>4983</Hit_len>
-  <Hit_hsps>
-    <Hsp>
-      <Hsp_num>1</Hsp_num>
-      <Hsp_bit-score>89.6514</Hsp_bit-score>
-      <Hsp_score>98</Hsp_score>
-      <Hsp_evalue>6.62923e-23</Hsp_evalue>
-      <Hsp_query-from>1</Hsp_query-from>
-      <Hsp_query-to>74</Hsp_query-to>
-      <Hsp_hit-from>2319</Hsp_hit-from>
-      <Hsp_hit-to>2392</Hsp_hit-to>
-      <Hsp_query-frame>1</Hsp_query-frame>
-      <Hsp_hit-frame>1</Hsp_hit-frame>
-      <Hsp_identity>64</Hsp_identity>
-      <Hsp_positive>64</Hsp_positive>
-      <Hsp_gaps>0</Hsp_gaps>
-      <Hsp_align-len>74</Hsp_align-len>
-      <Hsp_qseq>GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTGTTCGCAGTCCAGAA</Hsp_qseq>
-      <Hsp_hseq>GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA</Hsp_hseq>
-      <Hsp_midline>||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | ||||| ||||||||</Hsp_midline>
-    </Hsp>
-  </Hit_hsps>
-</Hit>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>0</Statistics_db-num>
-      <Statistics_db-len>0</Statistics_db-len>
-      <Statistics_hsp-len>11</Statistics_hsp-len>
-      <Statistics_eff-space>64449</Statistics_eff-space>
-      <Statistics_kappa>0.41</Statistics_kappa>
-      <Statistics_lambda>0.625</Statistics_lambda>
-      <Statistics_entropy>0.78</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-</Iteration>
-</BlastOutput_iterations>
-</BlastOutput>
-
--- a/test-data/Galaxy8-[blastn-short_EUginius_primers_probes.fasta_vs__EUginius_].blastxml	Thu May 15 16:59:18 2014 +0200
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,412 +0,0 @@
-<?xml version="1.0"?>
-<!DOCTYPE BlastOutput PUBLIC "-//NCBI//NCBI BlastOutput/EN" "http://www.ncbi.nlm.nih.gov/dtd/NCBI_BlastOutput.dtd">
-<BlastOutput>
-  <BlastOutput_program>blastn</BlastOutput_program>
-  <BlastOutput_version>BLASTN 2.2.29+</BlastOutput_version>
-  <BlastOutput_reference>Stephen F. Altschul, Thomas L. Madden, Alejandro A. Sch&amp;auml;ffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), &quot;Gapped BLAST and PSI-BLAST: a new generation of protein database search programs&quot;, Nucleic Acids Res. 25:3389-3402.</BlastOutput_reference>
-  <BlastOutput_db>/opt/galaxy/blastdbs/EUginius_plasmid_insert</BlastOutput_db>
-  <BlastOutput_query-ID>Query_1</BlastOutput_query-ID>
-  <BlastOutput_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</BlastOutput_query-def>
-  <BlastOutput_query-len>20</BlastOutput_query-len>
-  <BlastOutput_param>
-    <Parameters>
-      <Parameters_expect>0.001</Parameters_expect>
-      <Parameters_sc-match>1</Parameters_sc-match>
-      <Parameters_sc-mismatch>-3</Parameters_sc-mismatch>
-      <Parameters_gap-open>5</Parameters_gap-open>
-      <Parameters_gap-extend>2</Parameters_gap-extend>
-      <Parameters_filter>L;m;</Parameters_filter>
-    </Parameters>
-  </BlastOutput_param>
-<BlastOutput_iterations>
-<Iteration>
-  <Iteration_iter-num>1</Iteration_iter-num>
-  <Iteration_query-ID>Query_1</Iteration_query-ID>
-  <Iteration_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-<Hit>
-  <Hit_num>1</Hit_num>
-  <Hit_id>gnl|BL_ORD_ID|5</Hit_id>
-  <Hit_def>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</Hit_def>
-  <Hit_accession>5</Hit_accession>
-  <Hit_len>2457</Hit_len>
-  <Hit_hsps>
-    <Hsp>
-      <Hsp_num>1</Hsp_num>
-      <Hsp_bit-score>40.14</Hsp_bit-score>
-      <Hsp_score>20</Hsp_score>
-      <Hsp_evalue>1.51296e-07</Hsp_evalue>
-      <Hsp_query-from>1</Hsp_query-from>
-      <Hsp_query-to>20</Hsp_query-to>
-      <Hsp_hit-from>2119</Hsp_hit-from>
-      <Hsp_hit-to>2138</Hsp_hit-to>
-      <Hsp_query-frame>1</Hsp_query-frame>
-      <Hsp_hit-frame>1</Hsp_hit-frame>
-      <Hsp_identity>20</Hsp_identity>
-      <Hsp_positive>20</Hsp_positive>
-      <Hsp_gaps>0</Hsp_gaps>
-      <Hsp_align-len>20</Hsp_align-len>
-      <Hsp_qseq>AGCGCGCAAACTAGGATAAA</Hsp_qseq>
-      <Hsp_hseq>AGCGCGCAAACTAGGATAAA</Hsp_hseq>
-      <Hsp_midline>||||||||||||||||||||</Hsp_midline>
-    </Hsp>
-  </Hit_hsps>
-</Hit>
-<Hit>
-  <Hit_num>2</Hit_num>
-  <Hit_id>gnl|BL_ORD_ID|2</Hit_id>
-  <Hit_def>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</Hit_def>
-  <Hit_accession>2</Hit_accession>
-  <Hit_len>323</Hit_len>
-  <Hit_hsps>
-    <Hsp>
-      <Hsp_num>1</Hsp_num>
-      <Hsp_bit-score>40.14</Hsp_bit-score>
-      <Hsp_score>20</Hsp_score>
-      <Hsp_evalue>1.51296e-07</Hsp_evalue>
-      <Hsp_query-from>1</Hsp_query-from>
-      <Hsp_query-to>20</Hsp_query-to>
-      <Hsp_hit-from>200</Hsp_hit-from>
-      <Hsp_hit-to>219</Hsp_hit-to>
-      <Hsp_query-frame>1</Hsp_query-frame>
-      <Hsp_hit-frame>1</Hsp_hit-frame>
-      <Hsp_identity>20</Hsp_identity>
-      <Hsp_positive>20</Hsp_positive>
-      <Hsp_gaps>0</Hsp_gaps>
-      <Hsp_align-len>20</Hsp_align-len>
-      <Hsp_qseq>AGCGCGCAAACTAGGATAAA</Hsp_qseq>
-      <Hsp_hseq>AGCGCGCAAACTAGGATAAA</Hsp_hseq>
-      <Hsp_midline>||||||||||||||||||||</Hsp_midline>
-    </Hsp>
-  </Hit_hsps>
-</Hit>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>8</Statistics_db-num>
-      <Statistics_db-len>15339</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>183300</Statistics_eff-space>
-      <Statistics_kappa>0.710602795216363</Statistics_kappa>
-      <Statistics_lambda>1.37406312246009</Statistics_lambda>
-      <Statistics_entropy>1.30724660390929</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>2</Iteration_iter-num>
-  <Iteration_query-ID>Query_2</Iteration_query-ID>
-  <Iteration_query-def>Reverse_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>8</Statistics_db-num>
-      <Statistics_db-len>15339</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>183300</Statistics_eff-space>
-      <Statistics_kappa>0.710602795216363</Statistics_kappa>
-      <Statistics_lambda>1.37406312246009</Statistics_lambda>
-      <Statistics_entropy>1.30724660390929</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>3</Iteration_iter-num>
-  <Iteration_query-ID>Query_3</Iteration_query-ID>
-  <Iteration_query-def>Probe|NOST-Spec_(Genetic_ID)</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-<Hit>
-  <Hit_num>1</Hit_num>
-  <Hit_id>gnl|BL_ORD_ID|5</Hit_id>
-  <Hit_def>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</Hit_def>
-  <Hit_accession>5</Hit_accession>
-  <Hit_len>2457</Hit_len>
-  <Hit_hsps>
-    <Hsp>
-      <Hsp_num>1</Hsp_num>
-      <Hsp_bit-score>40.14</Hsp_bit-score>
-      <Hsp_score>20</Hsp_score>
-      <Hsp_evalue>1.51296e-07</Hsp_evalue>
-      <Hsp_query-from>1</Hsp_query-from>
-      <Hsp_query-to>20</Hsp_query-to>
-      <Hsp_hit-from>2143</Hsp_hit-from>
-      <Hsp_hit-to>2162</Hsp_hit-to>
-      <Hsp_query-frame>1</Hsp_query-frame>
-      <Hsp_hit-frame>1</Hsp_hit-frame>
-      <Hsp_identity>20</Hsp_identity>
-      <Hsp_positive>20</Hsp_positive>
-      <Hsp_gaps>0</Hsp_gaps>
-      <Hsp_align-len>20</Hsp_align-len>
-      <Hsp_qseq>CGCGCGCGGTGTCATCTATG</Hsp_qseq>
-      <Hsp_hseq>CGCGCGCGGTGTCATCTATG</Hsp_hseq>
-      <Hsp_midline>||||||||||||||||||||</Hsp_midline>
-    </Hsp>
-  </Hit_hsps>
-</Hit>
-<Hit>
-  <Hit_num>2</Hit_num>
-  <Hit_id>gnl|BL_ORD_ID|2</Hit_id>
-  <Hit_def>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</Hit_def>
-  <Hit_accession>2</Hit_accession>
-  <Hit_len>323</Hit_len>
-  <Hit_hsps>
-    <Hsp>
-      <Hsp_num>1</Hsp_num>
-      <Hsp_bit-score>40.14</Hsp_bit-score>
-      <Hsp_score>20</Hsp_score>
-      <Hsp_evalue>1.51296e-07</Hsp_evalue>
-      <Hsp_query-from>1</Hsp_query-from>
-      <Hsp_query-to>20</Hsp_query-to>
-      <Hsp_hit-from>224</Hsp_hit-from>
-      <Hsp_hit-to>243</Hsp_hit-to>
-      <Hsp_query-frame>1</Hsp_query-frame>
-      <Hsp_hit-frame>1</Hsp_hit-frame>
-      <Hsp_identity>20</Hsp_identity>
-      <Hsp_positive>20</Hsp_positive>
-      <Hsp_gaps>0</Hsp_gaps>
-      <Hsp_align-len>20</Hsp_align-len>
-      <Hsp_qseq>CGCGCGCGGTGTCATCTATG</Hsp_qseq>
-      <Hsp_hseq>CGCGCGCGGTGTCATCTATG</Hsp_hseq>
-      <Hsp_midline>||||||||||||||||||||</Hsp_midline>
-    </Hsp>
-  </Hit_hsps>
-</Hit>
-<Hit>
-  <Hit_num>3</Hit_num>
-  <Hit_id>gnl|BL_ORD_ID|1</Hit_id>
-  <Hit_def>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3&apos;UTR/plant_junction_region.|-9105899556052450000</Hit_def>
-  <Hit_accession>1</Hit_accession>
-  <Hit_len>1045</Hit_len>
-  <Hit_hsps>
-    <Hsp>
-      <Hsp_num>1</Hsp_num>
-      <Hsp_bit-score>34.1929</Hsp_bit-score>
-      <Hsp_score>17</Hsp_score>
-      <Hsp_evalue>9.33411e-06</Hsp_evalue>
-      <Hsp_query-from>4</Hsp_query-from>
-      <Hsp_query-to>20</Hsp_query-to>
-      <Hsp_hit-from>2</Hsp_hit-from>
-      <Hsp_hit-to>18</Hsp_hit-to>
-      <Hsp_query-frame>1</Hsp_query-frame>
-      <Hsp_hit-frame>1</Hsp_hit-frame>
-      <Hsp_identity>17</Hsp_identity>
-      <Hsp_positive>17</Hsp_positive>
-      <Hsp_gaps>0</Hsp_gaps>
-      <Hsp_align-len>17</Hsp_align-len>
-      <Hsp_qseq>GCGCGGTGTCATCTATG</Hsp_qseq>
-      <Hsp_hseq>GCGCGGTGTCATCTATG</Hsp_hseq>
-      <Hsp_midline>|||||||||||||||||</Hsp_midline>
-    </Hsp>
-  </Hit_hsps>
-</Hit>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>8</Statistics_db-num>
-      <Statistics_db-len>15339</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>183300</Statistics_eff-space>
-      <Statistics_kappa>0.710602795216363</Statistics_kappa>
-      <Statistics_lambda>1.37406312246009</Statistics_lambda>
-      <Statistics_entropy>1.30724660390929</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>4</Iteration_iter-num>
-  <Iteration_query-ID>Query_4</Iteration_query-ID>
-  <Iteration_query-def>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>24</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>8</Statistics_db-num>
-      <Statistics_db-len>15339</Statistics_db-len>
-      <Statistics_hsp-len>9</Statistics_hsp-len>
-      <Statistics_eff-space>229005</Statistics_eff-space>
-      <Statistics_kappa>0.710602795216363</Statistics_kappa>
-      <Statistics_lambda>1.37406312246009</Statistics_lambda>
-      <Statistics_entropy>1.30724660390929</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>5</Iteration_iter-num>
-  <Iteration_query-ID>Query_5</Iteration_query-ID>
-  <Iteration_query-def>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>20</Iteration_query-len>
-<Iteration_hits>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>8</Statistics_db-num>
-      <Statistics_db-len>15339</Statistics_db-len>
-      <Statistics_hsp-len>8</Statistics_hsp-len>
-      <Statistics_eff-space>183300</Statistics_eff-space>
-      <Statistics_kappa>0.710602795216363</Statistics_kappa>
-      <Statistics_lambda>1.37406312246009</Statistics_lambda>
-      <Statistics_entropy>1.30724660390929</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-  <Iteration_message>No hits found</Iteration_message>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>6</Iteration_iter-num>
-  <Iteration_query-ID>Query_6</Iteration_query-ID>
-  <Iteration_query-def>Probe|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>25</Iteration_query-len>
-<Iteration_hits>
-<Hit>
-  <Hit_num>1</Hit_num>
-  <Hit_id>gnl|BL_ORD_ID|7</Hit_id>
-  <Hit_def>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</Hit_def>
-  <Hit_accession>7</Hit_accession>
-  <Hit_len>4983</Hit_len>
-  <Hit_hsps>
-    <Hsp>
-      <Hsp_num>1</Hsp_num>
-      <Hsp_bit-score>36.1753</Hsp_bit-score>
-      <Hsp_score>18</Hsp_score>
-      <Hsp_evalue>3.14801e-06</Hsp_evalue>
-      <Hsp_query-from>1</Hsp_query-from>
-      <Hsp_query-to>22</Hsp_query-to>
-      <Hsp_hit-from>2344</Hsp_hit-from>
-      <Hsp_hit-to>2365</Hsp_hit-to>
-      <Hsp_query-frame>1</Hsp_query-frame>
-      <Hsp_hit-frame>1</Hsp_hit-frame>
-      <Hsp_identity>21</Hsp_identity>
-      <Hsp_positive>21</Hsp_positive>
-      <Hsp_gaps>0</Hsp_gaps>
-      <Hsp_align-len>22</Hsp_align-len>
-      <Hsp_qseq>ACATGAACAGCGCCTTGACCAC</Hsp_qseq>
-      <Hsp_hseq>ACATGAACAGCGCCCTGACCAC</Hsp_hseq>
-      <Hsp_midline>|||||||||||||| |||||||</Hsp_midline>
-    </Hsp>
-  </Hit_hsps>
-</Hit>
-<Hit>
-  <Hit_num>2</Hit_num>
-  <Hit_id>gnl|BL_ORD_ID|6</Hit_id>
-  <Hit_def>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</Hit_def>
-  <Hit_accession>6</Hit_accession>
-  <Hit_len>4180</Hit_len>
-  <Hit_hsps>
-    <Hsp>
-      <Hsp_num>1</Hsp_num>
-      <Hsp_bit-score>36.1753</Hsp_bit-score>
-      <Hsp_score>18</Hsp_score>
-      <Hsp_evalue>3.14801e-06</Hsp_evalue>
-      <Hsp_query-from>1</Hsp_query-from>
-      <Hsp_query-to>22</Hsp_query-to>
-      <Hsp_hit-from>1541</Hsp_hit-from>
-      <Hsp_hit-to>1562</Hsp_hit-to>
-      <Hsp_query-frame>1</Hsp_query-frame>
-      <Hsp_hit-frame>1</Hsp_hit-frame>
-      <Hsp_identity>21</Hsp_identity>
-      <Hsp_positive>21</Hsp_positive>
-      <Hsp_gaps>0</Hsp_gaps>
-      <Hsp_align-len>22</Hsp_align-len>
-      <Hsp_qseq>ACATGAACAGCGCCTTGACCAC</Hsp_qseq>
-      <Hsp_hseq>ACATGAACAGCGCCCTGACCAC</Hsp_hseq>
-      <Hsp_midline>|||||||||||||| |||||||</Hsp_midline>
-    </Hsp>
-  </Hit_hsps>
-</Hit>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>8</Statistics_db-num>
-      <Statistics_db-len>15339</Statistics_db-len>
-      <Statistics_hsp-len>9</Statistics_hsp-len>
-      <Statistics_eff-space>244272</Statistics_eff-space>
-      <Statistics_kappa>0.710602795216363</Statistics_kappa>
-      <Statistics_lambda>1.37406312246009</Statistics_lambda>
-      <Statistics_entropy>1.30724660390929</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-</Iteration>
-<Iteration>
-  <Iteration_iter-num>7</Iteration_iter-num>
-  <Iteration_query-ID>Query_7</Iteration_query-ID>
-  <Iteration_query-def>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
-  <Iteration_query-len>74</Iteration_query-len>
-<Iteration_hits>
-<Hit>
-  <Hit_num>1</Hit_num>
-  <Hit_id>gnl|BL_ORD_ID|7</Hit_id>
-  <Hit_def>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</Hit_def>
-  <Hit_accession>7</Hit_accession>
-  <Hit_len>4983</Hit_len>
-  <Hit_hsps>
-    <Hsp>
-      <Hsp_num>1</Hsp_num>
-      <Hsp_bit-score>67.8929</Hsp_bit-score>
-      <Hsp_score>34</Hsp_score>
-      <Hsp_evalue>3.56369e-15</Hsp_evalue>
-      <Hsp_query-from>1</Hsp_query-from>
-      <Hsp_query-to>74</Hsp_query-to>
-      <Hsp_hit-from>2319</Hsp_hit-from>
-      <Hsp_hit-to>2392</Hsp_hit-to>
-      <Hsp_query-frame>1</Hsp_query-frame>
-      <Hsp_hit-frame>1</Hsp_hit-frame>
-      <Hsp_identity>64</Hsp_identity>
-      <Hsp_positive>64</Hsp_positive>
-      <Hsp_gaps>0</Hsp_gaps>
-      <Hsp_align-len>74</Hsp_align-len>
-      <Hsp_qseq>GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTGTTCGCAGTCCAGAA</Hsp_qseq>
-      <Hsp_hseq>GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA</Hsp_hseq>
-      <Hsp_midline>||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | ||||| ||||||||</Hsp_midline>
-    </Hsp>
-  </Hit_hsps>
-</Hit>
-<Hit>
-  <Hit_num>2</Hit_num>
-  <Hit_id>gnl|BL_ORD_ID|6</Hit_id>
-  <Hit_def>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</Hit_def>
-  <Hit_accession>6</Hit_accession>
-  <Hit_len>4180</Hit_len>
-  <Hit_hsps>
-    <Hsp>
-      <Hsp_num>1</Hsp_num>
-      <Hsp_bit-score>67.8929</Hsp_bit-score>
-      <Hsp_score>34</Hsp_score>
-      <Hsp_evalue>3.56369e-15</Hsp_evalue>
-      <Hsp_query-from>1</Hsp_query-from>
-      <Hsp_query-to>74</Hsp_query-to>
-      <Hsp_hit-from>1516</Hsp_hit-from>
-      <Hsp_hit-to>1589</Hsp_hit-to>
-      <Hsp_query-frame>1</Hsp_query-frame>
-      <Hsp_hit-frame>1</Hsp_hit-frame>
-      <Hsp_identity>64</Hsp_identity>
-      <Hsp_positive>64</Hsp_positive>
-      <Hsp_gaps>0</Hsp_gaps>
-      <Hsp_align-len>74</Hsp_align-len>
-      <Hsp_qseq>GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTGTTCGCAGTCCAGAA</Hsp_qseq>
-      <Hsp_hseq>GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA</Hsp_hseq>
-      <Hsp_midline>||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | ||||| ||||||||</Hsp_midline>
-    </Hsp>
-  </Hit_hsps>
-</Hit>
-</Iteration_hits>
-  <Iteration_stat>
-    <Statistics>
-      <Statistics_db-num>8</Statistics_db-num>
-      <Statistics_db-len>15339</Statistics_db-len>
-      <Statistics_hsp-len>10</Statistics_hsp-len>
-      <Statistics_eff-space>976576</Statistics_eff-space>
-      <Statistics_kappa>0.710602795216363</Statistics_kappa>
-      <Statistics_lambda>1.37406312246009</Statistics_lambda>
-      <Statistics_entropy>1.30724660390929</Statistics_entropy>
-    </Statistics>
-  </Iteration_stat>
-</Iteration>
-</BlastOutput_iterations>
-</BlastOutput>
-
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/blast xml example1.html	Thu May 15 17:22:02 2014 +0200
@@ -0,0 +1,13220 @@
+<!DOCTYPE html>
+<html>
+  <head>
+    <meta charset="UTF-8">
+    <meta name=generator content="blast2html; see ...">
+    
+    <title>Blast output</title>
+    
+    <style>
+      body {
+      color: #333333;
+      font-family: Arial,Sans-Serif;
+      }
+
+      :link {
+      color: #336699;
+      }
+
+      .right {
+      float: right;
+      }
+
+      /* Galaxy with html sanitization enabled strips the header of this html page. If so, show the user a warning.*/
+      #strip_html_warning {
+      display: none;
+      }
+      
+      #content {
+      margin: 0 2em;
+      padding: 0.5em;
+      border: 1px solid #888888;
+      background-color: #d3dff5;
+      }
+
+      h1, h2, h3, h4, h5, h6 {
+      color: #2A6979;
+      font-family: arial,verdana,sans-serif;
+      letter-spacing: -1px;
+      margin: 1.2em 0 0.3em;
+      }
+
+      h1 {
+      border-bottom: 1px solid #CCCCCC;
+      font-size: 150%;
+      padding-bottom: 0.1em;
+      }
+
+      h2 {
+      font-size: 120%;
+      font-weight: bold;
+      }
+
+      h4.darkHeader {
+      color: #4D4D4D;
+      letter-spacing: 0;
+      font-weight: bold;
+      }
+
+      #nodata {
+      font-weight: bold;
+      }
+
+      .index {
+      margin-bottom: 3em;
+      }
+      .index div.indexentry {
+      margin: 1.2em 1.6em;
+      font-weight: bold;
+      font-size: 100%;
+      }
+      
+      .headerdata {
+      font-size: 90%;
+      }
+      .headerdata .param {
+      font-weight: bold;
+      text-align: right;
+      padding: 0 1em;
+      }
+
+      .grey {
+      background-color: #eeeeee;
+      border: 1px solid #cccccc;
+      padding: 1em;
+      }
+
+      .white {
+      background-color: white;
+      border: 1px solid #cccccc;
+      padding: 1.5em 2%;
+      }
+
+      .graphicrow {
+      clear: left;
+      width: 100%;
+      }
+
+      .graphicitem {
+      float: left;
+      }
+
+
+      
+      .graphics .grey {
+      text-align: center;
+      }
+
+      .graphic {
+      background-color: white;
+      border: 2px solid black;
+      padding: 1.5em;
+      margin: auto;
+      }
+
+      .centered, .defline, div.legend, div.tablewrapper {
+      margin-left: auto;
+      margin-right: auto;
+      }
+
+      .defline {
+      background-color: white;
+      border: 1px solid black;
+      margin: .5em auto;
+      padding-left: .2em;
+      padding-right: .2em;
+      max-width: 50em;
+      text-align: left;
+      height: 2.8em;
+      overflow-y: hidden;
+      }
+
+      div.legend {
+      max-width: 40em;
+      }
+      div.legend div {
+      width: 100%;
+      color: white;
+      font-weight: bold;
+      border-spacing: 0;
+      }
+      div.legend div .graphicitem {
+      width: 20%;
+      padding: 0;
+      margin: 0;
+      border: none;
+      }
+
+      div.tablewrapper {
+      width: 50%;
+      min-width: 60em;
+      }
+
+      /* For small widths we give the graphic 100% */
+      @media (max-width: 72.5em) {
+      div.tablewrapper {
+      width: 100%;
+      min-width: 0px;
+      }
+      }
+
+      .scale {
+      width: 100%;
+      margin: .5em 0;
+      font-weight: bold;
+      }
+      .scale div {
+      color: red;
+      text-align: left;
+      }
+      .scale .graphicrow {
+      margin: .5em 0 .5em 0;
+      color: white;
+      }
+      .scale .graphicitem {
+      position: relative;
+      }
+      .scale .graphicitem div {
+      margin: 0 1px;
+      padding: 0 2px;
+      text-align: right;
+      background-color: red;
+      color: white;
+      }
+      .scale .graphicitem:first-child div {
+      margin-left: 0px;
+      }
+      .scale .graphicitem:last-child div {
+      margin-right: 0px;
+      }
+      .scale .graphicitem .lastlabel {
+      position: absolute;
+      top: 0px;
+      left: 100%;
+      background-color: transparent;
+      color: red;
+      }
+
+      a.matchresult {
+      display: block;
+      margin: 0;
+      padding: 0;
+      }
+      div.matchrow {
+      margin-top: 4px;
+      }
+      div.matchrow, div.matchitem {
+      height: 4px;
+      }
+
+      
+      table.descriptiontable {
+      font-size: 85%;
+      border: 1px solid #97b0c8;
+      border-spacing: 0;
+      color: #222222;
+      line-height: 1.3em;
+      background-color: white;
+      }
+      table.descriptiontable col:first-child {
+      width: 100%;
+      }
+      table.descriptiontable tr:hover {
+      background-color: #D5DEE3;
+      }
+      table.descriptiontable th {
+      color: #14376C;
+      font-weight: normal;
+      background-color: #F0F0F0;
+      background: linear-gradient(#FFFFFF, #F0F0F0);
+      border-bottom: 1px solid #D4DFE9;
+      border-right: 1px solid #CFCFCF;
+      border-left: 0px solid black;
+      border-top: 0px solid black;
+      }
+      table.descriptiontable td {
+      overflow: hidden;
+      text-align: center;
+      padding: .4em .8em;
+      }
+      table.descriptiontable td div {
+      width: 1em;
+      overflow: visible;
+      white-space: nowrap;
+      text-align: left;
+      }
+
+
+      
+      .alignments .white {
+      padding: 1.5em 1em;
+      }
+      
+      .alignment {
+      border-top: 1px solid black;
+      padding-left: 1em;
+      padding-right: 1em;
+      }
+      
+      div.linkheader {
+      padding-top: .2em;
+      font-size: 85%;
+      color: #14376C;
+      }
+      div.linkheader a.linkheader {
+      margin-right: 1em;
+      }
+      div.linkheader .right a {
+      text-decoration: none;
+      }
+
+      .title .hittitle {
+      color: #222222;
+      margin-bottom: .3em;
+      }
+      .title .titleinfo {
+      font-size: 80%;
+      margin-top: 0;
+      margin-bottom: .3em;
+      }
+      .title .titleinfo .b {
+      color: #606060;
+      font-weight: bold;
+      font-size: 90%;
+      }
+
+      .moretitles {
+      margin: 1.2em;
+      }
+      .moretitles .titleinfo {
+      margin: 0;
+      padding: 0;
+      }
+      .moretitles .hittitle {
+      margin: .4em 0 .2em 0;
+      padding: 0;
+      }
+      
+      a.showmoretitles {
+      font-size: 75%;
+      color: #336699;
+      font-weight: bold;
+      margin-top: 0;
+      }
+      a.showmoretitles:hover {
+      }
+
+      .hotspot {
+      color: #606060;
+      font-family: verdana, arial, sans-serif;
+      margin-bottom: 2.5em;
+      }
+
+      .hotspot p.range {
+      font-size: 70%;
+      margin-top: 0;
+      margin-top: 1em;
+      margin-bottom: .2em;
+      }
+      .hotspot p.range span.range {
+      font-weight: bold;
+      }
+      .hotspot p.range a.range {
+      margin-left: .5em;
+      }
+
+      table.hotspotstable {
+      border-top: 1px solid;
+      border-bottom: 1px solid;
+      text-align: left;
+      border-collapse: collapse;
+      }
+      table.hotspotstable th, table.hotspotstable td {
+      padding: .1em 1em;
+      }
+      table.hotspotstable th {
+      font-size: 70%;
+      }
+      table.hotspotstable td {
+      min-width: 7em;
+      color: #222222;
+      font-size: 80%;
+      }
+
+      pre.alignmentgraphic {
+      color: #222222;
+      }
+
+      footer {
+      text-align: center;
+      color: #cccccc;
+      font-size: 70%;
+      margin-top: 1em;
+      }
+      footer :link {
+      color: #5588cc;
+      }
+      
+    </style>
+
+    <script type="text/javascript">
+      function toggle_visibility(id) {
+          var e = document.getElementById(id);
+          if(e.style.display != 'block')
+              e.style.display = 'block';
+          else
+              e.style.display = 'none';
+      }
+    </script>
+
+  </head>
+
+  
+  <body>
+    
+    <div id="strip_html_warning">
+      <!-- This div should be hidden by the header css block. Galaxy
+      strips all css, breaking this page but making this warning
+      visible. This warning contains some ugly old skool tabular html
+      layout that is not stripped. -->
+      <table bgcolor="#FFE5C9"><tr><td><font color="red"><b>
+                <font size=5><center>This html page seems to have been stripped by Galaxy.</center></font>
+                Disable Galaxy's html sanitization feature to view the full page (see <font face=monospace>sanitize_all_html</font> in your galaxy's universe_wsgi.ini), or download this page instead of viewing it in Galaxy.
+      </b></font></td></tr></table>
+    </div>
+    
+    <div id=content>
+
+
+
+      
+      <section class=match id=match1>
+      
+        <h1>Nucleotide Sequence (16 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>106397</td></tr>
+            <tr><td class=param>Query definition:</td><td>No definition line</td></tr>
+            <tr><td class=param>Query length:</td><td>16</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td>pdb</td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h2>Graphic Summary</h2>
+
+          <div class=grey>
+            <h3 class=centered>Distribution of 1 Blast Hits on the Query Sequence</h3>
+
+            <div class=defline id=defline1>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">200≤</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 12.5%">
+                        <div>2</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.5%">
+                        <div>4</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.5%">
+                        <div>6</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.5%">
+                        <div>8</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.5%">
+                        <div>10</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.5%">
+                        <div>12</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.5%">
+                        <div>14</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.5%">
+                        <div>16</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit1"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, E. Coli 70s-fmetval-trnaval Post-translocation Complex (post4, 50s Subunit)"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, E. Coli 70s-fmetval-trnaval Post-translocation Complex (post4, 50s Subunit)">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit2"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Post- Translocation State (post3b, 50s Subunit)"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Post- Translocation State (post3b, 50s Subunit)">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit3"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Post- Translocation State (post3a, 50s Subunit)"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Post- Translocation State (post3a, 50s Subunit)">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit4"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Post- Translocation State (post2b, 50s Subunit)"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Post- Translocation State (post2b, 50s Subunit)">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit5"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Post- Translocation State (post2a, 50s Subunit)"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Post- Translocation State (post2a, 50s Subunit)">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit6"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Classic Post- Translocation State (post1, 50s Subunit)"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Classic Post- Translocation State (post1, 50s Subunit)">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit7"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Hybrid Pre- Translocation State (pre5b, 50s Subunit)"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Hybrid Pre- Translocation State (pre5b, 50s Subunit)">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit8"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Hybrid Pre- Translocation State (pre5a, 50s Subunit)"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Hybrid Pre- Translocation State (pre5a, 50s Subunit)">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit9"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Hybrid Pre- Translocation State (pre4, 50s Subunit)"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Hybrid Pre- Translocation State (pre4, 50s Subunit)">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit10"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Classic Pre- Translocation State (pre1a, 50s Subunit)"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Classic Pre- Translocation State (pre1a, 50s Subunit)">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit11"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Pre- Translocation State (pre3, 50s Subunit)"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Pre- Translocation State (pre3, 50s Subunit)">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit12"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Pre- Translocation State (pre2, 50s Subunit)"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Pre- Translocation State (pre2, 50s Subunit)">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit13"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Classic Pre- Translocation State (pre1b, 50s Subunit)"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Classic Pre- Translocation State (pre1b, 50s Subunit)">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit14"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, Tetracycline Resistance Protein Tet(o) Bound To The Ribosome"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, Tetracycline Resistance Protein Tet(o) Bound To The Ribosome">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit15"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain B, Structural Insights Into Cognate Vs. Near-Cognate Discrimination During Decoding. This Entry Contains The Large Subunit Of A Ribosome Programmed With A Near-Cognate Codon. "'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain B, Structural Insights Into Cognate Vs. Near-Cognate Discrimination During Decoding. This Entry Contains The Large Subunit Of A Ribosome Programmed With A Near-Cognate Codon. ">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit16"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain B, Ternary Complex-Bound E.Coli 70s Ribosome. This Entry Consists Of The 50s Subunit. "'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain B, Ternary Complex-Bound E.Coli 70s Ribosome. This Entry Consists Of The 50s Subunit. ">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit17"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain B, Structure Of The 50s Subunit Of E. Coli Ribosome In Pre-Accommodation State "'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain B, Structure Of The 50s Subunit Of E. Coli Ribosome In Pre-Accommodation State ">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit18"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, Structure Of The 50s Subunit Of A Secm-Stalled E. Coli Ribosome Complex Obtained By Fitting Atomic Models For Rna And Protein Components Into Cryo-Em Map Emd-1143"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, Structure Of The 50s Subunit Of A Secm-Stalled E. Coli Ribosome Complex Obtained By Fitting Atomic Models For Rna And Protein Components Into Cryo-Em Map Emd-1143">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit19"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, Structure Of The 50s Subunit Of A Pre-Translocational E. Coli Ribosome Obtained By Fitting Atomic Models For Rna And Protein Components Into Cryo-Em Map Emd-1056"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, Structure Of The 50s Subunit Of A Pre-Translocational E. Coli Ribosome Obtained By Fitting Atomic Models For Rna And Protein Components Into Cryo-Em Map Emd-1056">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit20"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain B, Crystal Structure Of Ribosome With Messenger Rna And The Anticodon Stem-Loop Of P-Site Trna. This File Contains The 50s Subunit Of One 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400."'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain B, Crystal Structure Of Ribosome With Messenger Rna And The Anticodon Stem-Loop Of P-Site Trna. This File Contains The 50s Subunit Of One 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400.">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit21"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli At 3.5 A Resolution. This File Contains The 50s Subunit Of One 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. "'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli At 3.5 A Resolution. This File Contains The 50s Subunit Of One 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. ">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit22"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli At 3.5 A Resolution. This File Contains The 50s Subunit Of The Second 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. "'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli At 3.5 A Resolution. This File Contains The 50s Subunit Of The Second 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. ">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit23"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With The Antibiotic Kasugamyin At 3.5a Resolution. This File Contains The 50s Subunit Of One 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. "'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With The Antibiotic Kasugamyin At 3.5a Resolution. This File Contains The 50s Subunit Of One 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. ">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit24"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, Real Space Refined Coordinates Of The 50s Subunit Fitted Into The Low Resolution Cryo-Em Map Of The Ef-G.Gtp State Of E. Coli 70s Ribosome "'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, Real Space Refined Coordinates Of The 50s Subunit Fitted Into The Low Resolution Cryo-Em Map Of The Ef-G.Gtp State Of E. Coli 70s Ribosome ">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit25"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain B, 23s Rrna Structure Fitted To A Cryo-Electron Microscopic Map At 7.5 Angstroms Resolution"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain B, 23s Rrna Structure Fitted To A Cryo-Electron Microscopic Map At 7.5 Angstroms Resolution">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 81.25%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit30"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 1, Structure Of The Methanococcus Jannaschii Ribosome-secyebeta Channel Complex (50s Ribosomal Subunit)"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 1, Structure Of The Methanococcus Jannaschii Ribosome-secyebeta Channel Complex (50s Ribosomal Subunit)">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 81.25%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit35"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 1, Promiscuous Behavior Of Proteins In Archaeal Ribosomes Revealed By Cryo-em: Implications For Evolution Of Eukaryotic Ribosomes (50s Ribosomal Rna)"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 1, Promiscuous Behavior Of Proteins In Archaeal Ribosomes Revealed By Cryo-em: Implications For Evolution Of Eukaryotic Ribosomes (50s Ribosomal Rna)">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 81.25%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit26"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain a, Model Of The Large Subunit Rna Based On A 5.5 A Cryo-em Map Of Triticum Aestivum Translating 80s Ribosome"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain a, Model Of The Large Subunit Rna Based On A 5.5 A Cryo-em Map Of Triticum Aestivum Translating 80s Ribosome">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 87.5%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit27"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, 39s Large Subunit Of The Porcine Mitochondrial Ribosome"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, 39s Large Subunit Of The Porcine Mitochondrial Ribosome">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 43.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 56.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit28"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 5, Cryo-em Reconstruction Of The 80s-eif5b-met-itrnamet Eukaryotic Translation Initiation Complex"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 5, Cryo-em Reconstruction Of The 80s-eif5b-met-itrnamet Eukaryotic Translation Initiation Complex">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 81.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit29"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 5, Cryo-em Reconstruction Of The 80s-eif5b-met-itrnamet Eukaryotic Translation Initiation Complex"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 5, Cryo-em Reconstruction Of The 80s-eif5b-met-itrnamet Eukaryotic Translation Initiation Complex">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 81.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit31"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, The Re-refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution: More Complete Structure Of The L7/l12 And L1 Stalk, L5 And Lx Proteins"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, The Re-refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution: More Complete Structure Of The L7/l12 And L1 Stalk, L5 And Lx Proteins">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 75.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit32"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 5, Structure Of The H. Sapiens 60s Rrna"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 5, Structure Of The H. Sapiens 60s Rrna">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit33"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 5, Structure Of The D. Melanogaster 60s Rrna"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 5, Structure Of The D. Melanogaster 60s Rrna">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit34"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain B, High_resolution Cryo-electron Microscopy Structure Of The Trypanosoma Brucei Ribosome"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain B, High_resolution Cryo-electron Microscopy Structure Of The Trypanosoma Brucei Ribosome">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 81.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit36"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, Crystal Structure Of Enhanced Macrolide Bound To 50s Ribosomal Subunit"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, Crystal Structure Of Enhanced Macrolide Bound To 50s Ribosomal Subunit">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 56.25%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit37"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, The Cryo-em Structure Of The Archaeal 50s Ribosomal Subunit In Complex With Initiation Factor 6"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, The Cryo-em Structure Of The Archaeal 50s Ribosomal Subunit In Complex With Initiation Factor 6">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 75.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit38"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 6, The Structure Of The Eukaryotic Ribosome At 3.0 A Resolution. This Entry Contains Ribosomal Rna And Ions Of The 40s Subunit, Ribosome B"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 6, The Structure Of The Eukaryotic Ribosome At 3.0 A Resolution. This Entry Contains Ribosomal Rna And Ions Of The 40s Subunit, Ribosome B">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 12.5%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 87.5%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit39"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 2, The Structure Of The Eukaryotic Ribosome At 3.0 A Resolution. This Entry Contains Ribosomal Rna And Ions Of The 40s Subunit, Ribosome A "'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 2, The Structure Of The Eukaryotic Ribosome At 3.0 A Resolution. This Entry Contains Ribosomal Rna And Ions Of The 40s Subunit, Ribosome A ">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 12.5%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 87.5%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit40"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 1, T.Thermophila 60s Ribosomal Subunit In Complex With Initiation Factor 6. This File Contains 26s Rrna And Proteins Of Molecule 4."'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 1, T.Thermophila 60s Ribosomal Subunit In Complex With Initiation Factor 6. This File Contains 26s Rrna And Proteins Of Molecule 4.">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 75.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit41"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 1, T.Thermophila 60s Ribosomal Subunit In Complex With Initiation Factor 6. This File Contains 26s Rrna And Proteins Of Molecule 1"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 1, T.Thermophila 60s Ribosomal Subunit In Complex With Initiation Factor 6. This File Contains 26s Rrna And Proteins Of Molecule 1">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 75.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit42"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 1, T.Thermophila 60s Ribosomal Subunit In Complex With Initiation Factor 6. This File Contains 26s Rrna And Proteins Of Molecule 3. "'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 1, T.Thermophila 60s Ribosomal Subunit In Complex With Initiation Factor 6. This File Contains 26s Rrna And Proteins Of Molecule 3. ">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 75.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit43"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 8, Core Of Mammalian 80s Pre-Ribosome In Complex With Trnas Fitted To A 9.8a Cryo-Em Map: Classic Pre State 1"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 8, Core Of Mammalian 80s Pre-Ribosome In Complex With Trnas Fitted To A 9.8a Cryo-Em Map: Classic Pre State 1">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 56.25%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit44"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 8, Core Of Mammalian 80s Pre-Ribosome In Complex With Trnas Fitted To A 9a Cryo-Em Map: Classic Pre State 2"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 8, Core Of Mammalian 80s Pre-Ribosome In Complex With Trnas Fitted To A 9a Cryo-Em Map: Classic Pre State 2">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 56.25%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit45"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 1, Yeast 80s Ribosome. This Entry Consists Of The 60s Subunit Of The First 80s In The Asymmetric Unit. "'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 1, Yeast 80s Ribosome. This Entry Consists Of The 60s Subunit Of The First 80s In The Asymmetric Unit. ">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 81.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit46"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 1, Yeast 80s Ribosome. This Entry Consists Of The 60s Subunit Of The Second 80s In The Asymmetric Unit. "'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 1, Yeast 80s Ribosome. This Entry Consists Of The 60s Subunit Of The Second 80s In The Asymmetric Unit. ">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 81.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit47"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 1, Yeast 80s Ribosome. This Entry Consists Of The 40s Subunit Of The First 80s In The Asymmetric Unit."'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 1, Yeast 80s Ribosome. This Entry Consists Of The 40s Subunit Of The First 80s In The Asymmetric Unit.">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 12.5%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 87.5%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit48"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 1, Yeast 80s Ribosome. This Entry Consists Of The 40s Subunit Of The Second 80s In The Asymmetric Unit."'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 1, Yeast 80s Ribosome. This Entry Consists Of The 40s Subunit Of The Second 80s In The Asymmetric Unit.">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 12.5%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 87.5%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit49"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, Model Of The Large Subunit Rna Based On A 6.1 A Cryo-Em Map Of Saccharomyces Cerevisiae Translating 80s Ribosome (With Es27l-In Conformation)"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, Model Of The Large Subunit Rna Based On A 6.1 A Cryo-Em Map Of Saccharomyces Cerevisiae Translating 80s Ribosome (With Es27l-In Conformation)">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 81.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit50"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, Model Of The Small Subunit Rna Based On A 6.1 A Cryo-Em Map Of Saccharomyces Cerevisiae Translating 80s Ribosome"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, Model Of The Small Subunit Rna Based On A 6.1 A Cryo-Em Map Of Saccharomyces Cerevisiae Translating 80s Ribosome">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 12.5%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 87.5%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit51"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain I, I-Msoi Re-Designed For Altered Dna Cleavage Specificity (-7c)"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain I, I-Msoi Re-Designed For Altered Dna Cleavage Specificity (-7c)">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 56.25%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit52"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain H, I-Msoi Re-Designed For Altered Dna Cleavage Specificity (-7c)"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain H, I-Msoi Re-Designed For Altered Dna Cleavage Specificity (-7c)">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 56.25%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit53"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain D, I-Msoi Re-Designed For Altered Dna Cleavage Specificity (-7c)"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain D, I-Msoi Re-Designed For Altered Dna Cleavage Specificity (-7c)">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 56.25%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit54"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain C, I-Msoi Re-Designed For Altered Dna Cleavage Specificity (-7c)"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain C, I-Msoi Re-Designed For Altered Dna Cleavage Specificity (-7c)">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 56.25%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit55"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, Co-Crystal Structure Of Triacetyloleandomcyin Bound To The Large Ribosomal Subunit"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, Co-Crystal Structure Of Triacetyloleandomcyin Bound To The Large Ribosomal Subunit">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 75.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit56"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 5, Structure Of The 60s Rrna For Eukaryotic Ribosome Based On Cryo-Em Map Of Thermomyces Lanuginosus Ribosome At 8.9a Resolution"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 5, Structure Of The 60s Rrna For Eukaryotic Ribosome Based On Cryo-Em Map Of Thermomyces Lanuginosus Ribosome At 8.9a Resolution">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 81.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit57"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, Structure Of The 40s Rrna And Proteins And PE TRNA FOR EUKARYOTIC Ribosome Based On Cryo-Em Map Of Thermomyces Lanuginosus Ribosome At 8.9a Resolution"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, Structure Of The 40s Rrna And Proteins And PE TRNA FOR EUKARYOTIC Ribosome Based On Cryo-Em Map Of Thermomyces Lanuginosus Ribosome At 8.9a Resolution">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 12.5%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 87.5%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit58"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 3, Structure Of The Ribosomal 80s-Eef2-Sordarin Complex From Yeast Obtained By Docking Atomic Models For Rna And Protein Components Into A 11.7 A Cryo-Em Map. This File, 1s1i, Contains 60s Subunit. The 40s Ribosomal Subunit Is In File 1s1h."'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 3, Structure Of The Ribosomal 80s-Eef2-Sordarin Complex From Yeast Obtained By Docking Atomic Models For Rna And Protein Components Into A 11.7 A Cryo-Em Map. This File, 1s1i, Contains 60s Subunit. The 40s Ribosomal Subunit Is In File 1s1h.">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 56.25%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit59"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, Negamycin Binds To The Wall Of The Nascent Chain Exit Tunnel Of The 50s Ribosomal Subunit"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, Negamycin Binds To The Wall Of The Nascent Chain Exit Tunnel Of The 50s Ribosomal Subunit">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 56.25%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit60"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, The Structure Of The Antibiotic Linezolid Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, The Structure Of The Antibiotic Linezolid Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 56.25%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit61"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation G2616a "'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation G2616a ">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 75.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit62"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation G2482c"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation G2482c">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 75.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit63"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation G2482a"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation G2482a">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 75.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit64"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation A2488c. Density For Anisomycin Is Visible But Not Included In The Model."'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation A2488c. Density For Anisomycin Is Visible But Not Included In The Model.">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 75.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit65"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation A2488u"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation A2488u">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 75.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit66"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation G2611u"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation G2611u">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 75.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit67"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation U2535c. Density For Anisomycin Is Visible But Not Included In Model."'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation U2535c. Density For Anisomycin Is Visible But Not Included In Model.">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 75.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit68"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation C2534u"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation C2534u">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 75.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit69"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation U2535a"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation U2535a">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 75.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit70"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation C2487u"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation C2487u">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 75.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit71"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, The Refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution With Rrna Sequence For The 23s Rrna And Genome-Derived Sequences For R-Proteins "'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, The Refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution With Rrna Sequence For The 23s Rrna And Genome-Derived Sequences For R-Proteins ">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 75.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit72"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, Structure Of A Mammalian Ribosomal 60s Subunit Within An 80s Complex Obtained By Docking Homology Models Of The Rna And Proteins Into An 8.7 A Cryo-Em Map"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, Structure Of A Mammalian Ribosomal 60s Subunit Within An 80s Complex Obtained By Docking Homology Models Of The Rna And Proteins Into An 8.7 A Cryo-Em Map">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 81.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit73"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, A More Complete Structure Of The The L7L12 STALK OF THE Haloarcula Marismortui 50s Large Ribosomal Subunit"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, A More Complete Structure Of The The L7L12 STALK OF THE Haloarcula Marismortui 50s Large Ribosomal Subunit">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 56.25%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit74"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain R, Structural Model For The Large Subunit Of The Mammalian Mitochondrial Ribosome"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain R, Structural Model For The Large Subunit Of The Mammalian Mitochondrial Ribosome">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 43.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 56.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit75"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, Refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution "'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, Refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution ">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 56.25%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit76"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, Crystal Structure Of Virginiamycin M And S Bound To The 50s Ribosomal Subunit Of Haloarcula Marismortui "'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, Crystal Structure Of Virginiamycin M And S Bound To The 50s Ribosomal Subunit Of Haloarcula Marismortui ">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 75.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit77"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, Crystal Structure Of Azithromycin Bound To The G2099a Mutant 50s Ribosomal Subunit Of Haloarcula Marismortui "'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, Crystal Structure Of Azithromycin Bound To The G2099a Mutant 50s Ribosomal Subunit Of Haloarcula Marismortui ">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 75.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit78"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, Crystal Structure Of Quinupristin Bound To The G2099a Mutant 50s Ribosomal Subunit Of Haloarcula Marismortui"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, Crystal Structure Of Quinupristin Bound To The G2099a Mutant 50s Ribosomal Subunit Of Haloarcula Marismortui">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 75.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit79"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, Crystal Structure Of Cca-Phe-Cap-Biotin Bound Simultaneously At Half Occupancy To Both The A-Site And P- Site Of The The 50s Ribosomal Subunit."'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, Crystal Structure Of Cca-Phe-Cap-Biotin Bound Simultaneously At Half Occupancy To Both The A-Site And P- Site Of The The 50s Ribosomal Subunit.">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 56.25%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit80"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, Fully Refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution "'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, Fully Refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution ">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 56.25%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit81"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, Co-Crystal Structure Of Blasticidin S Bound To The 50s Ribosomal Subunit"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, Co-Crystal Structure Of Blasticidin S Bound To The 50s Ribosomal Subunit">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 56.25%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit82"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 0, Crystal Structure Of The Large Ribosomal Subunit From Haloarcula Marismortui At 2.4 Angstrom Resolution"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 0, Crystal Structure Of The Large Ribosomal Subunit From Haloarcula Marismortui At 2.4 Angstrom Resolution">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 56.25%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit83"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, Large Ribosomal Subunit Complexed With A 13 Bp Minihelix- Puromycin Compound"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, Large Ribosomal Subunit Complexed With A 13 Bp Minihelix- Puromycin Compound">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 56.25%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit84"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, Large Ribosomal Subunit Complexed With R(Cc)-Da-Puromycin"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, Large Ribosomal Subunit Complexed With R(Cc)-Da-Puromycin">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 56.25%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit85"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain F, Crystal Structure Of The Catalytic Domain Of Rlub In Complex With A 21-nucleotide Rna Substrate"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain F, Crystal Structure Of The Catalytic Domain Of Rlub In Complex With A 21-nucleotide Rna Substrate">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 50.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit86"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain E, Crystal Structure Of The Catalytic Domain Of Rlub In Complex With A 21-nucleotide Rna Substrate"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain E, Crystal Structure Of The Catalytic Domain Of Rlub In Complex With A 21-nucleotide Rna Substrate">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 50.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit87"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, Thermus Thermophilus Ribosome"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, Thermus Thermophilus Ribosome">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 68.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit88"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, Crystal Structure Of Blasticidin S Bound To Thermus Thermophilus 70s Ribosome. This File Contains The 50s Subunit And Blasticidin S Molecule From The First 70s Ribosome. "'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, Crystal Structure Of Blasticidin S Bound To Thermus Thermophilus 70s Ribosome. This File Contains The 50s Subunit And Blasticidin S Molecule From The First 70s Ribosome. ">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 68.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit89"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, Crystal Structure Of The 70s Ribosome Bound With The Q253p Mutant Of Release Factor Rf2. 50s Of The A Subunit "'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, Crystal Structure Of The 70s Ribosome Bound With The Q253p Mutant Of Release Factor Rf2. 50s Of The A Subunit ">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 68.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit90"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, Crystal Structure Of Thermus Thermophilus 70s Containing Trnas And Mrna Stop Codon With Pseudouridine"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, Crystal Structure Of Thermus Thermophilus 70s Containing Trnas And Mrna Stop Codon With Pseudouridine">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 68.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit91"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, Crystal Structure Of Thermus Thermophilus 70s Containing Trnas And Mrna Stop Codon With Pseudouridine"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, Crystal Structure Of Thermus Thermophilus 70s Containing Trnas And Mrna Stop Codon With Pseudouridine">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 68.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit92"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, Atomic Model Of The Immature 50s Subunit From Bacillus Subtilis (state I-a)"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, Atomic Model Of The Immature 50s Subunit From Bacillus Subtilis (state I-a)">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 12.5%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 87.5%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit93"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, Atomic Model Of The Immature 50s Subunit From Bacillus Subtilis (state Ii-a)"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, Atomic Model Of The Immature 50s Subunit From Bacillus Subtilis (state Ii-a)">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 12.5%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 87.5%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit94"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, Crystal Structure Of The Bacterial Ribosome Ram Mutation G347u. This Entry Contains The 50s Ribosomal Subunit Of The Second 70s Molecule In The Asymmetric Unit"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, Crystal Structure Of The Bacterial Ribosome Ram Mutation G347u. This Entry Contains The 50s Ribosomal Subunit Of The Second 70s Molecule In The Asymmetric Unit">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 68.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit95"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, Crystal Structure Of The Bacterial Ribosome Ram Mutation G347u. This Entry Contains The 50s Ribosomal Subunit Of The First 70s Molecule In The Asymmetric Unit"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, Crystal Structure Of The Bacterial Ribosome Ram Mutation G347u. This Entry Contains The 50s Ribosomal Subunit Of The First 70s Molecule In The Asymmetric Unit">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 68.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit96"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain d, The Cryo-Em Structure Of A 3d Dna-Origami Object"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain d, The Cryo-Em Structure Of A 3d Dna-Origami Object">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 50.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit97"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, The Cryo-Em Structure Of A 3d Dna-Origami Object"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, The Cryo-Em Structure Of A 3d Dna-Origami Object">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 56.25%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit98"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain A, Structure Of The Thermus Thermophilus 70s Ribosome Complexed With Mrna, Trna And Paromomycin (Part 2 Of 4). This File Contains The 50s Subunit From Molecule I. "'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain A, Structure Of The Thermus Thermophilus 70s Ribosome Complexed With Mrna, Trna And Paromomycin (Part 2 Of 4). This File Contains The 50s Subunit From Molecule I. ">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 68.75%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 6.25%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit99"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain C, Crystal Structure Of I-Crei Complexed With Its Target Methylated At Position Plus 2 (In The B Strand) In The Presence Of Magnesium"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain C, Crystal Structure Of I-Crei Complexed With Its Target Methylated At Position Plus 2 (In The B Strand) In The Presence Of Magnesium">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 50.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit100"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain C, Crystal Structure Of I-Crei Complexed With Its Target Methylated At Position Plus 2 (In The B Strand) In The Presence Of Calcium"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain C, Crystal Structure Of I-Crei Complexed With Its Target Methylated At Position Plus 2 (In The B Strand) In The Presence Of Calcium">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 50.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 25.0%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h2>Descriptions</h2>
+
+          <div class=grey><div class=white>
+              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit1"
+                              title="Chain A, E. Coli 70s-fmetval-trnaval Post-translocation Complex (post4, 50s Subunit)"
+                              id="description1">
+                        Chain A, E. Coli 70s-fmetval-trnaval Post-translocation Complex (post4, 50s Subunit)
+                  </a></div></td>
+                  <td>32.2</td>
+                  <td>77.3</td>
+                  <td>100%</td>
+                  <td>0.0007913</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804730?report=genbank&amp;log$=nuclalign">3J5K_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit2"
+                              title="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Post- Translocation State (post3b, 50s Subunit)"
+                              id="description2">
+                        Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Post- Translocation State (post3b, 50s Subunit)
+                  </a></div></td>
+                  <td>32.2</td>
+                  <td>77.3</td>
+                  <td>100%</td>
+                  <td>0.0007913</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804675?report=genbank&amp;log$=nuclalign">3J5I_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit3"
+                              title="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Post- Translocation State (post3a, 50s Subunit)"
+                              id="description3">
+                        Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Post- Translocation State (post3a, 50s Subunit)
+                  </a></div></td>
+                  <td>32.2</td>
+                  <td>77.3</td>
+                  <td>100%</td>
+                  <td>0.0007913</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804619?report=genbank&amp;log$=nuclalign">3J5G_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit4"
+                              title="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Post- Translocation State (post2b, 50s Subunit)"
+                              id="description4">
+                        Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Post- Translocation State (post2b, 50s Subunit)
+                  </a></div></td>
+                  <td>32.2</td>
+                  <td>77.3</td>
+                  <td>100%</td>
+                  <td>0.0007913</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804563?report=genbank&amp;log$=nuclalign">3J5E_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit5"
+                              title="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Post- Translocation State (post2a, 50s Subunit)"
+                              id="description5">
+                        Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Post- Translocation State (post2a, 50s Subunit)
+                  </a></div></td>
+                  <td>32.2</td>
+                  <td>77.3</td>
+                  <td>100%</td>
+                  <td>0.0007913</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804507?report=genbank&amp;log$=nuclalign">3J5C_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit6"
+                              title="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Classic Post- Translocation State (post1, 50s Subunit)"
+                              id="description6">
+                        Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Classic Post- Translocation State (post1, 50s Subunit)
+                  </a></div></td>
+                  <td>32.2</td>
+                  <td>77.3</td>
+                  <td>100%</td>
+                  <td>0.0007913</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804451?report=genbank&amp;log$=nuclalign">3J5A_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit7"
+                              title="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Hybrid Pre- Translocation State (pre5b, 50s Subunit)"
+                              id="description7">
+                        Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Hybrid Pre- Translocation State (pre5b, 50s Subunit)
+                  </a></div></td>
+                  <td>32.2</td>
+                  <td>77.3</td>
+                  <td>100%</td>
+                  <td>0.0007913</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804395?report=genbank&amp;log$=nuclalign">3J58_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit8"
+                              title="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Hybrid Pre- Translocation State (pre5a, 50s Subunit)"
+                              id="description8">
+                        Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Hybrid Pre- Translocation State (pre5a, 50s Subunit)
+                  </a></div></td>
+                  <td>32.2</td>
+                  <td>77.3</td>
+                  <td>100%</td>
+                  <td>0.0007913</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804339?report=genbank&amp;log$=nuclalign">3J56_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit9"
+                              title="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Hybrid Pre- Translocation State (pre4, 50s Subunit)"
+                              id="description9">
+                        Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Hybrid Pre- Translocation State (pre4, 50s Subunit)
+                  </a></div></td>
+                  <td>32.2</td>
+                  <td>77.3</td>
+                  <td>100%</td>
+                  <td>0.0007913</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804283?report=genbank&amp;log$=nuclalign">3J54_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit10"
+                              title="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Classic Pre- Translocation State (pre1a, 50s Subunit)"
+                              id="description10">
+                        Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Classic Pre- Translocation State (pre1a, 50s Subunit)
+                  </a></div></td>
+                  <td>32.2</td>
+                  <td>77.3</td>
+                  <td>100%</td>
+                  <td>0.0007913</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804227?report=genbank&amp;log$=nuclalign">3J52_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit11"
+                              title="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Pre- Translocation State (pre3, 50s Subunit)"
+                              id="description11">
+                        Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Pre- Translocation State (pre3, 50s Subunit)
+                  </a></div></td>
+                  <td>32.2</td>
+                  <td>77.3</td>
+                  <td>100%</td>
+                  <td>0.0007913</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804195?report=genbank&amp;log$=nuclalign">3J51_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit12"
+                              title="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Pre- Translocation State (pre2, 50s Subunit)"
+                              id="description12">
+                        Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Pre- Translocation State (pre2, 50s Subunit)
+                  </a></div></td>
+                  <td>32.2</td>
+                  <td>77.3</td>
+                  <td>100%</td>
+                  <td>0.0007913</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804163?report=genbank&amp;log$=nuclalign">3J50_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit13"
+                              title="Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Classic Pre- Translocation State (pre1b, 50s Subunit)"
+                              id="description13">
+                        Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Classic Pre- Translocation State (pre1b, 50s Subunit)
+                  </a></div></td>
+                  <td>32.2</td>
+                  <td>77.3</td>
+                  <td>100%</td>
+                  <td>0.0007913</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804083?report=genbank&amp;log$=nuclalign">3J4X_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit14"
+                              title="Chain A, Tetracycline Resistance Protein Tet(o) Bound To The Ribosome"
+                              id="description14">
+                        Chain A, Tetracycline Resistance Protein Tet(o) Bound To The Ribosome
+                  </a></div></td>
+                  <td>32.2</td>
+                  <td>62.9</td>
+                  <td>100%</td>
+                  <td>0.0007913</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/474452808?report=genbank&amp;log$=nuclalign">3J37_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit15"
+                              title="Chain B, Structural Insights Into Cognate Vs. Near-Cognate Discrimination During Decoding. This Entry Contains The Large Subunit Of A Ribosome Programmed With A Near-Cognate Codon. "
+                              id="description15">
+                        Chain B, Structural Insights Into Cognate Vs. Near-Cognate Discrimination During Decoding. This Entry Contains The Large Subunit Of A Ribosome Programmed With A Near-Cognate Codon. 
+                  </a></div></td>
+                  <td>32.2</td>
+                  <td>62.9</td>
+                  <td>100%</td>
+                  <td>0.0007913</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/326634210?report=genbank&amp;log$=nuclalign">3IZT_B</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit16"
+                              title="Chain B, Ternary Complex-Bound E.Coli 70s Ribosome. This Entry Consists Of The 50s Subunit. "
+                              id="description16">
+                        Chain B, Ternary Complex-Bound E.Coli 70s Ribosome. This Entry Consists Of The 50s Subunit. 
+                  </a></div></td>
+                  <td>32.2</td>
+                  <td>77.3</td>
+                  <td>100%</td>
+                  <td>0.0007913</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/224510767?report=genbank&amp;log$=nuclalign">3FIK_B</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit17"
+                              title="Chain B, Structure Of The 50s Subunit Of E. Coli Ribosome In Pre-Accommodation State "
+                              id="description17">
+                        Chain B, Structure Of The 50s Subunit Of E. Coli Ribosome In Pre-Accommodation State 
+                  </a></div></td>
+                  <td>32.2</td>
+                  <td>77.3</td>
+                  <td>100%</td>
+                  <td>0.0007913</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/256032374?report=genbank&amp;log$=nuclalign">3E1B_B</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit18"
+                              title="Chain 0, Structure Of The 50s Subunit Of A Secm-Stalled E. Coli Ribosome Complex Obtained By Fitting Atomic Models For Rna And Protein Components Into Cryo-Em Map Emd-1143"
+                              id="description18">
+                        Chain 0, Structure Of The 50s Subunit Of A Secm-Stalled E. Coli Ribosome Complex Obtained By Fitting Atomic Models For Rna And Protein Components Into Cryo-Em Map Emd-1143
+                  </a></div></td>
+                  <td>32.2</td>
+                  <td>77.3</td>
+                  <td>100%</td>
+                  <td>0.0007913</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/157883716?report=genbank&amp;log$=nuclalign">2GYC_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit19"
+                              title="Chain 0, Structure Of The 50s Subunit Of A Pre-Translocational E. Coli Ribosome Obtained By Fitting Atomic Models For Rna And Protein Components Into Cryo-Em Map Emd-1056"
+                              id="description19">
+                        Chain 0, Structure Of The 50s Subunit Of A Pre-Translocational E. Coli Ribosome Obtained By Fitting Atomic Models For Rna And Protein Components Into Cryo-Em Map Emd-1056
+                  </a></div></td>
+                  <td>32.2</td>
+                  <td>77.3</td>
+                  <td>100%</td>
+                  <td>0.0007913</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/157883710?report=genbank&amp;log$=nuclalign">2GYA_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit20"
+                              title="Chain B, Crystal Structure Of Ribosome With Messenger Rna And The Anticodon Stem-Loop Of P-Site Trna. This File Contains The 50s Subunit Of One 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400."
+                              id="description20">
+                        Chain B, Crystal Structure Of Ribosome With Messenger Rna And The Anticodon Stem-Loop Of P-Site Trna. This File Contains The 50s Subunit Of One 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400.
+                  </a></div></td>
+                  <td>32.2</td>
+                  <td>77.3</td>
+                  <td>100%</td>
+                  <td>0.0007913</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/122922257?report=genbank&amp;log$=nuclalign">2I2V_B</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit21"
+                              title="Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli At 3.5 A Resolution. This File Contains The 50s Subunit Of One 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. "
+                              id="description21">
+                        Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli At 3.5 A Resolution. This File Contains The 50s Subunit Of One 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. 
+                  </a></div></td>
+                  <td>32.2</td>
+                  <td>77.3</td>
+                  <td>100%</td>
+                  <td>0.0007913</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/83754062?report=genbank&amp;log$=nuclalign">2AW4_B</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit22"
+                              title="Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli At 3.5 A Resolution. This File Contains The 50s Subunit Of The Second 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. "
+                              id="description22">
+                        Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli At 3.5 A Resolution. This File Contains The 50s Subunit Of The Second 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. 
+                  </a></div></td>
+                  <td>32.2</td>
+                  <td>77.3</td>
+                  <td>100%</td>
+                  <td>0.0007913</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/83754118?report=genbank&amp;log$=nuclalign">2AWB_B</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit23"
+                              title="Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With The Antibiotic Kasugamyin At 3.5a Resolution. This File Contains The 50s Subunit Of One 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. "
+                              id="description23">
+                        Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With The Antibiotic Kasugamyin At 3.5a Resolution. This File Contains The 50s Subunit Of One 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. 
+                  </a></div></td>
+                  <td>32.2</td>
+                  <td>77.3</td>
+                  <td>100%</td>
+                  <td>0.0007913</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/157880571?report=genbank&amp;log$=nuclalign">1VS6_B</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit24"
+                              title="Chain 0, Real Space Refined Coordinates Of The 50s Subunit Fitted Into The Low Resolution Cryo-Em Map Of The Ef-G.Gtp State Of E. Coli 70s Ribosome "
+                              id="description24">
+                        Chain 0, Real Space Refined Coordinates Of The 50s Subunit Fitted Into The Low Resolution Cryo-Em Map Of The Ef-G.Gtp State Of E. Coli 70s Ribosome 
+                  </a></div></td>
+                  <td>32.2</td>
+                  <td>77.3</td>
+                  <td>100%</td>
+                  <td>0.0007913</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/33357900?report=genbank&amp;log$=nuclalign">1P85_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit25"
+                              title="Chain B, 23s Rrna Structure Fitted To A Cryo-Electron Microscopic Map At 7.5 Angstroms Resolution"
+                              id="description25">
+                        Chain B, 23s Rrna Structure Fitted To A Cryo-Electron Microscopic Map At 7.5 Angstroms Resolution
+                  </a></div></td>
+                  <td>26.3</td>
+                  <td>40.6</td>
+                  <td>81%</td>
+                  <td>0.04882</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/7767146?report=genbank&amp;log$=nuclalign">1C2W_B</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit30"
+                              title="Chain 1, Structure Of The Methanococcus Jannaschii Ribosome-secyebeta Channel Complex (50s Ribosomal Subunit)"
+                              id="description30">
+                        Chain 1, Structure Of The Methanococcus Jannaschii Ribosome-secyebeta Channel Complex (50s Ribosomal Subunit)
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>36.7</td>
+                  <td>81%</td>
+                  <td>11.9</td>
+                  <td>92%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/551701574?report=genbank&amp;log$=nuclalign">3J44_1</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit35"
+                              title="Chain 1, Promiscuous Behavior Of Proteins In Archaeal Ribosomes Revealed By Cryo-em: Implications For Evolution Of Eukaryotic Ribosomes (50s Ribosomal Rna)"
+                              id="description35">
+                        Chain 1, Promiscuous Behavior Of Proteins In Archaeal Ribosomes Revealed By Cryo-em: Implications For Evolution Of Eukaryotic Ribosomes (50s Ribosomal Rna)
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>36.7</td>
+                  <td>81%</td>
+                  <td>11.9</td>
+                  <td>92%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/428697991?report=genbank&amp;log$=nuclalign">3J2L_1</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit26"
+                              title="Chain a, Model Of The Large Subunit Rna Based On A 5.5 A Cryo-em Map Of Triticum Aestivum Translating 80s Ribosome"
+                              id="description26">
+                        Chain a, Model Of The Large Subunit Rna Based On A 5.5 A Cryo-em Map Of Triticum Aestivum Translating 80s Ribosome
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>77.8</td>
+                  <td>88%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=genbank&amp;log$=nuclalign">3J62_AA</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit27"
+                              title="Chain A, 39s Large Subunit Of The Porcine Mitochondrial Ribosome"
+                              id="description27">
+                        Chain A, 39s Large Subunit Of The Porcine Mitochondrial Ribosome
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>18.3</td>
+                  <td>56%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/567755268?report=genbank&amp;log$=nuclalign">4CE4_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit28"
+                              title="Chain 5, Cryo-em Reconstruction Of The 80s-eif5b-met-itrnamet Eukaryotic Translation Initiation Complex"
+                              id="description28">
+                        Chain 5, Cryo-em Reconstruction Of The 80s-eif5b-met-itrnamet Eukaryotic Translation Initiation Complex
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>79.8</td>
+                  <td>81%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=genbank&amp;log$=nuclalign">4BYP_5</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit29"
+                              title="Chain 5, Cryo-em Reconstruction Of The 80s-eif5b-met-itrnamet Eukaryotic Translation Initiation Complex"
+                              id="description29">
+                        Chain 5, Cryo-em Reconstruction Of The 80s-eif5b-met-itrnamet Eukaryotic Translation Initiation Complex
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>79.8</td>
+                  <td>81%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=genbank&amp;log$=nuclalign">4BYW_5</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit31"
+                              title="Chain 0, The Re-refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution: More Complete Structure Of The L7/l12 And L1 Stalk, L5 And Lx Proteins"
+                              id="description31">
+                        Chain 0, The Re-refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution: More Complete Structure Of The L7/l12 And L1 Stalk, L5 And Lx Proteins
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>51.0</td>
+                  <td>75%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/508123724?report=genbank&amp;log$=nuclalign">4HUB_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit32"
+                              title="Chain 5, Structure Of The H. Sapiens 60s Rrna"
+                              id="description32">
+                        Chain 5, Structure Of The H. Sapiens 60s Rrna
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>128.8</td>
+                  <td>100%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=genbank&amp;log$=nuclalign">3J3F_5</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit33"
+                              title="Chain 5, Structure Of The D. Melanogaster 60s Rrna"
+                              id="description33">
+                        Chain 5, Structure Of The D. Melanogaster 60s Rrna
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>63.4</td>
+                  <td>100%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/485601474?report=genbank&amp;log$=nuclalign">3J3E_5</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit34"
+                              title="Chain B, High_resolution Cryo-electron Microscopy Structure Of The Trypanosoma Brucei Ribosome"
+                              id="description34">
+                        Chain B, High_resolution Cryo-electron Microscopy Structure Of The Trypanosoma Brucei Ribosome
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>32.7</td>
+                  <td>81%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/449802187?report=genbank&amp;log$=nuclalign">3ZEX_B</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit36"
+                              title="Chain 0, Crystal Structure Of Enhanced Macrolide Bound To 50s Ribosomal Subunit"
+                              id="description36">
+                        Chain 0, Crystal Structure Of Enhanced Macrolide Bound To 50s Ribosomal Subunit
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>32.7</td>
+                  <td>56%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/392311504?report=genbank&amp;log$=nuclalign">3OW2_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit37"
+                              title="Chain 0, The Cryo-em Structure Of The Archaeal 50s Ribosomal Subunit In Complex With Initiation Factor 6"
+                              id="description37">
+                        Chain 0, The Cryo-em Structure Of The Archaeal 50s Ribosomal Subunit In Complex With Initiation Factor 6
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>51.0</td>
+                  <td>75%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/374977932?report=genbank&amp;log$=nuclalign">4ADX_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit38"
+                              title="Chain 6, The Structure Of The Eukaryotic Ribosome At 3.0 A Resolution. This Entry Contains Ribosomal Rna And Ions Of The 40s Subunit, Ribosome B"
+                              id="description38">
+                        Chain 6, The Structure Of The Eukaryotic Ribosome At 3.0 A Resolution. This Entry Contains Ribosomal Rna And Ions Of The 40s Subunit, Ribosome B
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>47.1</td>
+                  <td>88%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/364506133?report=genbank&amp;log$=nuclalign">3U5F_6</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit39"
+                              title="Chain 2, The Structure Of The Eukaryotic Ribosome At 3.0 A Resolution. This Entry Contains Ribosomal Rna And Ions Of The 40s Subunit, Ribosome A "
+                              id="description39">
+                        Chain 2, The Structure Of The Eukaryotic Ribosome At 3.0 A Resolution. This Entry Contains Ribosomal Rna And Ions Of The 40s Subunit, Ribosome A 
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>47.1</td>
+                  <td>88%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/364506095?report=genbank&amp;log$=nuclalign">3U5B_2</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit40"
+                              title="Chain 1, T.Thermophila 60s Ribosomal Subunit In Complex With Initiation Factor 6. This File Contains 26s Rrna And Proteins Of Molecule 4."
+                              id="description40">
+                        Chain 1, T.Thermophila 60s Ribosomal Subunit In Complex With Initiation Factor 6. This File Contains 26s Rrna And Proteins Of Molecule 4.
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>51.0</td>
+                  <td>75%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/358440203?report=genbank&amp;log$=nuclalign">4A1D_1</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit41"
+                              title="Chain 1, T.Thermophila 60s Ribosomal Subunit In Complex With Initiation Factor 6. This File Contains 26s Rrna And Proteins Of Molecule 1"
+                              id="description41">
+                        Chain 1, T.Thermophila 60s Ribosomal Subunit In Complex With Initiation Factor 6. This File Contains 26s Rrna And Proteins Of Molecule 1
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>51.0</td>
+                  <td>75%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/358440111?report=genbank&amp;log$=nuclalign">4A18_1</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit42"
+                              title="Chain 1, T.Thermophila 60s Ribosomal Subunit In Complex With Initiation Factor 6. This File Contains 26s Rrna And Proteins Of Molecule 3. "
+                              id="description42">
+                        Chain 1, T.Thermophila 60s Ribosomal Subunit In Complex With Initiation Factor 6. This File Contains 26s Rrna And Proteins Of Molecule 3. 
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>51.0</td>
+                  <td>75%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/358440157?report=genbank&amp;log$=nuclalign">4A1B_1</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit43"
+                              title="Chain 8, Core Of Mammalian 80s Pre-Ribosome In Complex With Trnas Fitted To A 9.8a Cryo-Em Map: Classic Pre State 1"
+                              id="description43">
+                        Chain 8, Core Of Mammalian 80s Pre-Ribosome In Complex With Trnas Fitted To A 9.8a Cryo-Em Map: Classic Pre State 1
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>18.3</td>
+                  <td>56%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/357380452?report=genbank&amp;log$=nuclalign">3J0L_8</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit44"
+                              title="Chain 8, Core Of Mammalian 80s Pre-Ribosome In Complex With Trnas Fitted To A 9a Cryo-Em Map: Classic Pre State 2"
+                              id="description44">
+                        Chain 8, Core Of Mammalian 80s Pre-Ribosome In Complex With Trnas Fitted To A 9a Cryo-Em Map: Classic Pre State 2
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>18.3</td>
+                  <td>56%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/357380483?report=genbank&amp;log$=nuclalign">3J0O_8</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit45"
+                              title="Chain 1, Yeast 80s Ribosome. This Entry Consists Of The 60s Subunit Of The First 80s In The Asymmetric Unit. "
+                              id="description45">
+                        Chain 1, Yeast 80s Ribosome. This Entry Consists Of The 60s Subunit Of The First 80s In The Asymmetric Unit. 
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>79.8</td>
+                  <td>81%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=genbank&amp;log$=nuclalign">3O58_1</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit46"
+                              title="Chain 1, Yeast 80s Ribosome. This Entry Consists Of The 60s Subunit Of The Second 80s In The Asymmetric Unit. "
+                              id="description46">
+                        Chain 1, Yeast 80s Ribosome. This Entry Consists Of The 60s Subunit Of The Second 80s In The Asymmetric Unit. 
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>79.8</td>
+                  <td>81%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=genbank&amp;log$=nuclalign">3O5H_1</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit47"
+                              title="Chain 1, Yeast 80s Ribosome. This Entry Consists Of The 40s Subunit Of The First 80s In The Asymmetric Unit."
+                              id="description47">
+                        Chain 1, Yeast 80s Ribosome. This Entry Consists Of The 40s Subunit Of The First 80s In The Asymmetric Unit.
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>47.1</td>
+                  <td>88%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/315113447?report=genbank&amp;log$=nuclalign">3O2Z_1</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit48"
+                              title="Chain 1, Yeast 80s Ribosome. This Entry Consists Of The 40s Subunit Of The Second 80s In The Asymmetric Unit."
+                              id="description48">
+                        Chain 1, Yeast 80s Ribosome. This Entry Consists Of The 40s Subunit Of The Second 80s In The Asymmetric Unit.
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>47.1</td>
+                  <td>88%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/315113475?report=genbank&amp;log$=nuclalign">3O30_1</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit49"
+                              title="Chain A, Model Of The Large Subunit Rna Based On A 6.1 A Cryo-Em Map Of Saccharomyces Cerevisiae Translating 80s Ribosome (With Es27l-In Conformation)"
+                              id="description49">
+                        Chain A, Model Of The Large Subunit Rna Based On A 6.1 A Cryo-Em Map Of Saccharomyces Cerevisiae Translating 80s Ribosome (With Es27l-In Conformation)
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>79.8</td>
+                  <td>81%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=genbank&amp;log$=nuclalign">3IZF_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit50"
+                              title="Chain A, Model Of The Small Subunit Rna Based On A 6.1 A Cryo-Em Map Of Saccharomyces Cerevisiae Translating 80s Ribosome"
+                              id="description50">
+                        Chain A, Model Of The Small Subunit Rna Based On A 6.1 A Cryo-Em Map Of Saccharomyces Cerevisiae Translating 80s Ribosome
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>47.1</td>
+                  <td>88%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/313103744?report=genbank&amp;log$=nuclalign">3IZE_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit51"
+                              title="Chain I, I-Msoi Re-Designed For Altered Dna Cleavage Specificity (-7c)"
+                              id="description51">
+                        Chain I, I-Msoi Re-Designed For Altered Dna Cleavage Specificity (-7c)
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>18.3</td>
+                  <td>56%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/296278448?report=genbank&amp;log$=nuclalign">3KO2_I</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit52"
+                              title="Chain H, I-Msoi Re-Designed For Altered Dna Cleavage Specificity (-7c)"
+                              id="description52">
+                        Chain H, I-Msoi Re-Designed For Altered Dna Cleavage Specificity (-7c)
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>18.3</td>
+                  <td>56%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/296278447?report=genbank&amp;log$=nuclalign">3KO2_H</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit53"
+                              title="Chain D, I-Msoi Re-Designed For Altered Dna Cleavage Specificity (-7c)"
+                              id="description53">
+                        Chain D, I-Msoi Re-Designed For Altered Dna Cleavage Specificity (-7c)
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>18.3</td>
+                  <td>56%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/296278444?report=genbank&amp;log$=nuclalign">3KO2_D</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit54"
+                              title="Chain C, I-Msoi Re-Designed For Altered Dna Cleavage Specificity (-7c)"
+                              id="description54">
+                        Chain C, I-Msoi Re-Designed For Altered Dna Cleavage Specificity (-7c)
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>18.3</td>
+                  <td>56%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/296278443?report=genbank&amp;log$=nuclalign">3KO2_C</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit55"
+                              title="Chain 0, Co-Crystal Structure Of Triacetyloleandomcyin Bound To The Large Ribosomal Subunit"
+                              id="description55">
+                        Chain 0, Co-Crystal Structure Of Triacetyloleandomcyin Bound To The Large Ribosomal Subunit
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>51.0</td>
+                  <td>75%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/290790096?report=genbank&amp;log$=nuclalign">3I56_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit56"
+                              title="Chain 5, Structure Of The 60s Rrna For Eukaryotic Ribosome Based On Cryo-Em Map Of Thermomyces Lanuginosus Ribosome At 8.9a Resolution"
+                              id="description56">
+                        Chain 5, Structure Of The 60s Rrna For Eukaryotic Ribosome Based On Cryo-Em Map Of Thermomyces Lanuginosus Ribosome At 8.9a Resolution
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>79.8</td>
+                  <td>81%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=genbank&amp;log$=nuclalign">3JYX_5</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit57"
+                              title="Chain A, Structure Of The 40s Rrna And Proteins And PE TRNA FOR EUKARYOTIC Ribosome Based On Cryo-Em Map Of Thermomyces Lanuginosus Ribosome At 8.9a Resolution"
+                              id="description57">
+                        Chain A, Structure Of The 40s Rrna And Proteins And PE TRNA FOR EUKARYOTIC Ribosome Based On Cryo-Em Map Of Thermomyces Lanuginosus Ribosome At 8.9a Resolution
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>47.1</td>
+                  <td>88%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/281500807?report=genbank&amp;log$=nuclalign">3JYV_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit58"
+                              title="Chain 3, Structure Of The Ribosomal 80s-Eef2-Sordarin Complex From Yeast Obtained By Docking Atomic Models For Rna And Protein Components Into A 11.7 A Cryo-Em Map. This File, 1s1i, Contains 60s Subunit. The 40s Ribosomal Subunit Is In File 1s1h."
+                              id="description58">
+                        Chain 3, Structure Of The Ribosomal 80s-Eef2-Sordarin Complex From Yeast Obtained By Docking Atomic Models For Rna And Protein Components Into A 11.7 A Cryo-Em Map. This File, 1s1i, Contains 60s Subunit. The 40s Ribosomal Subunit Is In File 1s1h.
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>32.7</td>
+                  <td>56%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/259090425?report=genbank&amp;log$=nuclalign">1S1I_3</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit59"
+                              title="Chain 0, Negamycin Binds To The Wall Of The Nascent Chain Exit Tunnel Of The 50s Ribosomal Subunit"
+                              id="description59">
+                        Chain 0, Negamycin Binds To The Wall Of The Nascent Chain Exit Tunnel Of The 50s Ribosomal Subunit
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>32.7</td>
+                  <td>56%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/208435493?report=genbank&amp;log$=nuclalign">2QEX_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit60"
+                              title="Chain 0, The Structure Of The Antibiotic Linezolid Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui"
+                              id="description60">
+                        Chain 0, The Structure Of The Antibiotic Linezolid Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>32.7</td>
+                  <td>56%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/194368703?report=genbank&amp;log$=nuclalign">3CPW_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit61"
+                              title="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation G2616a "
+                              id="description61">
+                        Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation G2616a 
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>51.0</td>
+                  <td>75%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596372?report=genbank&amp;log$=nuclalign">3CCV_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit62"
+                              title="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation G2482c"
+                              id="description62">
+                        Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation G2482c
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>51.0</td>
+                  <td>75%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596341?report=genbank&amp;log$=nuclalign">3CCU_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit63"
+                              title="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation G2482a"
+                              id="description63">
+                        Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation G2482a
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>51.0</td>
+                  <td>75%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596310?report=genbank&amp;log$=nuclalign">3CCS_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit64"
+                              title="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation A2488c. Density For Anisomycin Is Visible But Not Included In The Model."
+                              id="description64">
+                        Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation A2488c. Density For Anisomycin Is Visible But Not Included In The Model.
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>51.0</td>
+                  <td>75%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596279?report=genbank&amp;log$=nuclalign">3CCR_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit65"
+                              title="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation A2488u"
+                              id="description65">
+                        Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation A2488u
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>51.0</td>
+                  <td>75%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596248?report=genbank&amp;log$=nuclalign">3CCQ_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit66"
+                              title="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation G2611u"
+                              id="description66">
+                        Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation G2611u
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>36.7</td>
+                  <td>75%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596217?report=genbank&amp;log$=nuclalign">3CCM_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit67"
+                              title="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation U2535c. Density For Anisomycin Is Visible But Not Included In Model."
+                              id="description67">
+                        Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation U2535c. Density For Anisomycin Is Visible But Not Included In Model.
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>51.0</td>
+                  <td>75%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596186?report=genbank&amp;log$=nuclalign">3CCL_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit68"
+                              title="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation C2534u"
+                              id="description68">
+                        Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation C2534u
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>51.0</td>
+                  <td>75%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596155?report=genbank&amp;log$=nuclalign">3CCJ_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit69"
+                              title="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation U2535a"
+                              id="description69">
+                        Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation U2535a
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>51.0</td>
+                  <td>75%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596124?report=genbank&amp;log$=nuclalign">3CCE_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit70"
+                              title="Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation C2487u"
+                              id="description70">
+                        Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation C2487u
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>51.0</td>
+                  <td>75%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596093?report=genbank&amp;log$=nuclalign">3CC7_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit71"
+                              title="Chain 0, The Refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution With Rrna Sequence For The 23s Rrna And Genome-Derived Sequences For R-Proteins "
+                              id="description71">
+                        Chain 0, The Refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution With Rrna Sequence For The 23s Rrna And Genome-Derived Sequences For R-Proteins 
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>51.0</td>
+                  <td>75%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596031?report=genbank&amp;log$=nuclalign">3CC2_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit72"
+                              title="Chain 0, Structure Of A Mammalian Ribosomal 60s Subunit Within An 80s Complex Obtained By Docking Homology Models Of The Rna And Proteins Into An 8.7 A Cryo-Em Map"
+                              id="description72">
+                        Chain 0, Structure Of A Mammalian Ribosomal 60s Subunit Within An 80s Complex Obtained By Docking Homology Models Of The Rna And Proteins Into An 8.7 A Cryo-Em Map
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>63.4</td>
+                  <td>81%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/187609272?report=genbank&amp;log$=nuclalign">2ZKR_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit73"
+                              title="Chain 0, A More Complete Structure Of The The L7L12 STALK OF THE Haloarcula Marismortui 50s Large Ribosomal Subunit"
+                              id="description73">
+                        Chain 0, A More Complete Structure Of The The L7L12 STALK OF THE Haloarcula Marismortui 50s Large Ribosomal Subunit
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>32.7</td>
+                  <td>56%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/171848835?report=genbank&amp;log$=nuclalign">2QA4_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit74"
+                              title="Chain R, Structural Model For The Large Subunit Of The Mammalian Mitochondrial Ribosome"
+                              id="description74">
+                        Chain R, Structural Model For The Large Subunit Of The Mammalian Mitochondrial Ribosome
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>18.3</td>
+                  <td>56%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/99032306?report=genbank&amp;log$=nuclalign">2FTC_R</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit75"
+                              title="Chain 0, Refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution "
+                              id="description75">
+                        Chain 0, Refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution 
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>32.7</td>
+                  <td>56%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/50513468?report=genbank&amp;log$=nuclalign">1S72_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit76"
+                              title="Chain 0, Crystal Structure Of Virginiamycin M And S Bound To The 50s Ribosomal Subunit Of Haloarcula Marismortui "
+                              id="description76">
+                        Chain 0, Crystal Structure Of Virginiamycin M And S Bound To The 50s Ribosomal Subunit Of Haloarcula Marismortui 
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>51.0</td>
+                  <td>75%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/66360881?report=genbank&amp;log$=nuclalign">1YIT_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit77"
+                              title="Chain 0, Crystal Structure Of Azithromycin Bound To The G2099a Mutant 50s Ribosomal Subunit Of Haloarcula Marismortui "
+                              id="description77">
+                        Chain 0, Crystal Structure Of Azithromycin Bound To The G2099a Mutant 50s Ribosomal Subunit Of Haloarcula Marismortui 
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>51.0</td>
+                  <td>75%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/66360782?report=genbank&amp;log$=nuclalign">1YHQ_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit78"
+                              title="Chain 0, Crystal Structure Of Quinupristin Bound To The G2099a Mutant 50s Ribosomal Subunit Of Haloarcula Marismortui"
+                              id="description78">
+                        Chain 0, Crystal Structure Of Quinupristin Bound To The G2099a Mutant 50s Ribosomal Subunit Of Haloarcula Marismortui
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>51.0</td>
+                  <td>75%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/66360980?report=genbank&amp;log$=nuclalign">1YJW_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit79"
+                              title="Chain A, Crystal Structure Of Cca-Phe-Cap-Biotin Bound Simultaneously At Half Occupancy To Both The A-Site And P- Site Of The The 50s Ribosomal Subunit."
+                              id="description79">
+                        Chain A, Crystal Structure Of Cca-Phe-Cap-Biotin Bound Simultaneously At Half Occupancy To Both The A-Site And P- Site Of The The 50s Ribosomal Subunit.
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>32.7</td>
+                  <td>56%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/37928006?report=genbank&amp;log$=nuclalign">1Q86_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit80"
+                              title="Chain 0, Fully Refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution "
+                              id="description80">
+                        Chain 0, Fully Refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution 
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>32.7</td>
+                  <td>56%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/15825941?report=genbank&amp;log$=nuclalign">1JJ2_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit81"
+                              title="Chain A, Co-Crystal Structure Of Blasticidin S Bound To The 50s Ribosomal Subunit"
+                              id="description81">
+                        Chain A, Co-Crystal Structure Of Blasticidin S Bound To The 50s Ribosomal Subunit
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>32.7</td>
+                  <td>56%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/34811146?report=genbank&amp;log$=nuclalign">1KC8_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit82"
+                              title="Chain 0, Crystal Structure Of The Large Ribosomal Subunit From Haloarcula Marismortui At 2.4 Angstrom Resolution"
+                              id="description82">
+                        Chain 0, Crystal Structure Of The Large Ribosomal Subunit From Haloarcula Marismortui At 2.4 Angstrom Resolution
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>32.7</td>
+                  <td>56%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/10120918?report=genbank&amp;log$=nuclalign">1FFK_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit83"
+                              title="Chain A, Large Ribosomal Subunit Complexed With A 13 Bp Minihelix- Puromycin Compound"
+                              id="description83">
+                        Chain A, Large Ribosomal Subunit Complexed With A 13 Bp Minihelix- Puromycin Compound
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>32.7</td>
+                  <td>56%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/10120728?report=genbank&amp;log$=nuclalign">1FG0_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit84"
+                              title="Chain A, Large Ribosomal Subunit Complexed With R(Cc)-Da-Puromycin"
+                              id="description84">
+                        Chain A, Large Ribosomal Subunit Complexed With R(Cc)-Da-Puromycin
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>32.7</td>
+                  <td>56%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/10120727?report=genbank&amp;log$=nuclalign">1FFZ_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit85"
+                              title="Chain F, Crystal Structure Of The Catalytic Domain Of Rlub In Complex With A 21-nucleotide Rna Substrate"
+                              id="description85">
+                        Chain F, Crystal Structure Of The Catalytic Domain Of Rlub In Complex With A 21-nucleotide Rna Substrate
+                  </a></div></td>
+                  <td>16.4</td>
+                  <td>16.4</td>
+                  <td>50%</td>
+                  <td>47.03</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/558705015?report=genbank&amp;log$=nuclalign">4LGT_F</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit86"
+                              title="Chain E, Crystal Structure Of The Catalytic Domain Of Rlub In Complex With A 21-nucleotide Rna Substrate"
+                              id="description86">
+                        Chain E, Crystal Structure Of The Catalytic Domain Of Rlub In Complex With A 21-nucleotide Rna Substrate
+                  </a></div></td>
+                  <td>16.4</td>
+                  <td>16.4</td>
+                  <td>50%</td>
+                  <td>47.03</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/558705013?report=genbank&amp;log$=nuclalign">4LGT_E</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit87"
+                              title="Chain A, Thermus Thermophilus Ribosome"
+                              id="description87">
+                        Chain A, Thermus Thermophilus Ribosome
+                  </a></div></td>
+                  <td>16.4</td>
+                  <td>32.7</td>
+                  <td>69%</td>
+                  <td>47.03</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/529280935?report=genbank&amp;log$=nuclalign">4BTD_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit88"
+                              title="Chain A, Crystal Structure Of Blasticidin S Bound To Thermus Thermophilus 70s Ribosome. This File Contains The 50s Subunit And Blasticidin S Molecule From The First 70s Ribosome. "
+                              id="description88">
+                        Chain A, Crystal Structure Of Blasticidin S Bound To Thermus Thermophilus 70s Ribosome. This File Contains The 50s Subunit And Blasticidin S Molecule From The First 70s Ribosome. 
+                  </a></div></td>
+                  <td>16.4</td>
+                  <td>32.7</td>
+                  <td>69%</td>
+                  <td>47.03</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/528082310?report=genbank&amp;log$=nuclalign">4L6J_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit89"
+                              title="Chain A, Crystal Structure Of The 70s Ribosome Bound With The Q253p Mutant Of Release Factor Rf2. 50s Of The A Subunit "
+                              id="description89">
+                        Chain A, Crystal Structure Of The 70s Ribosome Bound With The Q253p Mutant Of Release Factor Rf2. 50s Of The A Subunit 
+                  </a></div></td>
+                  <td>16.4</td>
+                  <td>32.7</td>
+                  <td>69%</td>
+                  <td>47.03</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/520729408?report=genbank&amp;log$=nuclalign">4KFI_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit90"
+                              title="Chain A, Crystal Structure Of Thermus Thermophilus 70s Containing Trnas And Mrna Stop Codon With Pseudouridine"
+                              id="description90">
+                        Chain A, Crystal Structure Of Thermus Thermophilus 70s Containing Trnas And Mrna Stop Codon With Pseudouridine
+                  </a></div></td>
+                  <td>16.4</td>
+                  <td>32.7</td>
+                  <td>69%</td>
+                  <td>47.03</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/520728860?report=genbank&amp;log$=nuclalign">4K0Q_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit91"
+                              title="Chain A, Crystal Structure Of Thermus Thermophilus 70s Containing Trnas And Mrna Stop Codon With Pseudouridine"
+                              id="description91">
+                        Chain A, Crystal Structure Of Thermus Thermophilus 70s Containing Trnas And Mrna Stop Codon With Pseudouridine
+                  </a></div></td>
+                  <td>16.4</td>
+                  <td>32.7</td>
+                  <td>69%</td>
+                  <td>47.03</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/520728802?report=genbank&amp;log$=nuclalign">4K0M_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit92"
+                              title="Chain A, Atomic Model Of The Immature 50s Subunit From Bacillus Subtilis (state I-a)"
+                              id="description92">
+                        Chain A, Atomic Model Of The Immature 50s Subunit From Bacillus Subtilis (state I-a)
+                  </a></div></td>
+                  <td>16.4</td>
+                  <td>73.8</td>
+                  <td>88%</td>
+                  <td>47.03</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=genbank&amp;log$=nuclalign">3J3V_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit93"
+                              title="Chain A, Atomic Model Of The Immature 50s Subunit From Bacillus Subtilis (state Ii-a)"
+                              id="description93">
+                        Chain A, Atomic Model Of The Immature 50s Subunit From Bacillus Subtilis (state Ii-a)
+                  </a></div></td>
+                  <td>16.4</td>
+                  <td>73.8</td>
+                  <td>88%</td>
+                  <td>47.03</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=genbank&amp;log$=nuclalign">3J3W_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit94"
+                              title="Chain A, Crystal Structure Of The Bacterial Ribosome Ram Mutation G347u. This Entry Contains The 50s Ribosomal Subunit Of The Second 70s Molecule In The Asymmetric Unit"
+                              id="description94">
+                        Chain A, Crystal Structure Of The Bacterial Ribosome Ram Mutation G347u. This Entry Contains The 50s Ribosomal Subunit Of The Second 70s Molecule In The Asymmetric Unit
+                  </a></div></td>
+                  <td>16.4</td>
+                  <td>32.7</td>
+                  <td>69%</td>
+                  <td>47.03</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/482676744?report=genbank&amp;log$=nuclalign">3V6X_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit95"
+                              title="Chain A, Crystal Structure Of The Bacterial Ribosome Ram Mutation G347u. This Entry Contains The 50s Ribosomal Subunit Of The First 70s Molecule In The Asymmetric Unit"
+                              id="description95">
+                        Chain A, Crystal Structure Of The Bacterial Ribosome Ram Mutation G347u. This Entry Contains The 50s Ribosomal Subunit Of The First 70s Molecule In The Asymmetric Unit
+                  </a></div></td>
+                  <td>16.4</td>
+                  <td>32.7</td>
+                  <td>69%</td>
+                  <td>47.03</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/482676712?report=genbank&amp;log$=nuclalign">3V6W_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit96"
+                              title="Chain d, The Cryo-Em Structure Of A 3d Dna-Origami Object"
+                              id="description96">
+                        Chain d, The Cryo-Em Structure Of A 3d Dna-Origami Object
+                  </a></div></td>
+                  <td>16.4</td>
+                  <td>16.4</td>
+                  <td>50%</td>
+                  <td>47.03</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/428697829?report=genbank&amp;log$=nuclalign">2YMI_DD</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit97"
+                              title="Chain A, The Cryo-Em Structure Of A 3d Dna-Origami Object"
+                              id="description97">
+                        Chain A, The Cryo-Em Structure Of A 3d Dna-Origami Object
+                  </a></div></td>
+                  <td>16.4</td>
+                  <td>30.7</td>
+                  <td>56%</td>
+                  <td>47.03</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/428697789?report=genbank&amp;log$=nuclalign">2YMF_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit98"
+                              title="Chain A, Structure Of The Thermus Thermophilus 70s Ribosome Complexed With Mrna, Trna And Paromomycin (Part 2 Of 4). This File Contains The 50s Subunit From Molecule I. "
+                              id="description98">
+                        Chain A, Structure Of The Thermus Thermophilus 70s Ribosome Complexed With Mrna, Trna And Paromomycin (Part 2 Of 4). This File Contains The 50s Subunit From Molecule I. 
+                  </a></div></td>
+                  <td>16.4</td>
+                  <td>32.7</td>
+                  <td>69%</td>
+                  <td>47.03</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/396639330?report=genbank&amp;log$=nuclalign">2J01_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit99"
+                              title="Chain C, Crystal Structure Of I-Crei Complexed With Its Target Methylated At Position Plus 2 (In The B Strand) In The Presence Of Magnesium"
+                              id="description99">
+                        Chain C, Crystal Structure Of I-Crei Complexed With Its Target Methylated At Position Plus 2 (In The B Strand) In The Presence Of Magnesium
+                  </a></div></td>
+                  <td>16.4</td>
+                  <td>16.4</td>
+                  <td>50%</td>
+                  <td>47.03</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/393715375?report=genbank&amp;log$=nuclalign">4AQX_C</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit100"
+                              title="Chain C, Crystal Structure Of I-Crei Complexed With Its Target Methylated At Position Plus 2 (In The B Strand) In The Presence Of Calcium"
+                              id="description100">
+                        Chain C, Crystal Structure Of I-Crei Complexed With Its Target Methylated At Position Plus 2 (In The B Strand) In The Presence Of Calcium
+                  </a></div></td>
+                  <td>16.4</td>
+                  <td>16.4</td>
+                  <td>50%</td>
+                  <td>47.03</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/393715371?report=genbank&amp;log$=nuclalign">4AQU_C</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h2>Alignments</h2>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description1">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804730?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804730?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval Post-translocation Complex (post4, 50s Subunit)</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804730?report=genbank&amp;log$=nuclalign">pdb|3J5K|A</a>
+                    <span class=b>Length:</span> 2903
+                    <span class=b>Number of Matches:</span> 4
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 961 to 976</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804730?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804730?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2 bits(16)</td>
+                      <td>0.0</td>
+                      <td>16/16(100%)</td>
+                      <td>0/16(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAAGAG  16
+                ||||||||||||||||
+Subject    961  CGTCCGTCGTGAAGAG  976</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2591 to 2598</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804730?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804730?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2591  CGTCGTGA  2598</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 839 to 845</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804730?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804730?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAA  13
+                |||||||
+Subject    839  TCGTGAA  845</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 2027 to 2033</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804730?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804730?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2027  GTGAAGA  2033</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit2>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description2">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804675?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804675?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Post- Translocation State (post3b, 50s Subunit)</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804675?report=genbank&amp;log$=nuclalign">pdb|3J5I|A</a>
+                    <span class=b>Length:</span> 2903
+                    <span class=b>Number of Matches:</span> 4
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 961 to 976</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804675?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804675?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2 bits(16)</td>
+                      <td>0.0</td>
+                      <td>16/16(100%)</td>
+                      <td>0/16(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAAGAG  16
+                ||||||||||||||||
+Subject    961  CGTCCGTCGTGAAGAG  976</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2591 to 2598</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804675?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804675?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2591  CGTCGTGA  2598</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 839 to 845</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804675?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804675?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAA  13
+                |||||||
+Subject    839  TCGTGAA  845</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 2027 to 2033</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804675?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804675?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2027  GTGAAGA  2033</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit3>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description3">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804619?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804619?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Post- Translocation State (post3a, 50s Subunit)</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804619?report=genbank&amp;log$=nuclalign">pdb|3J5G|A</a>
+                    <span class=b>Length:</span> 2903
+                    <span class=b>Number of Matches:</span> 4
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 961 to 976</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804619?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804619?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2 bits(16)</td>
+                      <td>0.0</td>
+                      <td>16/16(100%)</td>
+                      <td>0/16(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAAGAG  16
+                ||||||||||||||||
+Subject    961  CGTCCGTCGTGAAGAG  976</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2591 to 2598</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804619?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804619?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2591  CGTCGTGA  2598</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 839 to 845</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804619?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804619?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAA  13
+                |||||||
+Subject    839  TCGTGAA  845</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 2027 to 2033</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804619?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804619?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2027  GTGAAGA  2033</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit4>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description4">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804563?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804563?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Post- Translocation State (post2b, 50s Subunit)</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804563?report=genbank&amp;log$=nuclalign">pdb|3J5E|A</a>
+                    <span class=b>Length:</span> 2903
+                    <span class=b>Number of Matches:</span> 4
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 961 to 976</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804563?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804563?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2 bits(16)</td>
+                      <td>0.0</td>
+                      <td>16/16(100%)</td>
+                      <td>0/16(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAAGAG  16
+                ||||||||||||||||
+Subject    961  CGTCCGTCGTGAAGAG  976</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2591 to 2598</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804563?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804563?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2591  CGTCGTGA  2598</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 839 to 845</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804563?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804563?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAA  13
+                |||||||
+Subject    839  TCGTGAA  845</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 2027 to 2033</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804563?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804563?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2027  GTGAAGA  2033</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit5>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description5">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804507?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804507?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Post- Translocation State (post2a, 50s Subunit)</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804507?report=genbank&amp;log$=nuclalign">pdb|3J5C|A</a>
+                    <span class=b>Length:</span> 2903
+                    <span class=b>Number of Matches:</span> 4
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 961 to 976</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804507?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804507?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2 bits(16)</td>
+                      <td>0.0</td>
+                      <td>16/16(100%)</td>
+                      <td>0/16(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAAGAG  16
+                ||||||||||||||||
+Subject    961  CGTCCGTCGTGAAGAG  976</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2591 to 2598</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804507?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804507?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2591  CGTCGTGA  2598</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 839 to 845</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804507?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804507?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAA  13
+                |||||||
+Subject    839  TCGTGAA  845</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 2027 to 2033</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804507?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804507?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2027  GTGAAGA  2033</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit6>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description6">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804451?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804451?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Classic Post- Translocation State (post1, 50s Subunit)</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804451?report=genbank&amp;log$=nuclalign">pdb|3J5A|A</a>
+                    <span class=b>Length:</span> 2903
+                    <span class=b>Number of Matches:</span> 4
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 961 to 976</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804451?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804451?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2 bits(16)</td>
+                      <td>0.0</td>
+                      <td>16/16(100%)</td>
+                      <td>0/16(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAAGAG  16
+                ||||||||||||||||
+Subject    961  CGTCCGTCGTGAAGAG  976</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2591 to 2598</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804451?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804451?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2591  CGTCGTGA  2598</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 839 to 845</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804451?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804451?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAA  13
+                |||||||
+Subject    839  TCGTGAA  845</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 2027 to 2033</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804451?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804451?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2027  GTGAAGA  2033</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit7>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description7">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804395?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804395?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Hybrid Pre- Translocation State (pre5b, 50s Subunit)</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804395?report=genbank&amp;log$=nuclalign">pdb|3J58|A</a>
+                    <span class=b>Length:</span> 2903
+                    <span class=b>Number of Matches:</span> 4
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 961 to 976</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804395?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804395?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2 bits(16)</td>
+                      <td>0.0</td>
+                      <td>16/16(100%)</td>
+                      <td>0/16(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAAGAG  16
+                ||||||||||||||||
+Subject    961  CGTCCGTCGTGAAGAG  976</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2591 to 2598</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804395?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804395?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2591  CGTCGTGA  2598</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 839 to 845</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804395?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804395?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAA  13
+                |||||||
+Subject    839  TCGTGAA  845</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 2027 to 2033</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804395?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804395?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2027  GTGAAGA  2033</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit8>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description8">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804339?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804339?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Hybrid Pre- Translocation State (pre5a, 50s Subunit)</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804339?report=genbank&amp;log$=nuclalign">pdb|3J56|A</a>
+                    <span class=b>Length:</span> 2903
+                    <span class=b>Number of Matches:</span> 4
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 961 to 976</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804339?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804339?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2 bits(16)</td>
+                      <td>0.0</td>
+                      <td>16/16(100%)</td>
+                      <td>0/16(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAAGAG  16
+                ||||||||||||||||
+Subject    961  CGTCCGTCGTGAAGAG  976</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2591 to 2598</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804339?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804339?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2591  CGTCGTGA  2598</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 839 to 845</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804339?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804339?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAA  13
+                |||||||
+Subject    839  TCGTGAA  845</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 2027 to 2033</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804339?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804339?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2027  GTGAAGA  2033</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit9>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description9">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804283?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804283?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Hybrid Pre- Translocation State (pre4, 50s Subunit)</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804283?report=genbank&amp;log$=nuclalign">pdb|3J54|A</a>
+                    <span class=b>Length:</span> 2903
+                    <span class=b>Number of Matches:</span> 4
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 961 to 976</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804283?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804283?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2 bits(16)</td>
+                      <td>0.0</td>
+                      <td>16/16(100%)</td>
+                      <td>0/16(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAAGAG  16
+                ||||||||||||||||
+Subject    961  CGTCCGTCGTGAAGAG  976</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2591 to 2598</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804283?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804283?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2591  CGTCGTGA  2598</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 839 to 845</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804283?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804283?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAA  13
+                |||||||
+Subject    839  TCGTGAA  845</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 2027 to 2033</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804283?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804283?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2027  GTGAAGA  2033</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit10>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description10">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804227?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804227?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Classic Pre- Translocation State (pre1a, 50s Subunit)</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804227?report=genbank&amp;log$=nuclalign">pdb|3J52|A</a>
+                    <span class=b>Length:</span> 2903
+                    <span class=b>Number of Matches:</span> 4
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 961 to 976</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804227?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804227?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2 bits(16)</td>
+                      <td>0.0</td>
+                      <td>16/16(100%)</td>
+                      <td>0/16(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAAGAG  16
+                ||||||||||||||||
+Subject    961  CGTCCGTCGTGAAGAG  976</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2591 to 2598</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804227?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804227?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2591  CGTCGTGA  2598</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 839 to 845</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804227?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804227?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAA  13
+                |||||||
+Subject    839  TCGTGAA  845</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 2027 to 2033</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804227?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804227?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2027  GTGAAGA  2033</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit11>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description11">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804195?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804195?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Pre- Translocation State (pre3, 50s Subunit)</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804195?report=genbank&amp;log$=nuclalign">pdb|3J51|A</a>
+                    <span class=b>Length:</span> 2903
+                    <span class=b>Number of Matches:</span> 4
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 961 to 976</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804195?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804195?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2 bits(16)</td>
+                      <td>0.0</td>
+                      <td>16/16(100%)</td>
+                      <td>0/16(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAAGAG  16
+                ||||||||||||||||
+Subject    961  CGTCCGTCGTGAAGAG  976</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2591 to 2598</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804195?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804195?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2591  CGTCGTGA  2598</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 839 to 845</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804195?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804195?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAA  13
+                |||||||
+Subject    839  TCGTGAA  845</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 2027 to 2033</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804195?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804195?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2027  GTGAAGA  2033</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit12>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description12">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804163?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804163?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Pre- Translocation State (pre2, 50s Subunit)</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804163?report=genbank&amp;log$=nuclalign">pdb|3J50|A</a>
+                    <span class=b>Length:</span> 2903
+                    <span class=b>Number of Matches:</span> 4
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 961 to 976</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804163?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804163?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2 bits(16)</td>
+                      <td>0.0</td>
+                      <td>16/16(100%)</td>
+                      <td>0/16(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAAGAG  16
+                ||||||||||||||||
+Subject    961  CGTCCGTCGTGAAGAG  976</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2591 to 2598</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804163?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804163?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2591  CGTCGTGA  2598</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 839 to 845</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804163?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804163?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAA  13
+                |||||||
+Subject    839  TCGTGAA  845</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 2027 to 2033</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804163?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804163?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2027  GTGAAGA  2033</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit13>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description13">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804083?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804083?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Classic Pre- Translocation State (pre1b, 50s Subunit)</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804083?report=genbank&amp;log$=nuclalign">pdb|3J4X|A</a>
+                    <span class=b>Length:</span> 2903
+                    <span class=b>Number of Matches:</span> 4
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 961 to 976</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804083?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804083?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2 bits(16)</td>
+                      <td>0.0</td>
+                      <td>16/16(100%)</td>
+                      <td>0/16(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAAGAG  16
+                ||||||||||||||||
+Subject    961  CGTCCGTCGTGAAGAG  976</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2591 to 2598</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804083?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804083?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2591  CGTCGTGA  2598</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 839 to 845</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804083?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804083?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAA  13
+                |||||||
+Subject    839  TCGTGAA  845</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 2027 to 2033</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804083?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804083?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2027  GTGAAGA  2033</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit14>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description14">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/474452808?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/474452808?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, Tetracycline Resistance Protein Tet(o) Bound To The Ribosome</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/474452808?report=genbank&amp;log$=nuclalign">pdb|3J37|A</a>
+                    <span class=b>Length:</span> 2904
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 961 to 976</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/474452808?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/474452808?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2 bits(16)</td>
+                      <td>0.0</td>
+                      <td>16/16(100%)</td>
+                      <td>0/16(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAAGAG  16
+                ||||||||||||||||
+Subject    961  CGTCCGTCGTGAAGAG  976</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2591 to 2598</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/474452808?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/474452808?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2591  CGTCGTGA  2598</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 839 to 845</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/474452808?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/474452808?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAA  13
+                |||||||
+Subject    839  TCGTGAA  845</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit15>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description15">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/326634210?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/326634210?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain B, Structural Insights Into Cognate Vs. Near-Cognate Discrimination During Decoding. This Entry Contains The Large Subunit Of A Ribosome Programmed With A Near-Cognate Codon. </p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/326634210?report=genbank&amp;log$=nuclalign">pdb|3IZT|B</a>
+                    <span class=b>Length:</span> 2904
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+                <a class=showmoretitles onclick="toggle_visibility('moretitles15'); return false;" href=''>
+                  See 7 more title(s)
+                </a>
+
+                <div class=moretitles id=moretitles15 style="display: none">
+                  <div class=title>
+                    <p class=hittitle>Chain B, Structural Insights Into Cognate Vs. Near-Cognate Discrimination During Decoding. This Entry Contains The Large Subunit Of A Ribosome Programmed With A Cognate Codon </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/326634243?report=genbank&amp;log$=nuclalign">pdb|3IZU|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Structural Characterization Of Mrna-Trna Translocation Intermediates (50s Ribosome Of Class2 Of The Six Classes) </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/380763703?report=genbank&amp;log$=nuclalign">pdb|3J0T|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Structural Characterization Of Mrna-Trna Translocation Intermediates (50s Ribosome Of Class 4a Of The Six Classes) </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/380763785?report=genbank&amp;log$=nuclalign">pdb|3J0W|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Structural Characterization Of Mrna-Trna Translocation Intermediates (50s Ribosome Of Class 4b Of The Six Classes) </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/380763843?report=genbank&amp;log$=nuclalign">pdb|3J0Y|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Structural Characterization Of Mrna-Trna Translocation Intermediates (50s Ribosome Of Class 3 Of The Six Classes) </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/380763925?report=genbank&amp;log$=nuclalign">pdb|3J11|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Structural Characterization Of Mrna-Trna Translocation Intermediates (50s Ribosome Of Class 5 Of The Six Classes) </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/380763959?report=genbank&amp;log$=nuclalign">pdb|3J12|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Structural Characterization Of Mrna-Trna Translocation Intermediates (50s Ribosome Of Class 6 Of The Six Classes)</p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/380764016?report=genbank&amp;log$=nuclalign">pdb|3J14|B</a>
+                    </p>
+                  </div>
+                </div>
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 961 to 976</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/326634210?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/326634210?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2 bits(16)</td>
+                      <td>0.0</td>
+                      <td>16/16(100%)</td>
+                      <td>0/16(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAAGAG  16
+                ||||||||||||||||
+Subject    961  CGTCCGTCGTGAAGAG  976</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2591 to 2598</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/326634210?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/326634210?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2591  CGTCGTGA  2598</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 839 to 845</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/326634210?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/326634210?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAA  13
+                |||||||
+Subject    839  TCGTGAA  845</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit16>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description16">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/224510767?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/224510767?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain B, Ternary Complex-Bound E.Coli 70s Ribosome. This Entry Consists Of The 50s Subunit. </p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/224510767?report=genbank&amp;log$=nuclalign">pdb|3FIK|B</a>
+                    <span class=b>Length:</span> 2903
+                    <span class=b>Number of Matches:</span> 4
+                  </p>
+                </div>
+
+                <a class=showmoretitles onclick="toggle_visibility('moretitles16'); return false;" href=''>
+                  See 19 more title(s)
+                </a>
+
+                <div class=moretitles id=moretitles16 style="display: none">
+                  <div class=title>
+                    <p class=hittitle>Chain A, Crystal Structure Of The E. Coli 70s Ribosome In An Intermediate State Of Ratcheting </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/257097373?report=genbank&amp;log$=nuclalign">pdb|3I1N|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Crystal Structure Of The E. Coli 70s Ribosome In An Intermediate State Of Ratcheting </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/257097425?report=genbank&amp;log$=nuclalign">pdb|3I1P|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Crystal Structure Of The E. Coli 70s Ribosome In An Intermediate State Of Ratcheting </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/257097479?report=genbank&amp;log$=nuclalign">pdb|3I1R|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Crystal Structure Of The E. Coli 70s Ribosome In An Intermediate State Of Ratcheting </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/257097533?report=genbank&amp;log$=nuclalign">pdb|3I1T|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Crystal Structure Of The E. Coli 70s Ribosome In An Intermediate State Of Ratcheting </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/257097588?report=genbank&amp;log$=nuclalign">pdb|3I20|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Crystal Structure Of The E. Coli 70s Ribosome In An Intermediate State Of Ratcheting </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/257097643?report=genbank&amp;log$=nuclalign">pdb|3I22|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, E.Coli 70s Ribosome Stalled During Translation Of Tnac Leader Peptide. This File Contains The 50s, The P-Site Trna And The Tnac Leader Peptide (Part 2 Of 2). </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/294662251?report=genbank&amp;log$=nuclalign">pdb|2WWQ|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Crystal Structure Of The E. Coli Ribosome Bound To Chloramphenicol. This File Contains The 50s Subunit Of The First 70s Ribosome With Chloramphenicol Bound. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/309320065?report=genbank&amp;log$=nuclalign">pdb|3OFC|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Crystal Structure Of The E. Coli Ribosome Bound To Clindamycin. This File Contains The 50s Subunit Of The First 70s Ribosome Bound To Clindamycin. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/309320169?report=genbank&amp;log$=nuclalign">pdb|3OFZ|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Crystal Structure Of The E. Coli Ribosome Bound To Clindamycin. This File Contains The 50s Subunit Of The Second 70s Ribosome. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/309320200?report=genbank&amp;log$=nuclalign">pdb|3OG0|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Crystal Structure Of The E. Coli Ribosome Bound To Telithromycin. This File Contains The 50s Subunit Of The Second 70s Ribosome. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/315113654?report=genbank&amp;log$=nuclalign">pdb|3OAS|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Crystal Structure Of The E. Coli Ribosome Bound To Telithromycin. This File Contains The 50s Subunit Of The First 70s Ribosome With Telithromycin Bound. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/315113685?report=genbank&amp;log$=nuclalign">pdb|3OAT|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Structures Of The Bacterial Ribosome In Classical And Hybrid States Of Trna Binding </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/334359437?report=genbank&amp;log$=nuclalign">pdb|3R8S|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Structures Of The Bacterial Ribosome In Classical And Hybrid States Of Trna Binding </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/334359468?report=genbank&amp;log$=nuclalign">pdb|3R8T|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Crystal Structure Of Release Factor Rf3 Trapped In The Gtp State On A Rotated Conformation Of The Ribosome </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/371927526?report=genbank&amp;log$=nuclalign">pdb|3SGF|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Crystal Structure Of Release Factor Rf3 Trapped In The Gtp State On A Rotated Conformation Of The Ribosome (Without Viomycin) </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/371927651?report=genbank&amp;log$=nuclalign">pdb|3UOS|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Structure Of The Bacterial Ribosome Complexed By Tmrna-Smpb And Ef-G During Translocation And Mld-Loading (50s Subunit) </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/386783121?report=genbank&amp;log$=nuclalign">pdb|3J19|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Structure Of The Ribosome With Elongation Factor G Trapped In The Pre- Translocation State (pre-translocation 70s*trna Structure, 50s Subunit) </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/567754995?report=genbank&amp;log$=nuclalign">pdb|3J5U|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Structure Of The Ribosome With Elongation Factor G Trapped In The Pre- Translocation State (pre-translocation 70s*trna*ef-g Structure, 50s Subunit)</p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/567755029?report=genbank&amp;log$=nuclalign">pdb|3J5W|A</a>
+                    </p>
+                  </div>
+                </div>
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 961 to 976</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/224510767?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/224510767?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2 bits(16)</td>
+                      <td>0.0</td>
+                      <td>16/16(100%)</td>
+                      <td>0/16(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAAGAG  16
+                ||||||||||||||||
+Subject    961  CGTCCGTCGTGAAGAG  976</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2591 to 2598</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/224510767?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/224510767?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2591  CGTCGTGA  2598</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 839 to 845</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/224510767?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/224510767?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAA  13
+                |||||||
+Subject    839  TCGTGAA  845</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 2027 to 2033</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/224510767?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/224510767?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2027  GTGAAGA  2033</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit17>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description17">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/256032374?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/256032374?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain B, Structure Of The 50s Subunit Of E. Coli Ribosome In Pre-Accommodation State </p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/256032374?report=genbank&amp;log$=nuclalign">pdb|3E1B|B</a>
+                    <span class=b>Length:</span> 2903
+                    <span class=b>Number of Matches:</span> 4
+                  </p>
+                </div>
+
+                <a class=showmoretitles onclick="toggle_visibility('moretitles17'); return false;" href=''>
+                  See 1 more title(s)
+                </a>
+
+                <div class=moretitles id=moretitles17 style="display: none">
+                  <div class=title>
+                    <p class=hittitle>Chain B, Structure Of The 50s Subunit Of E. Coli Ribosome In Post-Accommodation State</p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/256032431?report=genbank&amp;log$=nuclalign">pdb|3E1D|B</a>
+                    </p>
+                  </div>
+                </div>
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 961 to 976</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/256032374?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/256032374?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2 bits(16)</td>
+                      <td>0.0</td>
+                      <td>16/16(100%)</td>
+                      <td>0/16(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAAGAG  16
+                ||||||||||||||||
+Subject    961  CGTCCGTCGTGAAGAG  976</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2591 to 2598</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/256032374?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/256032374?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2591  CGTCGTGA  2598</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 839 to 845</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/256032374?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/256032374?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAA  13
+                |||||||
+Subject    839  TCGTGAA  845</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 2027 to 2033</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/256032374?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/256032374?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2027  GTGAAGA  2033</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit18>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description18">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/157883716?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/157883716?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, Structure Of The 50s Subunit Of A Secm-Stalled E. Coli Ribosome Complex Obtained By Fitting Atomic Models For Rna And Protein Components Into Cryo-Em Map Emd-1143</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/157883716?report=genbank&amp;log$=nuclalign">pdb|2GYC|0</a>
+                    <span class=b>Length:</span> 2740
+                    <span class=b>Number of Matches:</span> 4
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 889 to 904</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883716?report=genbank&amp;log$=nuclalign&amp;from=889&amp;to=904">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883716?report=graph&amp;log$=nuclalign&amp;from=889&amp;to=904">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2 bits(16)</td>
+                      <td>0.0</td>
+                      <td>16/16(100%)</td>
+                      <td>0/16(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAAGAG  16
+                ||||||||||||||||
+Subject    889  CGTCCGTCGTGAAGAG  904</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2453 to 2460</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883716?report=genbank&amp;log$=nuclalign&amp;from=2453&amp;to=2460">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883716?report=graph&amp;log$=nuclalign&amp;from=2453&amp;to=2460">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2453  CGTCGTGA  2460</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 776 to 782</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883716?report=genbank&amp;log$=nuclalign&amp;from=776&amp;to=782">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883716?report=graph&amp;log$=nuclalign&amp;from=776&amp;to=782">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAA  13
+                |||||||
+Subject    776  TCGTGAA  782</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 1910 to 1916</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883716?report=genbank&amp;log$=nuclalign&amp;from=1910&amp;to=1916">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883716?report=graph&amp;log$=nuclalign&amp;from=1910&amp;to=1916">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   1910  GTGAAGA  1916</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit19>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description19">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/157883710?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/157883710?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, Structure Of The 50s Subunit Of A Pre-Translocational E. Coli Ribosome Obtained By Fitting Atomic Models For Rna And Protein Components Into Cryo-Em Map Emd-1056</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/157883710?report=genbank&amp;log$=nuclalign">pdb|2GYA|0</a>
+                    <span class=b>Length:</span> 2740
+                    <span class=b>Number of Matches:</span> 4
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 889 to 904</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883710?report=genbank&amp;log$=nuclalign&amp;from=889&amp;to=904">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883710?report=graph&amp;log$=nuclalign&amp;from=889&amp;to=904">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2 bits(16)</td>
+                      <td>0.0</td>
+                      <td>16/16(100%)</td>
+                      <td>0/16(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAAGAG  16
+                ||||||||||||||||
+Subject    889  CGTCCGTCGTGAAGAG  904</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2453 to 2460</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883710?report=genbank&amp;log$=nuclalign&amp;from=2453&amp;to=2460">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883710?report=graph&amp;log$=nuclalign&amp;from=2453&amp;to=2460">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2453  CGTCGTGA  2460</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 776 to 782</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883710?report=genbank&amp;log$=nuclalign&amp;from=776&amp;to=782">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883710?report=graph&amp;log$=nuclalign&amp;from=776&amp;to=782">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAA  13
+                |||||||
+Subject    776  TCGTGAA  782</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 1910 to 1916</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883710?report=genbank&amp;log$=nuclalign&amp;from=1910&amp;to=1916">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883710?report=graph&amp;log$=nuclalign&amp;from=1910&amp;to=1916">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   1910  GTGAAGA  1916</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit20>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description20">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/122922257?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/122922257?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain B, Crystal Structure Of Ribosome With Messenger Rna And The Anticodon Stem-Loop Of P-Site Trna. This File Contains The 50s Subunit Of One 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400.</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/122922257?report=genbank&amp;log$=nuclalign">pdb|2I2V|B</a>
+                    <span class=b>Length:</span> 2904
+                    <span class=b>Number of Matches:</span> 4
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 961 to 976</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/122922257?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/122922257?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2 bits(16)</td>
+                      <td>0.0</td>
+                      <td>16/16(100%)</td>
+                      <td>0/16(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAAGAG  16
+                ||||||||||||||||
+Subject    961  CGTCCGTCGTGAAGAG  976</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2591 to 2598</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/122922257?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/122922257?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2591  CGTCGTGA  2598</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 839 to 845</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/122922257?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/122922257?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAA  13
+                |||||||
+Subject    839  TCGTGAA  845</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 2027 to 2033</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/122922257?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/122922257?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2027  GTGAAGA  2033</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit21>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description21">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/83754062?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/83754062?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli At 3.5 A Resolution. This File Contains The 50s Subunit Of One 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83754062?report=genbank&amp;log$=nuclalign">pdb|2AW4|B</a>
+                    <span class=b>Length:</span> 2904
+                    <span class=b>Number of Matches:</span> 4
+                  </p>
+                </div>
+
+                <a class=showmoretitles onclick="toggle_visibility('moretitles21'); return false;" href=''>
+                  See 38 more title(s)
+                </a>
+
+                <div class=moretitles id=moretitles21 style="display: none">
+                  <div class=title>
+                    <p class=hittitle>Chain B, Crystal Structure Of Ribosome With Messenger Rna And The Anticodon Stem-Loop Of P-Site Trna. This File Contains The 50s Subunit Of One 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/122922241?report=genbank&amp;log$=nuclalign">pdb|2I2T|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Spectinomycin. This File Contains The 50s Subunit Of The First 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/157836046?report=genbank&amp;log$=nuclalign">pdb|2QOV|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Spectinomycin. This File Contains The 50s Subunit Of The Second 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/157836098?report=genbank&amp;log$=nuclalign">pdb|2QOX|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Spectinomycin And Neomycin. This File Contains The 50s Subunit Of The First 70s Ribosome, With Neomycin Bound. The Entire Crystal Structure Contains Two 70s Ribosomes. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/157836150?report=genbank&amp;log$=nuclalign">pdb|2QOZ|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Spectinomycin And Neomycin. This File Contains The 50s Subunit Of The Second 70s Ribosome, With Neomycin Bound. The Entire Crystal Structure Contains Two 70s Ribosomes. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/157836202?report=genbank&amp;log$=nuclalign">pdb|2QP1|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Neomycin. This File Contains The 50s Subunit Of The First 70s Ribosome, With Neomycin Bound. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/158429721?report=genbank&amp;log$=nuclalign">pdb|2QAM|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Neomycin. This File Contains The 50s Subunit Of The Second 70s Ribosome, With Neomycin Bound. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/158429773?report=genbank&amp;log$=nuclalign">pdb|2QAO|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Gentamicin. This File Contains The 50s Subunit Of The First 70s Ribosome, With Gentamicin Bound. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/158429831?report=genbank&amp;log$=nuclalign">pdb|2QBA|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Gentamicin. This File Contains The 50s Subunit Of The Second 70s Ribosome, With Gentamicin Bound. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/158429883?report=genbank&amp;log$=nuclalign">pdb|2QBC|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Ribosome Recycling Factor (Rrf). This File Contains The 50s Subunit Of The First 70s Ribosome, With Rrf Bound. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/158429935?report=genbank&amp;log$=nuclalign">pdb|2QBE|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Ribosome Recycling Factor (Rrf). This File Contains The 50s Subunit Of The Second 70s Ribosome, With Rrf Bound. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/158429988?report=genbank&amp;log$=nuclalign">pdb|2QBG|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Gentamicin And Ribosome Recycling Factor (Rrf). This File Contains The 50s Subunit Of The First 70s Ribosome, With Gentamicin And Rrf Bound. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/158430041?report=genbank&amp;log$=nuclalign">pdb|2QBI|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Gentamicin And Ribosome Recycling Factor (Rrf). This File Contains The 50s Subunit Of The Second 70s Ribosome, With Gentamicin And Rrf Bound. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/158430094?report=genbank&amp;log$=nuclalign">pdb|2QBK|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Paromomycin And Ribosome Recycling Factor (Rrf). This File Contains The 50s Subunit Of The First 70s Ribosome, With Paromomycin And Rrf Bound. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/158431394?report=genbank&amp;log$=nuclalign">pdb|2Z4L|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Paromomycin And Ribosome Recycling Factor (Rrf). This File Contains The 50s Subunit Of The Second 70s Ribosome, With Paromomycin And Rrf Bound. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/158431447?report=genbank&amp;log$=nuclalign">pdb|2Z4N|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Structure Of Pdf Binding Helix In Complex With The Ribosome (Part 1 Of 4) </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/168988732?report=genbank&amp;log$=nuclalign">pdb|2VHM|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Structure Of Pdf Binding Helix In Complex With The Ribosome. (Part 2 Of 4) </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/168988763?report=genbank&amp;log$=nuclalign">pdb|2VHN|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, 50s Subunit With Ef-G(Gdpnp) And Rrf Bound </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/169404603?report=genbank&amp;log$=nuclalign">pdb|2RDO|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Hygromycin B. This File Contains The 50s Subunit Of The First 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/197107301?report=genbank&amp;log$=nuclalign">pdb|3DF2|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Hygromycin B. This File Contains The 50s Subunit Of The Second 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/197107353?report=genbank&amp;log$=nuclalign">pdb|3DF4|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 8, Ribosome-Secy Complex. This Entry 3kcr Contains 50s Ribosomal Subnit. The 30s Ribosomal Subunit Can Be Found In Pdb Entry 3kc4 </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/290560329?report=genbank&amp;log$=nuclalign">pdb|3KCR|8</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Crystal Structure Of The E. Coli Ribosome Bound To Cem-101. This File Contains The 50s Subunit Of The First 70s Ribosome Bound To Cem-101. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/308198729?report=genbank&amp;log$=nuclalign">pdb|3ORB|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Crystal Structure Of The E. Coli Ribosome Bound To Erythromycin. This File Contains The 50s Subunit Of The Second 70s Ribosome. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/308388007?report=genbank&amp;log$=nuclalign">pdb|3OFQ|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Crystal Structure Of The E. Coli Ribosome Bound To Erythromycin. This File Contains The 50s Subunit Of The First 70s Ribosome With Erthromycin Bound. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/308388038?report=genbank&amp;log$=nuclalign">pdb|3OFR|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Crystal Structure Of The E. Coli Ribosome Bound To Chloramphenicol. This File Contains The 50s Subunit Of The Second 70s Ribosome. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/309320096?report=genbank&amp;log$=nuclalign">pdb|3OFD|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 8, Structure Of The Ribosome-Secye Complex In The Membrane Environment </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/329666014?report=genbank&amp;log$=nuclalign">pdb|3J01|8</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Allosteric Control Of The Ribosome By Small-Molecule Antibiotics </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/402550607?report=genbank&amp;log$=nuclalign">pdb|4GAR|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Allosteric Control Of The Ribosome By Small-Molecule Antibiotics </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/402550662?report=genbank&amp;log$=nuclalign">pdb|4GAU|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Control Of Ribosomal Subunit Rotation By Elongation Factor G </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/524934273?report=genbank&amp;log$=nuclalign">pdb|4KIX|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Control Of Ribosomal Subunit Rotation By Elongation Factor G </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/524934341?report=genbank&amp;log$=nuclalign">pdb|4KIZ|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Control Of Ribosomal Subunit Rotation By Elongation Factor G </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/524934404?report=genbank&amp;log$=nuclalign">pdb|4KJ1|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Control Of Ribosomal Subunit Rotation By Elongation Factor G </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/524934483?report=genbank&amp;log$=nuclalign">pdb|4KJ3|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Control Of Ribosomal Subunit Rotation By Elongation Factor G </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/524934551?report=genbank&amp;log$=nuclalign">pdb|4KJ5|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Control Of Ribosomal Subunit Rotation By Elongation Factor G </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/524934613?report=genbank&amp;log$=nuclalign">pdb|4KJ7|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Control Of Ribosomal Subunit Rotation By Elongation Factor G </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/524934678?report=genbank&amp;log$=nuclalign">pdb|4KJ9|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Control Of Ribosomal Subunit Rotation By Elongation Factor G </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/524934740?report=genbank&amp;log$=nuclalign">pdb|4KJB|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Visualization Of Two Trnas Trapped In Transit During Ef-g-mediated Translocation (50s Subunit) </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/564730763?report=genbank&amp;log$=nuclalign">pdb|3J5O|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Structure Of The E. Coli 50s Subunit With Ermbl Nascent Chain</p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/597959819?report=genbank&amp;log$=nuclalign">pdb|3J5L|A</a>
+                    </p>
+                  </div>
+                </div>
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 961 to 976</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754062?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754062?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2 bits(16)</td>
+                      <td>0.0</td>
+                      <td>16/16(100%)</td>
+                      <td>0/16(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAAGAG  16
+                ||||||||||||||||
+Subject    961  CGTCCGTCGTGAAGAG  976</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2591 to 2598</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754062?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754062?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2591  CGTCGTGA  2598</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 839 to 845</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754062?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754062?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAA  13
+                |||||||
+Subject    839  TCGTGAA  845</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 2027 to 2033</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754062?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754062?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2027  GTGAAGA  2033</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit22>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description22">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/83754118?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/83754118?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli At 3.5 A Resolution. This File Contains The 50s Subunit Of The Second 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83754118?report=genbank&amp;log$=nuclalign">pdb|2AWB|B</a>
+                    <span class=b>Length:</span> 2904
+                    <span class=b>Number of Matches:</span> 4
+                  </p>
+                </div>
+
+                <a class=showmoretitles onclick="toggle_visibility('moretitles22'); return false;" href=''>
+                  See 2 more title(s)
+                </a>
+
+                <div class=moretitles id=moretitles22 style="display: none">
+                  <div class=title>
+                    <p class=hittitle>Chain B, Model Of E. Coli Srp Bound To 70s Rncs </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/126031747?report=genbank&amp;log$=nuclalign">pdb|2J28|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With The Antibiotic Kasugamyin At 3.5a Resolution. This File Contains The 50s Subunit Of One 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400.</p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/157880574?report=genbank&amp;log$=nuclalign">pdb|1VS8|B</a>
+                    </p>
+                  </div>
+                </div>
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 961 to 976</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754118?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754118?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2 bits(16)</td>
+                      <td>0.0</td>
+                      <td>16/16(100%)</td>
+                      <td>0/16(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAAGAG  16
+                ||||||||||||||||
+Subject    961  CGTCCGTCGTGAAGAG  976</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2591 to 2598</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754118?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754118?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2591  CGTCGTGA  2598</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 839 to 845</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754118?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754118?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAA  13
+                |||||||
+Subject    839  TCGTGAA  845</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 2027 to 2033</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754118?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754118?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2027  GTGAAGA  2033</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit23>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description23">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/157880571?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/157880571?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With The Antibiotic Kasugamyin At 3.5a Resolution. This File Contains The 50s Subunit Of One 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/157880571?report=genbank&amp;log$=nuclalign">pdb|1VS6|B</a>
+                    <span class=b>Length:</span> 2904
+                    <span class=b>Number of Matches:</span> 4
+                  </p>
+                </div>
+
+                <a class=showmoretitles onclick="toggle_visibility('moretitles23'); return false;" href=''>
+                  See 6 more title(s)
+                </a>
+
+                <div class=moretitles id=moretitles23 style="display: none">
+                  <div class=title>
+                    <p class=hittitle>Chain B, The Hsp15 Protein Fitted Into The Low Resolution Cryo-Em Map 50s.Nc-Trna.Hsp15 Complex </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/209870354?report=genbank&amp;log$=nuclalign">pdb|3BBX|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Coordinates Of 16s And 23s Rrnas Fitted Into The Cryo-Em Map Of Ef-G-Bound Translocation Complex </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/222447037?report=genbank&amp;log$=nuclalign">pdb|3DG0|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Coordinates Of 16s And 23s Rrnas Fitted Into The Cryo-Em Map Of A Pretranslocation Complex </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/222447039?report=genbank&amp;log$=nuclalign">pdb|3DG2|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Coordinates Of 16s And 23s Rrnas Fitted Into The Cryo-Em Map Of Rf1-Bound Termination Complex </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/222447041?report=genbank&amp;log$=nuclalign">pdb|3DG4|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain B, Coordinates Of 16s And 23s Rrnas Fitted Into The Cryo-Em Map Of Rf3-Bound Termination Complex </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/222447043?report=genbank&amp;log$=nuclalign">pdb|3DG5|B</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Crystal Structure Of The E. Coli Ribosome Bound To Cem-101. This File Contains The 50s Subunit Of The Second 70s Ribosome.</p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/308198355?report=genbank&amp;log$=nuclalign">pdb|1VT2|A</a>
+                    </p>
+                  </div>
+                </div>
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 961 to 976</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157880571?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157880571?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2 bits(16)</td>
+                      <td>0.0</td>
+                      <td>16/16(100%)</td>
+                      <td>0/16(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAAGAG  16
+                ||||||||||||||||
+Subject    961  CGTCCGTCGTGAAGAG  976</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2591 to 2598</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157880571?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157880571?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2591  CGTCGTGA  2598</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 839 to 845</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157880571?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157880571?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAA  13
+                |||||||
+Subject    839  TCGTGAA  845</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 2027 to 2033</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157880571?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157880571?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2027  GTGAAGA  2033</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit24>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description24">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/33357900?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/33357900?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, Real Space Refined Coordinates Of The 50s Subunit Fitted Into The Low Resolution Cryo-Em Map Of The Ef-G.Gtp State Of E. Coli 70s Ribosome </p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/33357900?report=genbank&amp;log$=nuclalign">pdb|1P85|0</a>
+                    <span class=b>Length:</span> 2904
+                    <span class=b>Number of Matches:</span> 4
+                  </p>
+                </div>
+
+                <a class=showmoretitles onclick="toggle_visibility('moretitles24'); return false;" href=''>
+                  See 1 more title(s)
+                </a>
+
+                <div class=moretitles id=moretitles24 style="display: none">
+                  <div class=title>
+                    <p class=hittitle>Chain 0, Real Space Refined Coordinates Of The 50s Subunit Fitted Into The Low Resolution Cryo-Em Map Of The Initiation-Like State Of E. Coli 70s Ribosome</p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/33357927?report=genbank&amp;log$=nuclalign">pdb|1P86|0</a>
+                    </p>
+                  </div>
+                </div>
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 961 to 976</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/33357900?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/33357900?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2 bits(16)</td>
+                      <td>0.0</td>
+                      <td>16/16(100%)</td>
+                      <td>0/16(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAAGAG  16
+                ||||||||||||||||
+Subject    961  CGTCCGTCGTGAAGAG  976</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2591 to 2598</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/33357900?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/33357900?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2591  CGTCGTGA  2598</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 839 to 845</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/33357900?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/33357900?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAA  13
+                |||||||
+Subject    839  TCGTGAA  845</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 2027 to 2033</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/33357900?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/33357900?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2027  GTGAAGA  2033</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit25>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description25">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/7767146?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/7767146?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain B, 23s Rrna Structure Fitted To A Cryo-Electron Microscopic Map At 7.5 Angstroms Resolution</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/7767146?report=genbank&amp;log$=nuclalign">pdb|1C2W|B</a>
+                    <span class=b>Length:</span> 2904
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 961 to 973</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/7767146?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=973">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/7767146?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=973">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>26.3 bits(13)</td>
+                      <td>0.0</td>
+                      <td>13/13(100%)</td>
+                      <td>0/13(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAA  13
+                |||||||||||||
+Subject    961  CGTCCGTCGTGAA  973</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 839 to 845</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/7767146?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/7767146?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAA  13
+                |||||||
+Subject    839  TCGTGAA  845</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit30>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description30">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/551701574?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/551701574?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 1, Structure Of The Methanococcus Jannaschii Ribosome-secyebeta Channel Complex (50s Ribosomal Subunit)</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/551701574?report=genbank&amp;log$=nuclalign">pdb|3J44|1</a>
+                    <span class=b>Length:</span> 3049
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 651 to 663</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/551701574?report=genbank&amp;log$=nuclalign&amp;from=651&amp;to=663">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/551701574?report=graph&amp;log$=nuclalign&amp;from=651&amp;to=663">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>12/13(92%)</td>
+                      <td>0/13(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAA  13
+                |||||||| ||||
+Subject    651  CGTCCGTCTTGAA  663</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2705 to 2713</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/551701574?report=genbank&amp;log$=nuclalign&amp;from=2705&amp;to=2713">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/551701574?report=graph&amp;log$=nuclalign&amp;from=2705&amp;to=2713">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2705  CCGTCGTGA  2713</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit35>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description35">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/428697991?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/428697991?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 1, Promiscuous Behavior Of Proteins In Archaeal Ribosomes Revealed By Cryo-em: Implications For Evolution Of Eukaryotic Ribosomes (50s Ribosomal Rna)</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/428697991?report=genbank&amp;log$=nuclalign">pdb|3J2L|1</a>
+                    <span class=b>Length:</span> 3049
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 651 to 663</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/428697991?report=genbank&amp;log$=nuclalign&amp;from=651&amp;to=663">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/428697991?report=graph&amp;log$=nuclalign&amp;from=651&amp;to=663">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>12/13(92%)</td>
+                      <td>0/13(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAA  13
+                |||||||| ||||
+Subject    651  CGTCCGTCTTGAA  663</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2705 to 2713</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/428697991?report=genbank&amp;log$=nuclalign&amp;from=2705&amp;to=2713">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/428697991?report=graph&amp;log$=nuclalign&amp;from=2705&amp;to=2713">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2705  CCGTCGTGA  2713</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit26>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description26">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain a, Model Of The Large Subunit Rna Based On A 5.5 A Cryo-em Map Of Triticum Aestivum Translating 80s Ribosome</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=genbank&amp;log$=nuclalign">pdb|3J62|AA</a>
+                    <span class=b>Length:</span> 3391
+                    <span class=b>Number of Matches:</span> 5
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2961 to 2969</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=genbank&amp;log$=nuclalign&amp;from=2961&amp;to=2969">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=graph&amp;log$=nuclalign&amp;from=2961&amp;to=2969">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2961  CCGTCGTGA  2969</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 177 to 170</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=genbank&amp;log$=nuclalign&amp;from=177&amp;to=170">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=graph&amp;log$=nuclalign&amp;from=177&amp;to=170">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        2  GTCCGTCG  9
+                ||||||||
+Subject    177  GTCCGTCG  170</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 553 to 559</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=genbank&amp;log$=nuclalign&amp;from=553&amp;to=559">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=graph&amp;log$=nuclalign&amp;from=553&amp;to=559">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGT  10
+                |||||||
+Subject    553  CCGTCGT  559</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 2048 to 2042</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=genbank&amp;log$=nuclalign&amp;from=2048&amp;to=2042">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=graph&amp;log$=nuclalign&amp;from=2048&amp;to=2042">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        2  GTCCGTC  8
+                |||||||
+Subject   2048  GTCCGTC  2042</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 5: 2211 to 2217</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=genbank&amp;log$=nuclalign&amp;from=2211&amp;to=2217">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=graph&amp;log$=nuclalign&amp;from=2211&amp;to=2217">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2211  GTGAAGA  2217</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit27>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description27">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/567755268?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/567755268?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, 39s Large Subunit Of The Porcine Mitochondrial Ribosome</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/567755268?report=genbank&amp;log$=nuclalign">pdb|4CE4|A</a>
+                    <span class=b>Length:</span> 1570
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 1020 to 1028</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/567755268?report=genbank&amp;log$=nuclalign&amp;from=1020&amp;to=1028">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/567755268?report=graph&amp;log$=nuclalign&amp;from=1020&amp;to=1028">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        8  CGTGAAGAG  16
+                |||||||||
+Subject   1020  CGTGAAGAG  1028</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit28>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description28">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 5, Cryo-em Reconstruction Of The 80s-eif5b-met-itrnamet Eukaryotic Translation Initiation Complex</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=genbank&amp;log$=nuclalign">pdb|4BYP|5</a>
+                    <span class=b>Length:</span> 3396
+                    <span class=b>Number of Matches:</span> 5
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2959 to 2967</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=genbank&amp;log$=nuclalign&amp;from=2959&amp;to=2967">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=graph&amp;log$=nuclalign&amp;from=2959&amp;to=2967">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2959  CCGTCGTGA  2967</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 1634 to 1627</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=genbank&amp;log$=nuclalign&amp;from=1634&amp;to=1627">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=graph&amp;log$=nuclalign&amp;from=1634&amp;to=1627">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        8  CGTGAAGA  15
+                ||||||||
+Subject   1634  CGTGAAGA  1627</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 2435 to 2442</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=genbank&amp;log$=nuclalign&amp;from=2435&amp;to=2442">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=graph&amp;log$=nuclalign&amp;from=2435&amp;to=2442">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGAG  16
+                ||||||||
+Subject   2435  GTGAAGAG  2442</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 1100 to 1106</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=genbank&amp;log$=nuclalign&amp;from=1100&amp;to=1106">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=graph&amp;log$=nuclalign&amp;from=1100&amp;to=1106">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query       10  TGAAGAG  16
+                |||||||
+Subject   1100  TGAAGAG  1106</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 5: 2216 to 2222</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=genbank&amp;log$=nuclalign&amp;from=2216&amp;to=2222">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=graph&amp;log$=nuclalign&amp;from=2216&amp;to=2222">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2216  GTGAAGA  2222</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit29>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description29">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 5, Cryo-em Reconstruction Of The 80s-eif5b-met-itrnamet Eukaryotic Translation Initiation Complex</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=genbank&amp;log$=nuclalign">pdb|4BYW|5</a>
+                    <span class=b>Length:</span> 3396
+                    <span class=b>Number of Matches:</span> 5
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2959 to 2967</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=genbank&amp;log$=nuclalign&amp;from=2959&amp;to=2967">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=graph&amp;log$=nuclalign&amp;from=2959&amp;to=2967">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2959  CCGTCGTGA  2967</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 1634 to 1627</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=genbank&amp;log$=nuclalign&amp;from=1634&amp;to=1627">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=graph&amp;log$=nuclalign&amp;from=1634&amp;to=1627">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        8  CGTGAAGA  15
+                ||||||||
+Subject   1634  CGTGAAGA  1627</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 2435 to 2442</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=genbank&amp;log$=nuclalign&amp;from=2435&amp;to=2442">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=graph&amp;log$=nuclalign&amp;from=2435&amp;to=2442">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGAG  16
+                ||||||||
+Subject   2435  GTGAAGAG  2442</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 1100 to 1106</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=genbank&amp;log$=nuclalign&amp;from=1100&amp;to=1106">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=graph&amp;log$=nuclalign&amp;from=1100&amp;to=1106">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query       10  TGAAGAG  16
+                |||||||
+Subject   1100  TGAAGAG  1106</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 5: 2216 to 2222</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=genbank&amp;log$=nuclalign&amp;from=2216&amp;to=2222">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=graph&amp;log$=nuclalign&amp;from=2216&amp;to=2222">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2216  GTGAAGA  2222</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit31>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description31">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/508123724?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/508123724?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, The Re-refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution: More Complete Structure Of The L7/l12 And L1 Stalk, L5 And Lx Proteins</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/508123724?report=genbank&amp;log$=nuclalign">pdb|4HUB|0</a>
+                    <span class=b>Length:</span> 2910
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 298 to 290</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/508123724?report=genbank&amp;log$=nuclalign&amp;from=298&amp;to=290">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/508123724?report=graph&amp;log$=nuclalign&amp;from=298&amp;to=290">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAAGA  15
+                |||||||||
+Subject    298  TCGTGAAGA  290</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2618 to 2626</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/508123724?report=genbank&amp;log$=nuclalign&amp;from=2618&amp;to=2626">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/508123724?report=graph&amp;log$=nuclalign&amp;from=2618&amp;to=2626">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2618  CCGTCGTGA  2626</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 2599 to 2605</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/508123724?report=genbank&amp;log$=nuclalign&amp;from=2599&amp;to=2605">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/508123724?report=graph&amp;log$=nuclalign&amp;from=2599&amp;to=2605">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2599  GTCGTGA  2605</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit32>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description32">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 5, Structure Of The H. Sapiens 60s Rrna</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=genbank&amp;log$=nuclalign">pdb|3J3F|5</a>
+                    <span class=b>Length:</span> 5070
+                    <span class=b>Number of Matches:</span> 8
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 4536 to 4544</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=genbank&amp;log$=nuclalign&amp;from=4536&amp;to=4544">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=graph&amp;log$=nuclalign&amp;from=4536&amp;to=4544">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   4536  CCGTCGTGA  4544</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 765 to 772</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=genbank&amp;log$=nuclalign&amp;from=765&amp;to=772">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=graph&amp;log$=nuclalign&amp;from=765&amp;to=772">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTC  8
+                ||||||||
+Subject    765  CGTCCGTC  772</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 769 to 776</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=genbank&amp;log$=nuclalign&amp;from=769&amp;to=776">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=graph&amp;log$=nuclalign&amp;from=769&amp;to=776">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTC  8
+                ||||||||
+Subject    769  CGTCCGTC  776</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 773 to 780</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=genbank&amp;log$=nuclalign&amp;from=773&amp;to=780">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=graph&amp;log$=nuclalign&amp;from=773&amp;to=780">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTC  8
+                ||||||||
+Subject    773  CGTCCGTC  780</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 5: 777 to 784</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=genbank&amp;log$=nuclalign&amp;from=777&amp;to=784">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=graph&amp;log$=nuclalign&amp;from=777&amp;to=784">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTC  8
+                ||||||||
+Subject    777  CGTCCGTC  784</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 6: 3939 to 3946</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=genbank&amp;log$=nuclalign&amp;from=3939&amp;to=3946">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=graph&amp;log$=nuclalign&amp;from=3939&amp;to=3946">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGAG  16
+                ||||||||
+Subject   3939  GTGAAGAG  3946</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 7: 393 to 399</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=genbank&amp;log$=nuclalign&amp;from=393&amp;to=399">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=graph&amp;log$=nuclalign&amp;from=393&amp;to=399">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query       10  TGAAGAG  16
+                |||||||
+Subject    393  TGAAGAG  399</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 8: 3720 to 3726</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=genbank&amp;log$=nuclalign&amp;from=3720&amp;to=3726">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=graph&amp;log$=nuclalign&amp;from=3720&amp;to=3726">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   3720  GTGAAGA  3726</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit33>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description33">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/485601474?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/485601474?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 5, Structure Of The D. Melanogaster 60s Rrna</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/485601474?report=genbank&amp;log$=nuclalign">pdb|3J3E|5</a>
+                    <span class=b>Length:</span> 3970
+                    <span class=b>Number of Matches:</span> 4
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 3490 to 3498</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601474?report=genbank&amp;log$=nuclalign&amp;from=3490&amp;to=3498">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601474?report=graph&amp;log$=nuclalign&amp;from=3490&amp;to=3498">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   3490  CCGTCGTGA  3498</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2177 to 2184</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601474?report=genbank&amp;log$=nuclalign&amp;from=2177&amp;to=2184">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601474?report=graph&amp;log$=nuclalign&amp;from=2177&amp;to=2184">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGAG  16
+                ||||||||
+Subject   2177  GTGAAGAG  2184</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 2594 to 2600</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601474?report=genbank&amp;log$=nuclalign&amp;from=2594&amp;to=2600">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601474?report=graph&amp;log$=nuclalign&amp;from=2594&amp;to=2600">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2594  GTGAAGA  2600</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 3627 to 3633</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601474?report=genbank&amp;log$=nuclalign&amp;from=3627&amp;to=3633">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601474?report=graph&amp;log$=nuclalign&amp;from=3627&amp;to=3633">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGT  7
+                |||||||
+Subject   3627  CGTCCGT  3633</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit34>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description34">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/449802187?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/449802187?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain B, High_resolution Cryo-electron Microscopy Structure Of The Trypanosoma Brucei Ribosome</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/449802187?report=genbank&amp;log$=nuclalign">pdb|3ZEX|B</a>
+                    <span class=b>Length:</span> 1465
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 1334 to 1342</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/449802187?report=genbank&amp;log$=nuclalign&amp;from=1334&amp;to=1342">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/449802187?report=graph&amp;log$=nuclalign&amp;from=1334&amp;to=1342">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   1334  CCGTCGTGA  1342</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 705 to 711</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/449802187?report=genbank&amp;log$=nuclalign&amp;from=705&amp;to=711">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/449802187?report=graph&amp;log$=nuclalign&amp;from=705&amp;to=711">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query       10  TGAAGAG  16
+                |||||||
+Subject    705  TGAAGAG  711</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit36>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description36">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/392311504?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/392311504?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, Crystal Structure Of Enhanced Macrolide Bound To 50s Ribosomal Subunit</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/392311504?report=genbank&amp;log$=nuclalign">pdb|3OW2|0</a>
+                    <span class=b>Length:</span> 2902
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2613 to 2621</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/392311504?report=genbank&amp;log$=nuclalign&amp;from=2613&amp;to=2621">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/392311504?report=graph&amp;log$=nuclalign&amp;from=2613&amp;to=2621">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2613  CCGTCGTGA  2621</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2594 to 2600</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/392311504?report=genbank&amp;log$=nuclalign&amp;from=2594&amp;to=2600">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/392311504?report=graph&amp;log$=nuclalign&amp;from=2594&amp;to=2600">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2594  GTCGTGA  2600</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit37>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description37">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/374977932?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/374977932?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, The Cryo-em Structure Of The Archaeal 50s Ribosomal Subunit In Complex With Initiation Factor 6</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/374977932?report=genbank&amp;log$=nuclalign">pdb|4ADX|0</a>
+                    <span class=b>Length:</span> 2923
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 305 to 297</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/374977932?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/374977932?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAAGA  15
+                |||||||||
+Subject    305  TCGTGAAGA  297</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2625 to 2633</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/374977932?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/374977932?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2625  CCGTCGTGA  2633</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 2606 to 2612</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/374977932?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/374977932?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2606  GTCGTGA  2612</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit38>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description38">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/364506133?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/364506133?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 6, The Structure Of The Eukaryotic Ribosome At 3.0 A Resolution. This Entry Contains Ribosomal Rna And Ions Of The 40s Subunit, Ribosome B</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/364506133?report=genbank&amp;log$=nuclalign">pdb|3U5F|6</a>
+                    <span class=b>Length:</span> 1800
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 1528 to 1536</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/364506133?report=genbank&amp;log$=nuclalign&amp;from=1528&amp;to=1536">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/364506133?report=graph&amp;log$=nuclalign&amp;from=1528&amp;to=1536">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        3  TCCGTCGTG  11
+                |||||||||
+Subject   1528  TCCGTCGTG  1536</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 1006 to 1012</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/364506133?report=genbank&amp;log$=nuclalign&amp;from=1006&amp;to=1012">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/364506133?report=graph&amp;log$=nuclalign&amp;from=1006&amp;to=1012">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGT  10
+                |||||||
+Subject   1006  CCGTCGT  1012</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 1569 to 1563</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/364506133?report=genbank&amp;log$=nuclalign&amp;from=1569&amp;to=1563">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/364506133?report=graph&amp;log$=nuclalign&amp;from=1569&amp;to=1563">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query       10  TGAAGAG  16
+                |||||||
+Subject   1569  TGAAGAG  1563</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit39>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description39">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/364506095?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/364506095?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 2, The Structure Of The Eukaryotic Ribosome At 3.0 A Resolution. This Entry Contains Ribosomal Rna And Ions Of The 40s Subunit, Ribosome A </p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/364506095?report=genbank&amp;log$=nuclalign">pdb|3U5B|2</a>
+                    <span class=b>Length:</span> 1800
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+                <a class=showmoretitles onclick="toggle_visibility('moretitles39'); return false;" href=''>
+                  See 2 more title(s)
+                </a>
+
+                <div class=moretitles id=moretitles39 style="display: none">
+                  <div class=title>
+                    <p class=hittitle>Chain 2, Cryo-em Reconstruction Of The 80s-eif5b-met-itrnamet Eukaryotic Translation Initiation Complex </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/558704782?report=genbank&amp;log$=nuclalign">pdb|4BYO|2</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 2, Cryo-em Reconstruction Of The 80s-eif5b-met-itrnamet Eukaryotic Translation Initiation Complex</p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/558704824?report=genbank&amp;log$=nuclalign">pdb|4BYV|2</a>
+                    </p>
+                  </div>
+                </div>
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 1528 to 1536</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/364506095?report=genbank&amp;log$=nuclalign&amp;from=1528&amp;to=1536">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/364506095?report=graph&amp;log$=nuclalign&amp;from=1528&amp;to=1536">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        3  TCCGTCGTG  11
+                |||||||||
+Subject   1528  TCCGTCGTG  1536</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 1006 to 1012</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/364506095?report=genbank&amp;log$=nuclalign&amp;from=1006&amp;to=1012">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/364506095?report=graph&amp;log$=nuclalign&amp;from=1006&amp;to=1012">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGT  10
+                |||||||
+Subject   1006  CCGTCGT  1012</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 1569 to 1563</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/364506095?report=genbank&amp;log$=nuclalign&amp;from=1569&amp;to=1563">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/364506095?report=graph&amp;log$=nuclalign&amp;from=1569&amp;to=1563">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query       10  TGAAGAG  16
+                |||||||
+Subject   1569  TGAAGAG  1563</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit40>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description40">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/358440203?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/358440203?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 1, T.Thermophila 60s Ribosomal Subunit In Complex With Initiation Factor 6. This File Contains 26s Rrna And Proteins Of Molecule 4.</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/358440203?report=genbank&amp;log$=nuclalign">pdb|4A1D|1</a>
+                    <span class=b>Length:</span> 3119
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2280 to 2288</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440203?report=genbank&amp;log$=nuclalign&amp;from=2280&amp;to=2288">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440203?report=graph&amp;log$=nuclalign&amp;from=2280&amp;to=2288">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAAGA  15
+                |||||||||
+Subject   2280  TCGTGAAGA  2288</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2714 to 2722</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440203?report=genbank&amp;log$=nuclalign&amp;from=2714&amp;to=2722">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440203?report=graph&amp;log$=nuclalign&amp;from=2714&amp;to=2722">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2714  CCGTCGTGA  2722</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 2838 to 2844</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440203?report=genbank&amp;log$=nuclalign&amp;from=2838&amp;to=2844">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440203?report=graph&amp;log$=nuclalign&amp;from=2838&amp;to=2844">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        8  CGTGAAG  14
+                |||||||
+Subject   2838  CGTGAAG  2844</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit41>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description41">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/358440111?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/358440111?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 1, T.Thermophila 60s Ribosomal Subunit In Complex With Initiation Factor 6. This File Contains 26s Rrna And Proteins Of Molecule 1</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/358440111?report=genbank&amp;log$=nuclalign">pdb|4A18|1</a>
+                    <span class=b>Length:</span> 3354
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2513 to 2521</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440111?report=genbank&amp;log$=nuclalign&amp;from=2513&amp;to=2521">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440111?report=graph&amp;log$=nuclalign&amp;from=2513&amp;to=2521">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAAGA  15
+                |||||||||
+Subject   2513  TCGTGAAGA  2521</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2947 to 2955</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440111?report=genbank&amp;log$=nuclalign&amp;from=2947&amp;to=2955">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440111?report=graph&amp;log$=nuclalign&amp;from=2947&amp;to=2955">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2947  CCGTCGTGA  2955</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 3071 to 3077</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440111?report=genbank&amp;log$=nuclalign&amp;from=3071&amp;to=3077">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440111?report=graph&amp;log$=nuclalign&amp;from=3071&amp;to=3077">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        8  CGTGAAG  14
+                |||||||
+Subject   3071  CGTGAAG  3077</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit42>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description42">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/358440157?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/358440157?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 1, T.Thermophila 60s Ribosomal Subunit In Complex With Initiation Factor 6. This File Contains 26s Rrna And Proteins Of Molecule 3. </p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/358440157?report=genbank&amp;log$=nuclalign">pdb|4A1B|1</a>
+                    <span class=b>Length:</span> 3354
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+                <a class=showmoretitles onclick="toggle_visibility('moretitles42'); return false;" href=''>
+                  See 1 more title(s)
+                </a>
+
+                <div class=moretitles id=moretitles42 style="display: none">
+                  <div class=title>
+                    <p class=hittitle>Chain 1, T.Thermophila 60s Ribosomal Subunit In Complex With Initiation Factor 6. This File Contains 26s Rrna And Proteins Of Molecule 2.</p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/359807703?report=genbank&amp;log$=nuclalign">pdb|4A19|1</a>
+                    </p>
+                  </div>
+                </div>
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2513 to 2521</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440157?report=genbank&amp;log$=nuclalign&amp;from=2513&amp;to=2521">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440157?report=graph&amp;log$=nuclalign&amp;from=2513&amp;to=2521">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAAGA  15
+                |||||||||
+Subject   2513  TCGTGAAGA  2521</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2947 to 2955</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440157?report=genbank&amp;log$=nuclalign&amp;from=2947&amp;to=2955">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440157?report=graph&amp;log$=nuclalign&amp;from=2947&amp;to=2955">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2947  CCGTCGTGA  2955</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 3071 to 3077</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440157?report=genbank&amp;log$=nuclalign&amp;from=3071&amp;to=3077">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440157?report=graph&amp;log$=nuclalign&amp;from=3071&amp;to=3077">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        8  CGTGAAG  14
+                |||||||
+Subject   3071  CGTGAAG  3077</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit43>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description43">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/357380452?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/357380452?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 8, Core Of Mammalian 80s Pre-Ribosome In Complex With Trnas Fitted To A 9.8a Cryo-Em Map: Classic Pre State 1</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/357380452?report=genbank&amp;log$=nuclalign">pdb|3J0L|8</a>
+                    <span class=b>Length:</span> 20
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 3 to 11</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/357380452?report=genbank&amp;log$=nuclalign&amp;from=3&amp;to=11">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/357380452?report=graph&amp;log$=nuclalign&amp;from=3&amp;to=11">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject      3  CCGTCGTGA  11</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit44>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description44">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/357380483?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/357380483?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 8, Core Of Mammalian 80s Pre-Ribosome In Complex With Trnas Fitted To A 9a Cryo-Em Map: Classic Pre State 2</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/357380483?report=genbank&amp;log$=nuclalign">pdb|3J0O|8</a>
+                    <span class=b>Length:</span> 20
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 3 to 11</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/357380483?report=genbank&amp;log$=nuclalign&amp;from=3&amp;to=11">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/357380483?report=graph&amp;log$=nuclalign&amp;from=3&amp;to=11">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject      3  CCGTCGTGA  11</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit45>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description45">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 1, Yeast 80s Ribosome. This Entry Consists Of The 60s Subunit Of The First 80s In The Asymmetric Unit. </p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=genbank&amp;log$=nuclalign">pdb|3O58|1</a>
+                    <span class=b>Length:</span> 3396
+                    <span class=b>Number of Matches:</span> 5
+                  </p>
+                </div>
+
+                <a class=showmoretitles onclick="toggle_visibility('moretitles45'); return false;" href=''>
+                  See 2 more title(s)
+                </a>
+
+                <div class=moretitles id=moretitles45 style="display: none">
+                  <div class=title>
+                    <p class=hittitle>Chain 5, Cryo-Em Structure Of The 60s Ribosomal Subunit In Complex With Arx1 And Rei1 </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/418837761?report=genbank&amp;log$=nuclalign">pdb|4B6B|5</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 1, Arx1 Pre-60s Particle. This Entry Contains The Rrna.</p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/597959861?report=genbank&amp;log$=nuclalign">pdb|3J64|1</a>
+                    </p>
+                  </div>
+                </div>
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2959 to 2967</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=genbank&amp;log$=nuclalign&amp;from=2959&amp;to=2967">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=graph&amp;log$=nuclalign&amp;from=2959&amp;to=2967">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2959  CCGTCGTGA  2967</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 1634 to 1627</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=genbank&amp;log$=nuclalign&amp;from=1634&amp;to=1627">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=graph&amp;log$=nuclalign&amp;from=1634&amp;to=1627">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        8  CGTGAAGA  15
+                ||||||||
+Subject   1634  CGTGAAGA  1627</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 2435 to 2442</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=genbank&amp;log$=nuclalign&amp;from=2435&amp;to=2442">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=graph&amp;log$=nuclalign&amp;from=2435&amp;to=2442">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGAG  16
+                ||||||||
+Subject   2435  GTGAAGAG  2442</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 1100 to 1106</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=genbank&amp;log$=nuclalign&amp;from=1100&amp;to=1106">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=graph&amp;log$=nuclalign&amp;from=1100&amp;to=1106">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query       10  TGAAGAG  16
+                |||||||
+Subject   1100  TGAAGAG  1106</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 5: 2216 to 2222</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=genbank&amp;log$=nuclalign&amp;from=2216&amp;to=2222">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=graph&amp;log$=nuclalign&amp;from=2216&amp;to=2222">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2216  GTGAAGA  2222</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit46>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description46">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 1, Yeast 80s Ribosome. This Entry Consists Of The 60s Subunit Of The Second 80s In The Asymmetric Unit. </p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=genbank&amp;log$=nuclalign">pdb|3O5H|1</a>
+                    <span class=b>Length:</span> 3396
+                    <span class=b>Number of Matches:</span> 5
+                  </p>
+                </div>
+
+                <a class=showmoretitles onclick="toggle_visibility('moretitles46'); return false;" href=''>
+                  See 2 more title(s)
+                </a>
+
+                <div class=moretitles id=moretitles46 style="display: none">
+                  <div class=title>
+                    <p class=hittitle>Chain 1, The Structure Of The Eukaryotic Ribosome At 3.0 A Resolution. This Entry Contains Ribosomal Rna And Ions Of The 60s Subunit, Ribosome A </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/364506130?report=genbank&amp;log$=nuclalign">pdb|3U5D|1</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 5, The Structure Of The Eukaryotic Ribosome At 3.0 A Resolution. This Entry Contains Ribosomal Rna And Ions Of The 60s Subunit, Ribosome B</p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/364506168?report=genbank&amp;log$=nuclalign">pdb|3U5H|5</a>
+                    </p>
+                  </div>
+                </div>
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2959 to 2967</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=genbank&amp;log$=nuclalign&amp;from=2959&amp;to=2967">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=graph&amp;log$=nuclalign&amp;from=2959&amp;to=2967">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2959  CCGTCGTGA  2967</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 1634 to 1627</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=genbank&amp;log$=nuclalign&amp;from=1634&amp;to=1627">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=graph&amp;log$=nuclalign&amp;from=1634&amp;to=1627">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        8  CGTGAAGA  15
+                ||||||||
+Subject   1634  CGTGAAGA  1627</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 2435 to 2442</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=genbank&amp;log$=nuclalign&amp;from=2435&amp;to=2442">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=graph&amp;log$=nuclalign&amp;from=2435&amp;to=2442">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGAG  16
+                ||||||||
+Subject   2435  GTGAAGAG  2442</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 1100 to 1106</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=genbank&amp;log$=nuclalign&amp;from=1100&amp;to=1106">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=graph&amp;log$=nuclalign&amp;from=1100&amp;to=1106">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query       10  TGAAGAG  16
+                |||||||
+Subject   1100  TGAAGAG  1106</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 5: 2216 to 2222</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=genbank&amp;log$=nuclalign&amp;from=2216&amp;to=2222">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=graph&amp;log$=nuclalign&amp;from=2216&amp;to=2222">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2216  GTGAAGA  2222</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit47>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description47">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/315113447?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/315113447?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 1, Yeast 80s Ribosome. This Entry Consists Of The 40s Subunit Of The First 80s In The Asymmetric Unit.</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/315113447?report=genbank&amp;log$=nuclalign">pdb|3O2Z|1</a>
+                    <span class=b>Length:</span> 1800
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 1528 to 1536</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113447?report=genbank&amp;log$=nuclalign&amp;from=1528&amp;to=1536">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113447?report=graph&amp;log$=nuclalign&amp;from=1528&amp;to=1536">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        3  TCCGTCGTG  11
+                |||||||||
+Subject   1528  TCCGTCGTG  1536</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 1006 to 1012</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113447?report=genbank&amp;log$=nuclalign&amp;from=1006&amp;to=1012">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113447?report=graph&amp;log$=nuclalign&amp;from=1006&amp;to=1012">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGT  10
+                |||||||
+Subject   1006  CCGTCGT  1012</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 1569 to 1563</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113447?report=genbank&amp;log$=nuclalign&amp;from=1569&amp;to=1563">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113447?report=graph&amp;log$=nuclalign&amp;from=1569&amp;to=1563">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query       10  TGAAGAG  16
+                |||||||
+Subject   1569  TGAAGAG  1563</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit48>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description48">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/315113475?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/315113475?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 1, Yeast 80s Ribosome. This Entry Consists Of The 40s Subunit Of The Second 80s In The Asymmetric Unit.</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/315113475?report=genbank&amp;log$=nuclalign">pdb|3O30|1</a>
+                    <span class=b>Length:</span> 1800
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 1528 to 1536</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113475?report=genbank&amp;log$=nuclalign&amp;from=1528&amp;to=1536">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113475?report=graph&amp;log$=nuclalign&amp;from=1528&amp;to=1536">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        3  TCCGTCGTG  11
+                |||||||||
+Subject   1528  TCCGTCGTG  1536</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 1006 to 1012</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113475?report=genbank&amp;log$=nuclalign&amp;from=1006&amp;to=1012">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113475?report=graph&amp;log$=nuclalign&amp;from=1006&amp;to=1012">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGT  10
+                |||||||
+Subject   1006  CCGTCGT  1012</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 1569 to 1563</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113475?report=genbank&amp;log$=nuclalign&amp;from=1569&amp;to=1563">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113475?report=graph&amp;log$=nuclalign&amp;from=1569&amp;to=1563">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query       10  TGAAGAG  16
+                |||||||
+Subject   1569  TGAAGAG  1563</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit49>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description49">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, Model Of The Large Subunit Rna Based On A 6.1 A Cryo-Em Map Of Saccharomyces Cerevisiae Translating 80s Ribosome (With Es27l-In Conformation)</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=genbank&amp;log$=nuclalign">pdb|3IZF|A</a>
+                    <span class=b>Length:</span> 3396
+                    <span class=b>Number of Matches:</span> 5
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2959 to 2967</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=genbank&amp;log$=nuclalign&amp;from=2959&amp;to=2967">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=graph&amp;log$=nuclalign&amp;from=2959&amp;to=2967">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2959  CCGTCGTGA  2967</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 1634 to 1627</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=genbank&amp;log$=nuclalign&amp;from=1634&amp;to=1627">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=graph&amp;log$=nuclalign&amp;from=1634&amp;to=1627">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        8  CGTGAAGA  15
+                ||||||||
+Subject   1634  CGTGAAGA  1627</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 2435 to 2442</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=genbank&amp;log$=nuclalign&amp;from=2435&amp;to=2442">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=graph&amp;log$=nuclalign&amp;from=2435&amp;to=2442">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGAG  16
+                ||||||||
+Subject   2435  GTGAAGAG  2442</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 1100 to 1106</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=genbank&amp;log$=nuclalign&amp;from=1100&amp;to=1106">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=graph&amp;log$=nuclalign&amp;from=1100&amp;to=1106">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query       10  TGAAGAG  16
+                |||||||
+Subject   1100  TGAAGAG  1106</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 5: 2216 to 2222</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=genbank&amp;log$=nuclalign&amp;from=2216&amp;to=2222">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=graph&amp;log$=nuclalign&amp;from=2216&amp;to=2222">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2216  GTGAAGA  2222</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit50>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description50">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/313103744?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/313103744?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, Model Of The Small Subunit Rna Based On A 6.1 A Cryo-Em Map Of Saccharomyces Cerevisiae Translating 80s Ribosome</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/313103744?report=genbank&amp;log$=nuclalign">pdb|3IZE|A</a>
+                    <span class=b>Length:</span> 1800
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 1528 to 1536</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103744?report=genbank&amp;log$=nuclalign&amp;from=1528&amp;to=1536">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103744?report=graph&amp;log$=nuclalign&amp;from=1528&amp;to=1536">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        3  TCCGTCGTG  11
+                |||||||||
+Subject   1528  TCCGTCGTG  1536</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 1006 to 1012</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103744?report=genbank&amp;log$=nuclalign&amp;from=1006&amp;to=1012">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103744?report=graph&amp;log$=nuclalign&amp;from=1006&amp;to=1012">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGT  10
+                |||||||
+Subject   1006  CCGTCGT  1012</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 1569 to 1563</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103744?report=genbank&amp;log$=nuclalign&amp;from=1569&amp;to=1563">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103744?report=graph&amp;log$=nuclalign&amp;from=1569&amp;to=1563">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query       10  TGAAGAG  16
+                |||||||
+Subject   1569  TGAAGAG  1563</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit51>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description51">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/296278448?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/296278448?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain I, I-Msoi Re-Designed For Altered Dna Cleavage Specificity (-7c)</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/296278448?report=genbank&amp;log$=nuclalign">pdb|3KO2|I</a>
+                    <span class=b>Length:</span> 24
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 19 to 11</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/296278448?report=genbank&amp;log$=nuclalign&amp;from=19&amp;to=11">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/296278448?report=graph&amp;log$=nuclalign&amp;from=19&amp;to=11">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject     19  CCGTCGTGA  11</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit52>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description52">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/296278447?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/296278447?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain H, I-Msoi Re-Designed For Altered Dna Cleavage Specificity (-7c)</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/296278447?report=genbank&amp;log$=nuclalign">pdb|3KO2|H</a>
+                    <span class=b>Length:</span> 24
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 6 to 14</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/296278447?report=genbank&amp;log$=nuclalign&amp;from=6&amp;to=14">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/296278447?report=graph&amp;log$=nuclalign&amp;from=6&amp;to=14">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject      6  CCGTCGTGA  14</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit53>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description53">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/296278444?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/296278444?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain D, I-Msoi Re-Designed For Altered Dna Cleavage Specificity (-7c)</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/296278444?report=genbank&amp;log$=nuclalign">pdb|3KO2|D</a>
+                    <span class=b>Length:</span> 24
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 19 to 11</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/296278444?report=genbank&amp;log$=nuclalign&amp;from=19&amp;to=11">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/296278444?report=graph&amp;log$=nuclalign&amp;from=19&amp;to=11">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject     19  CCGTCGTGA  11</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit54>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description54">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/296278443?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/296278443?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain C, I-Msoi Re-Designed For Altered Dna Cleavage Specificity (-7c)</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/296278443?report=genbank&amp;log$=nuclalign">pdb|3KO2|C</a>
+                    <span class=b>Length:</span> 24
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 6 to 14</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/296278443?report=genbank&amp;log$=nuclalign&amp;from=6&amp;to=14">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/296278443?report=graph&amp;log$=nuclalign&amp;from=6&amp;to=14">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject      6  CCGTCGTGA  14</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit55>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description55">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/290790096?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/290790096?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, Co-Crystal Structure Of Triacetyloleandomcyin Bound To The Large Ribosomal Subunit</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/290790096?report=genbank&amp;log$=nuclalign">pdb|3I56|0</a>
+                    <span class=b>Length:</span> 2923
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 305 to 297</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/290790096?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/290790096?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAAGA  15
+                |||||||||
+Subject    305  TCGTGAAGA  297</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2625 to 2633</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/290790096?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/290790096?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2625  CCGTCGTGA  2633</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 2606 to 2612</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/290790096?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/290790096?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2606  GTCGTGA  2612</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit56>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description56">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 5, Structure Of The 60s Rrna For Eukaryotic Ribosome Based On Cryo-Em Map Of Thermomyces Lanuginosus Ribosome At 8.9a Resolution</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=genbank&amp;log$=nuclalign">pdb|3JYX|5</a>
+                    <span class=b>Length:</span> 3170
+                    <span class=b>Number of Matches:</span> 5
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2740 to 2748</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=genbank&amp;log$=nuclalign&amp;from=2740&amp;to=2748">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=graph&amp;log$=nuclalign&amp;from=2740&amp;to=2748">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2740  CCGTCGTGA  2748</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 1587 to 1580</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=genbank&amp;log$=nuclalign&amp;from=1587&amp;to=1580">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=graph&amp;log$=nuclalign&amp;from=1587&amp;to=1580">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        8  CGTGAAGA  15
+                ||||||||
+Subject   1587  CGTGAAGA  1580</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 2222 to 2229</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=genbank&amp;log$=nuclalign&amp;from=2222&amp;to=2229">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=graph&amp;log$=nuclalign&amp;from=2222&amp;to=2229">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGAG  16
+                ||||||||
+Subject   2222  GTGAAGAG  2229</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 1344 to 1350</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=genbank&amp;log$=nuclalign&amp;from=1344&amp;to=1350">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=graph&amp;log$=nuclalign&amp;from=1344&amp;to=1350">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   1344  GTCGTGA  1350</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 5: 2003 to 2009</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=genbank&amp;log$=nuclalign&amp;from=2003&amp;to=2009">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=graph&amp;log$=nuclalign&amp;from=2003&amp;to=2009">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2003  GTGAAGA  2009</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit57>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description57">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/281500807?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/281500807?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, Structure Of The 40s Rrna And Proteins And PE TRNA FOR EUKARYOTIC Ribosome Based On Cryo-Em Map Of Thermomyces Lanuginosus Ribosome At 8.9a Resolution</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/281500807?report=genbank&amp;log$=nuclalign">pdb|3JYV|A</a>
+                    <span class=b>Length:</span> 1761
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 1492 to 1500</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500807?report=genbank&amp;log$=nuclalign&amp;from=1492&amp;to=1500">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500807?report=graph&amp;log$=nuclalign&amp;from=1492&amp;to=1500">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        3  TCCGTCGTG  11
+                |||||||||
+Subject   1492  TCCGTCGTG  1500</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 981 to 987</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500807?report=genbank&amp;log$=nuclalign&amp;from=981&amp;to=987">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500807?report=graph&amp;log$=nuclalign&amp;from=981&amp;to=987">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGT  10
+                |||||||
+Subject    981  CCGTCGT  987</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 1533 to 1527</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500807?report=genbank&amp;log$=nuclalign&amp;from=1533&amp;to=1527">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500807?report=graph&amp;log$=nuclalign&amp;from=1533&amp;to=1527">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query       10  TGAAGAG  16
+                |||||||
+Subject   1533  TGAAGAG  1527</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit58>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description58">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/259090425?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/259090425?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 3, Structure Of The Ribosomal 80s-Eef2-Sordarin Complex From Yeast Obtained By Docking Atomic Models For Rna And Protein Components Into A 11.7 A Cryo-Em Map. This File, 1s1i, Contains 60s Subunit. The 40s Ribosomal Subunit Is In File 1s1h.</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/259090425?report=genbank&amp;log$=nuclalign">pdb|1S1I|3</a>
+                    <span class=b>Length:</span> 2999
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2710 to 2718</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/259090425?report=genbank&amp;log$=nuclalign&amp;from=2710&amp;to=2718">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/259090425?report=graph&amp;log$=nuclalign&amp;from=2710&amp;to=2718">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2710  CCGTCGTGA  2718</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2691 to 2697</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/259090425?report=genbank&amp;log$=nuclalign&amp;from=2691&amp;to=2697">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/259090425?report=graph&amp;log$=nuclalign&amp;from=2691&amp;to=2697">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2691  GTCGTGA  2697</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit59>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description59">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/208435493?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/208435493?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, Negamycin Binds To The Wall Of The Nascent Chain Exit Tunnel Of The 50s Ribosomal Subunit</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/208435493?report=genbank&amp;log$=nuclalign">pdb|2QEX|0</a>
+                    <span class=b>Length:</span> 2772
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2476 to 2484</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/208435493?report=genbank&amp;log$=nuclalign&amp;from=2476&amp;to=2484">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/208435493?report=graph&amp;log$=nuclalign&amp;from=2476&amp;to=2484">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2476  CCGTCGTGA  2484</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2457 to 2463</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/208435493?report=genbank&amp;log$=nuclalign&amp;from=2457&amp;to=2463">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/208435493?report=graph&amp;log$=nuclalign&amp;from=2457&amp;to=2463">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2457  GTCGTGA  2463</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit60>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description60">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/194368703?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/194368703?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, The Structure Of The Antibiotic Linezolid Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/194368703?report=genbank&amp;log$=nuclalign">pdb|3CPW|0</a>
+                    <span class=b>Length:</span> 2922
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2624 to 2632</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/194368703?report=genbank&amp;log$=nuclalign&amp;from=2624&amp;to=2632">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/194368703?report=graph&amp;log$=nuclalign&amp;from=2624&amp;to=2632">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2624  CCGTCGTGA  2632</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2605 to 2611</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/194368703?report=genbank&amp;log$=nuclalign&amp;from=2605&amp;to=2611">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/194368703?report=graph&amp;log$=nuclalign&amp;from=2605&amp;to=2611">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2605  GTCGTGA  2611</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit61>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description61">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596372?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596372?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation G2616a </p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596372?report=genbank&amp;log$=nuclalign">pdb|3CCV|0</a>
+                    <span class=b>Length:</span> 2923
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+                <a class=showmoretitles onclick="toggle_visibility('moretitles61'); return false;" href=''>
+                  See 1 more title(s)
+                </a>
+
+                <div class=moretitles id=moretitles61 style="display: none">
+                  <div class=title>
+                    <p class=hittitle>Chain 0, Co-cystal Of Large Ribosomal Subunit Mutant G2616a With Cc-puromycin</p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596403?report=genbank&amp;log$=nuclalign">pdb|3CD6|0</a>
+                    </p>
+                  </div>
+                </div>
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 305 to 297</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596372?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596372?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAAGA  15
+                |||||||||
+Subject    305  TCGTGAAGA  297</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2625 to 2633</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596372?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596372?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2625  CCGTCGTGA  2633</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 2606 to 2612</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596372?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596372?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2606  GTCGTGA  2612</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit62>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description62">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596341?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596341?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation G2482c</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596341?report=genbank&amp;log$=nuclalign">pdb|3CCU|0</a>
+                    <span class=b>Length:</span> 2923
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 305 to 297</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596341?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596341?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAAGA  15
+                |||||||||
+Subject    305  TCGTGAAGA  297</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2625 to 2633</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596341?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596341?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2625  CCGTCGTGA  2633</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 2606 to 2612</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596341?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596341?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2606  GTCGTGA  2612</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit63>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description63">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596310?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596310?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation G2482a</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596310?report=genbank&amp;log$=nuclalign">pdb|3CCS|0</a>
+                    <span class=b>Length:</span> 2923
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 305 to 297</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596310?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596310?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAAGA  15
+                |||||||||
+Subject    305  TCGTGAAGA  297</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2625 to 2633</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596310?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596310?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2625  CCGTCGTGA  2633</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 2606 to 2612</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596310?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596310?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2606  GTCGTGA  2612</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit64>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description64">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596279?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596279?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation A2488c. Density For Anisomycin Is Visible But Not Included In The Model.</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596279?report=genbank&amp;log$=nuclalign">pdb|3CCR|0</a>
+                    <span class=b>Length:</span> 2923
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 305 to 297</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596279?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596279?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAAGA  15
+                |||||||||
+Subject    305  TCGTGAAGA  297</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2625 to 2633</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596279?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596279?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2625  CCGTCGTGA  2633</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 2606 to 2612</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596279?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596279?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2606  GTCGTGA  2612</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit65>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description65">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596248?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596248?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation A2488u</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596248?report=genbank&amp;log$=nuclalign">pdb|3CCQ|0</a>
+                    <span class=b>Length:</span> 2923
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 305 to 297</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596248?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596248?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAAGA  15
+                |||||||||
+Subject    305  TCGTGAAGA  297</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2625 to 2633</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596248?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596248?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2625  CCGTCGTGA  2633</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 2606 to 2612</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596248?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596248?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2606  GTCGTGA  2612</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit66>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description66">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596217?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596217?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation G2611u</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596217?report=genbank&amp;log$=nuclalign">pdb|3CCM|0</a>
+                    <span class=b>Length:</span> 2923
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 305 to 297</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596217?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596217?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAAGA  15
+                |||||||||
+Subject    305  TCGTGAAGA  297</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2625 to 2633</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596217?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596217?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2625  CCGTCGTGA  2633</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit67>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description67">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596186?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596186?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation U2535c. Density For Anisomycin Is Visible But Not Included In Model.</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596186?report=genbank&amp;log$=nuclalign">pdb|3CCL|0</a>
+                    <span class=b>Length:</span> 2923
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 305 to 297</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596186?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596186?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAAGA  15
+                |||||||||
+Subject    305  TCGTGAAGA  297</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2625 to 2633</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596186?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596186?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2625  CCGTCGTGA  2633</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 2606 to 2612</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596186?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596186?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2606  GTCGTGA  2612</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit68>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description68">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596155?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596155?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation C2534u</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596155?report=genbank&amp;log$=nuclalign">pdb|3CCJ|0</a>
+                    <span class=b>Length:</span> 2923
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 305 to 297</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596155?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596155?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAAGA  15
+                |||||||||
+Subject    305  TCGTGAAGA  297</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2625 to 2633</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596155?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596155?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2625  CCGTCGTGA  2633</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 2606 to 2612</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596155?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596155?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2606  GTCGTGA  2612</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit69>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description69">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596124?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596124?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation U2535a</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596124?report=genbank&amp;log$=nuclalign">pdb|3CCE|0</a>
+                    <span class=b>Length:</span> 2923
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 305 to 297</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596124?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596124?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAAGA  15
+                |||||||||
+Subject    305  TCGTGAAGA  297</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2625 to 2633</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596124?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596124?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2625  CCGTCGTGA  2633</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 2606 to 2612</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596124?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596124?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2606  GTCGTGA  2612</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit70>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description70">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596093?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596093?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation C2487u</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596093?report=genbank&amp;log$=nuclalign">pdb|3CC7|0</a>
+                    <span class=b>Length:</span> 2923
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 305 to 297</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596093?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596093?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAAGA  15
+                |||||||||
+Subject    305  TCGTGAAGA  297</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2625 to 2633</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596093?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596093?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2625  CCGTCGTGA  2633</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 2606 to 2612</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596093?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596093?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2606  GTCGTGA  2612</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit71>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description71">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596031?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596031?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, The Refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution With Rrna Sequence For The 23s Rrna And Genome-Derived Sequences For R-Proteins </p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596031?report=genbank&amp;log$=nuclalign">pdb|3CC2|0</a>
+                    <span class=b>Length:</span> 2923
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+                <a class=showmoretitles onclick="toggle_visibility('moretitles71'); return false;" href=''>
+                  See 7 more title(s)
+                </a>
+
+                <div class=moretitles id=moretitles71 style="display: none">
+                  <div class=title>
+                    <p class=hittitle>Chain 0, Co-Crystal Structure Of Anisomycin Bound To The 50s Ribosomal Subunit </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596062?report=genbank&amp;log$=nuclalign">pdb|3CC4|0</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 0, The Structure Of Cca And Cca-Phe-Cap-Bio Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/206581937?report=genbank&amp;log$=nuclalign">pdb|3CMA|0</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 0, The Structure Of Ca And Cca-Phe-Cap-Bio Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/206581970?report=genbank&amp;log$=nuclalign">pdb|3CME|0</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 0, Co-Crystal Structure Of Tiamulin Bound To The Large Ribosomal Subunit </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/228312141?report=genbank&amp;log$=nuclalign">pdb|3G4S|0</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 0, Co-Crystal Structure Of Homoharringtonine Bound To The Large Ribosomal Subunit </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/228312197?report=genbank&amp;log$=nuclalign">pdb|3G6E|0</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 0, Co-crystal Structure Of Bruceantin Bound To The Large Ribosomal Subunit </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/228312233?report=genbank&amp;log$=nuclalign">pdb|3G71|0</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 0, Co-Crystal Structure Of Mycalamide A Bound To The Large Ribosomal Subunit</p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/290790035?report=genbank&amp;log$=nuclalign">pdb|3I55|0</a>
+                    </p>
+                  </div>
+                </div>
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 305 to 297</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596031?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596031?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAAGA  15
+                |||||||||
+Subject    305  TCGTGAAGA  297</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2625 to 2633</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596031?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596031?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2625  CCGTCGTGA  2633</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 2606 to 2612</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596031?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596031?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2606  GTCGTGA  2612</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit72>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description72">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/187609272?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/187609272?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, Structure Of A Mammalian Ribosomal 60s Subunit Within An 80s Complex Obtained By Docking Homology Models Of The Rna And Proteins Into An 8.7 A Cryo-Em Map</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/187609272?report=genbank&amp;log$=nuclalign">pdb|2ZKR|0</a>
+                    <span class=b>Length:</span> 2903
+                    <span class=b>Number of Matches:</span> 4
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2623 to 2631</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/187609272?report=genbank&amp;log$=nuclalign&amp;from=2623&amp;to=2631">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/187609272?report=graph&amp;log$=nuclalign&amp;from=2623&amp;to=2631">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2623  CCGTCGTGA  2631</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2111 to 2118</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/187609272?report=genbank&amp;log$=nuclalign&amp;from=2111&amp;to=2118">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/187609272?report=graph&amp;log$=nuclalign&amp;from=2111&amp;to=2118">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGAG  16
+                ||||||||
+Subject   2111  GTGAAGAG  2118</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 353 to 359</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/187609272?report=genbank&amp;log$=nuclalign&amp;from=353&amp;to=359">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/187609272?report=graph&amp;log$=nuclalign&amp;from=353&amp;to=359">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query       10  TGAAGAG  16
+                |||||||
+Subject    353  TGAAGAG  359</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 1892 to 1898</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/187609272?report=genbank&amp;log$=nuclalign&amp;from=1892&amp;to=1898">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/187609272?report=graph&amp;log$=nuclalign&amp;from=1892&amp;to=1898">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   1892  GTGAAGA  1898</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit73>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description73">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/171848835?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/171848835?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, A More Complete Structure Of The The L7L12 STALK OF THE Haloarcula Marismortui 50s Large Ribosomal Subunit</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/171848835?report=genbank&amp;log$=nuclalign">pdb|2QA4|0</a>
+                    <span class=b>Length:</span> 2922
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2624 to 2632</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/171848835?report=genbank&amp;log$=nuclalign&amp;from=2624&amp;to=2632">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/171848835?report=graph&amp;log$=nuclalign&amp;from=2624&amp;to=2632">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2624  CCGTCGTGA  2632</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2605 to 2611</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/171848835?report=genbank&amp;log$=nuclalign&amp;from=2605&amp;to=2611">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/171848835?report=graph&amp;log$=nuclalign&amp;from=2605&amp;to=2611">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2605  GTCGTGA  2611</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit74>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description74">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/99032306?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/99032306?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain R, Structural Model For The Large Subunit Of The Mammalian Mitochondrial Ribosome</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/99032306?report=genbank&amp;log$=nuclalign">pdb|2FTC|R</a>
+                    <span class=b>Length:</span> 1568
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 1032 to 1040</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/99032306?report=genbank&amp;log$=nuclalign&amp;from=1032&amp;to=1040">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/99032306?report=graph&amp;log$=nuclalign&amp;from=1032&amp;to=1040">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        8  CGTGAAGAG  16
+                |||||||||
+Subject   1032  CGTGAAGAG  1040</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit75>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description75">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/50513468?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/50513468?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, Refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution </p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/50513468?report=genbank&amp;log$=nuclalign">pdb|1S72|0</a>
+                    <span class=b>Length:</span> 2922
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+                <a class=showmoretitles onclick="toggle_visibility('moretitles75'); return false;" href=''>
+                  See 14 more title(s)
+                </a>
+
+                <div class=moretitles id=moretitles75 style="display: none">
+                  <div class=title>
+                    <p class=hittitle>Chain 0, The Structure Of The Transition State Analogue &#34;daa&#34; Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83753123?report=genbank&amp;log$=nuclalign">pdb|1VQ4|0</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 0, The Structure Of The Transition State Analogue &#34;raa&#34; Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83753155?report=genbank&amp;log$=nuclalign">pdb|1VQ5|0</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 0, The Structure Of C-Hpmn And Cca-Phe-Cap-Bio Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83753187?report=genbank&amp;log$=nuclalign">pdb|1VQ6|0</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 0, The Structure Of The Transition State Analogue &#34;dca&#34; Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83753219?report=genbank&amp;log$=nuclalign">pdb|1VQ7|0</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 0, The Structure Of Ccda-Phe-Cap-Bio And The Antibiotic Sparsomycin Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83753251?report=genbank&amp;log$=nuclalign">pdb|1VQ8|0</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 0, The Structure Of Cca-Phe-Cap-Bio And The Antibiotic Sparsomycin Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83753282?report=genbank&amp;log$=nuclalign">pdb|1VQ9|0</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 0, The Structure Of Ccda-Phe-Cap-Bio Bound To The A Site Of The Ribosomal Subunit Of Haloarcula Marismortui </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83753314?report=genbank&amp;log$=nuclalign">pdb|1VQK|0</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 0, The Structure Of The Transition State Analogue &#34;dcsn&#34; Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83753345?report=genbank&amp;log$=nuclalign">pdb|1VQL|0</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 0, The Structure Of The Transition State Analogue &#34;dan&#34; Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83753376?report=genbank&amp;log$=nuclalign">pdb|1VQM|0</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 0, The Structure Of Cc-hpmn And Cca-phe-cap-bio Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83753407?report=genbank&amp;log$=nuclalign">pdb|1VQN|0</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 0, The Structure Of Ccpmn Bound To The Large Ribosomal Subunit Haloarcula Marismortui </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83753439?report=genbank&amp;log$=nuclalign">pdb|1VQO|0</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 0, The Structure Of The Transition State Analogue &#34;rap&#34; Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83753470?report=genbank&amp;log$=nuclalign">pdb|1VQP|0</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 0, 13-Deoxytedanolide Bound To The Large Subunit Of Haloarcula Marismortui </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/145580171?report=genbank&amp;log$=nuclalign">pdb|2OTJ|0</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 0, Girodazole Bound To The Large Subunit Of Haloarcula Marismortui</p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/145580202?report=genbank&amp;log$=nuclalign">pdb|2OTL|0</a>
+                    </p>
+                  </div>
+                </div>
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2624 to 2632</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/50513468?report=genbank&amp;log$=nuclalign&amp;from=2624&amp;to=2632">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/50513468?report=graph&amp;log$=nuclalign&amp;from=2624&amp;to=2632">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2624  CCGTCGTGA  2632</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2605 to 2611</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/50513468?report=genbank&amp;log$=nuclalign&amp;from=2605&amp;to=2611">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/50513468?report=graph&amp;log$=nuclalign&amp;from=2605&amp;to=2611">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2605  GTCGTGA  2611</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit76>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description76">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/66360881?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/66360881?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, Crystal Structure Of Virginiamycin M And S Bound To The 50s Ribosomal Subunit Of Haloarcula Marismortui </p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/66360881?report=genbank&amp;log$=nuclalign">pdb|1YIT|0</a>
+                    <span class=b>Length:</span> 2922
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+                <a class=showmoretitles onclick="toggle_visibility('moretitles76'); return false;" href=''>
+                  See 1 more title(s)
+                </a>
+
+                <div class=moretitles id=moretitles76 style="display: none">
+                  <div class=title>
+                    <p class=hittitle>Chain 0, Crystal Structure Of The Mutant 50s Ribosomal Subunit Of Haloarcula Marismortui Containing A Three Residue Deletion In L22</p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/66360914?report=genbank&amp;log$=nuclalign">pdb|1YJ9|0</a>
+                    </p>
+                  </div>
+                </div>
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 305 to 297</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360881?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360881?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAAGA  15
+                |||||||||
+Subject    305  TCGTGAAGA  297</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2625 to 2633</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360881?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360881?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2625  CCGTCGTGA  2633</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 2606 to 2612</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360881?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360881?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2606  GTCGTGA  2612</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit77>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description77">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/66360782?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/66360782?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, Crystal Structure Of Azithromycin Bound To The G2099a Mutant 50s Ribosomal Subunit Of Haloarcula Marismortui </p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/66360782?report=genbank&amp;log$=nuclalign">pdb|1YHQ|0</a>
+                    <span class=b>Length:</span> 2922
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+                <a class=showmoretitles onclick="toggle_visibility('moretitles77'); return false;" href=''>
+                  See 3 more title(s)
+                </a>
+
+                <div class=moretitles id=moretitles77 style="display: none">
+                  <div class=title>
+                    <p class=hittitle>Chain 0, Crystal Structure Of Erythromycin Bound To The G2099a Mutant 50s Ribosomal Subunit Of Haloarcula Marismortui </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/66360815?report=genbank&amp;log$=nuclalign">pdb|1YI2|0</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 0, Crystal Structure Of Telithromycin Bound To The G2099a Mutant 50s Ribosomal Subunit Of Haloarcula Marismortui </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/66360848?report=genbank&amp;log$=nuclalign">pdb|1YIJ|0</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 0, Crystal Structure Of Clindamycin Bound To The G2099a Mutant 50s Ribosomal Subunit Of Haloarcula Marismortui</p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/66360947?report=genbank&amp;log$=nuclalign">pdb|1YJN|0</a>
+                    </p>
+                  </div>
+                </div>
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 305 to 297</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360782?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360782?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAAGA  15
+                |||||||||
+Subject    305  TCGTGAAGA  297</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2625 to 2633</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360782?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360782?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2625  CCGTCGTGA  2633</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 2606 to 2612</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360782?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360782?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2606  GTCGTGA  2612</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit78>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description78">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/66360980?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/66360980?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, Crystal Structure Of Quinupristin Bound To The G2099a Mutant 50s Ribosomal Subunit Of Haloarcula Marismortui</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/66360980?report=genbank&amp;log$=nuclalign">pdb|1YJW|0</a>
+                    <span class=b>Length:</span> 2922
+                    <span class=b>Number of Matches:</span> 3
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 305 to 297</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360980?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360980?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        7  TCGTGAAGA  15
+                |||||||||
+Subject    305  TCGTGAAGA  297</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2625 to 2633</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360980?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360980?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2625  CCGTCGTGA  2633</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 2606 to 2612</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360980?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360980?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2606  GTCGTGA  2612</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit79>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description79">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/37928006?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/37928006?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, Crystal Structure Of Cca-Phe-Cap-Biotin Bound Simultaneously At Half Occupancy To Both The A-Site And P- Site Of The The 50s Ribosomal Subunit.</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/37928006?report=genbank&amp;log$=nuclalign">pdb|1Q86|A</a>
+                    <span class=b>Length:</span> 2922
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2624 to 2632</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/37928006?report=genbank&amp;log$=nuclalign&amp;from=2624&amp;to=2632">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/37928006?report=graph&amp;log$=nuclalign&amp;from=2624&amp;to=2632">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2624  CCGTCGTGA  2632</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2605 to 2611</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/37928006?report=genbank&amp;log$=nuclalign&amp;from=2605&amp;to=2611">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/37928006?report=graph&amp;log$=nuclalign&amp;from=2605&amp;to=2611">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2605  GTCGTGA  2611</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit80>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description80">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/15825941?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/15825941?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, Fully Refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution </p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/15825941?report=genbank&amp;log$=nuclalign">pdb|1JJ2|0</a>
+                    <span class=b>Length:</span> 2922
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+                <a class=showmoretitles onclick="toggle_visibility('moretitles80'); return false;" href=''>
+                  See 16 more title(s)
+                </a>
+
+                <div class=moretitles id=moretitles80 style="display: none">
+                  <div class=title>
+                    <p class=hittitle>Chain 0, The Haloarcula Marismortui 50s Complexed With A Pretranslocational Intermediate In Protein Synthesis </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/20150986?report=genbank&amp;log$=nuclalign">pdb|1KQS|0</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Co-Crystal Structure Of Azithromycin Bound To The 50s Ribosomal Subunit Of Haloarcula Marismortui </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/22219324?report=genbank&amp;log$=nuclalign">pdb|1M1K|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Co-Crystal Structure Of Cca-Phe-Caproic Acid-Biotin And Sparsomycin Bound To The 50s Ribosomal Subunit </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/24159019?report=genbank&amp;log$=nuclalign">pdb|1M90|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Co-Crystal Structure Of Anisomycin Bound To The 50s Ribosomal Subunit </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/34811116?report=genbank&amp;log$=nuclalign">pdb|1K73|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Structure Of Large Ribosomal Subunit In Complex With Virginiamycin M </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/34811185?report=genbank&amp;log$=nuclalign">pdb|1N8R|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Structure Of Chloramphenicol Bound To The 50s Ribosomal Subunit </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/34811215?report=genbank&amp;log$=nuclalign">pdb|1NJI|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Crystal Structure Of Ccdap-puromycin Bound At The Peptidyl Transferase Center Of The 50s Ribosomal Subunit </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/37927899?report=genbank&amp;log$=nuclalign">pdb|1Q7Y|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Crystal Structure Of Minihelix With 3&#39; Puromycin Bound To A- Site Of The 50s Ribosomal Subunit. </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/37927934?report=genbank&amp;log$=nuclalign">pdb|1Q81|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Crystal Structure Of Cc-Puromycin Bound To The A-Site Of The 50s Ribosomal Subunit </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/37927970?report=genbank&amp;log$=nuclalign">pdb|1Q82|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 0, Structure Of A Deacylated Trna Minihelix Bound To The E Site Of The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/39654670?report=genbank&amp;log$=nuclalign">pdb|1QVF|0</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 0, Structure Of Cca Oligonucleotide Bound To The Trna Binding Sites Of The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/39654701?report=genbank&amp;log$=nuclalign">pdb|1QVG|0</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Co-Crystal Structure Of Carbomycin A Bound To The 50s Ribosomal Subunit Of Haloarcula Marismortui </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/157878615?report=genbank&amp;log$=nuclalign">pdb|1K8A|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Co-Crystal Structure Of Tylosin Bound To The 50s Ribosomal Subunit Of Haloarcula Marismortui </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/157878625?report=genbank&amp;log$=nuclalign">pdb|1K9M|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain A, Co-crystal Structure Of Spiramycin Bound To The 50s Ribosomal Subunit Of Haloarcula Marismortui </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/157878639?report=genbank&amp;log$=nuclalign">pdb|1KD1|A</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 0, Trigger Factor Ribosome Binding Domain In Complex With 50s </p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/157880605?report=genbank&amp;log$=nuclalign">pdb|1W2B|0</a>
+                    </p>
+                  </div>
+                  <div class=title>
+                    <p class=hittitle>Chain 0, The Structure Of An Enhanced Oxazolidinone Inhibitor Bound To The 50s Ribosomal Subunit Of H. Marismortui</p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/228311909?report=genbank&amp;log$=nuclalign">pdb|3CXC|0</a>
+                    </p>
+                  </div>
+                </div>
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2624 to 2632</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/15825941?report=genbank&amp;log$=nuclalign&amp;from=2624&amp;to=2632">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/15825941?report=graph&amp;log$=nuclalign&amp;from=2624&amp;to=2632">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2624  CCGTCGTGA  2632</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2605 to 2611</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/15825941?report=genbank&amp;log$=nuclalign&amp;from=2605&amp;to=2611">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/15825941?report=graph&amp;log$=nuclalign&amp;from=2605&amp;to=2611">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2605  GTCGTGA  2611</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit81>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description81">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/34811146?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/34811146?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, Co-Crystal Structure Of Blasticidin S Bound To The 50s Ribosomal Subunit</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/34811146?report=genbank&amp;log$=nuclalign">pdb|1KC8|A</a>
+                    <span class=b>Length:</span> 2922
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2624 to 2632</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/34811146?report=genbank&amp;log$=nuclalign&amp;from=2624&amp;to=2632">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/34811146?report=graph&amp;log$=nuclalign&amp;from=2624&amp;to=2632">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2624  CCGTCGTGA  2632</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2605 to 2611</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/34811146?report=genbank&amp;log$=nuclalign&amp;from=2605&amp;to=2611">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/34811146?report=graph&amp;log$=nuclalign&amp;from=2605&amp;to=2611">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2605  GTCGTGA  2611</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit82>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description82">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/10120918?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/10120918?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 0, Crystal Structure Of The Large Ribosomal Subunit From Haloarcula Marismortui At 2.4 Angstrom Resolution</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/10120918?report=genbank&amp;log$=nuclalign">pdb|1FFK|0</a>
+                    <span class=b>Length:</span> 2922
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2624 to 2632</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/10120918?report=genbank&amp;log$=nuclalign&amp;from=2624&amp;to=2632">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/10120918?report=graph&amp;log$=nuclalign&amp;from=2624&amp;to=2632">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2624  CCGTCGTGA  2632</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2605 to 2611</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/10120918?report=genbank&amp;log$=nuclalign&amp;from=2605&amp;to=2611">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/10120918?report=graph&amp;log$=nuclalign&amp;from=2605&amp;to=2611">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject   2605  GTCGTGA  2611</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit83>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description83">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/10120728?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/10120728?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, Large Ribosomal Subunit Complexed With A 13 Bp Minihelix- Puromycin Compound</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/10120728?report=genbank&amp;log$=nuclalign">pdb|1FG0|A</a>
+                    <span class=b>Length:</span> 602
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 563 to 571</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/10120728?report=genbank&amp;log$=nuclalign&amp;from=563&amp;to=571">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/10120728?report=graph&amp;log$=nuclalign&amp;from=563&amp;to=571">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject    563  CCGTCGTGA  571</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 544 to 550</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/10120728?report=genbank&amp;log$=nuclalign&amp;from=544&amp;to=550">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/10120728?report=graph&amp;log$=nuclalign&amp;from=544&amp;to=550">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject    544  GTCGTGA  550</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit84>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description84">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/10120727?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/10120727?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, Large Ribosomal Subunit Complexed With R(Cc)-Da-Puromycin</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/10120727?report=genbank&amp;log$=nuclalign">pdb|1FFZ|A</a>
+                    <span class=b>Length:</span> 602
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 563 to 571</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/10120727?report=genbank&amp;log$=nuclalign&amp;from=563&amp;to=571">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/10120727?report=graph&amp;log$=nuclalign&amp;from=563&amp;to=571">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3 bits(9)</td>
+                      <td>11.9</td>
+                      <td>9/9(100%)</td>
+                      <td>0/9(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject    563  CCGTCGTGA  571</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 544 to 550</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/10120727?report=genbank&amp;log$=nuclalign&amp;from=544&amp;to=550">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/10120727?report=graph&amp;log$=nuclalign&amp;from=544&amp;to=550">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        6  GTCGTGA  12
+                |||||||
+Subject    544  GTCGTGA  550</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit85>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description85">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/558705015?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/558705015?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain F, Crystal Structure Of The Catalytic Domain Of Rlub In Complex With A 21-nucleotide Rna Substrate</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/558705015?report=genbank&amp;log$=nuclalign">pdb|4LGT|F</a>
+                    <span class=b>Length:</span> 21
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 5 to 12</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558705015?report=genbank&amp;log$=nuclalign&amp;from=5&amp;to=12">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558705015?report=graph&amp;log$=nuclalign&amp;from=5&amp;to=12">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject      5  CGTCGTGA  12</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit86>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description86">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/558705013?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/558705013?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain E, Crystal Structure Of The Catalytic Domain Of Rlub In Complex With A 21-nucleotide Rna Substrate</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/558705013?report=genbank&amp;log$=nuclalign">pdb|4LGT|E</a>
+                    <span class=b>Length:</span> 21
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 5 to 12</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558705013?report=genbank&amp;log$=nuclalign&amp;from=5&amp;to=12">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558705013?report=graph&amp;log$=nuclalign&amp;from=5&amp;to=12">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject      5  CGTCGTGA  12</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit87>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description87">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/529280935?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/529280935?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, Thermus Thermophilus Ribosome</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/529280935?report=genbank&amp;log$=nuclalign">pdb|4BTD|A</a>
+                    <span class=b>Length:</span> 2915
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2048 to 2055</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/529280935?report=genbank&amp;log$=nuclalign&amp;from=2048&amp;to=2055">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/529280935?report=graph&amp;log$=nuclalign&amp;from=2048&amp;to=2055">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        8  CGTGAAGA  15
+                ||||||||
+Subject   2048  CGTGAAGA  2055</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2603 to 2610</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/529280935?report=genbank&amp;log$=nuclalign&amp;from=2603&amp;to=2610">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/529280935?report=graph&amp;log$=nuclalign&amp;from=2603&amp;to=2610">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2603  CGTCGTGA  2610</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit88>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description88">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/528082310?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/528082310?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, Crystal Structure Of Blasticidin S Bound To Thermus Thermophilus 70s Ribosome. This File Contains The 50s Subunit And Blasticidin S Molecule From The First 70s Ribosome. </p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/528082310?report=genbank&amp;log$=nuclalign">pdb|4L6J|A</a>
+                    <span class=b>Length:</span> 2879
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+                <a class=showmoretitles onclick="toggle_visibility('moretitles88'); return false;" href=''>
+                  See 1 more title(s)
+                </a>
+
+                <div class=moretitles id=moretitles88 style="display: none">
+                  <div class=title>
+                    <p class=hittitle>Chain A, Crystal Structure Of Blasticidin S Bound To Thermus Thermophilus 70s Ribosome. This File Contains The 50s Subunit And Blasticidin S Molecule From The Second 70s Ribosome</p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/528082364?report=genbank&amp;log$=nuclalign">pdb|4L6L|A</a>
+                    </p>
+                  </div>
+                </div>
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2021 to 2028</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/528082310?report=genbank&amp;log$=nuclalign&amp;from=2021&amp;to=2028">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/528082310?report=graph&amp;log$=nuclalign&amp;from=2021&amp;to=2028">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        8  CGTGAAGA  15
+                ||||||||
+Subject   2021  CGTGAAGA  2028</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2576 to 2583</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/528082310?report=genbank&amp;log$=nuclalign&amp;from=2576&amp;to=2583">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/528082310?report=graph&amp;log$=nuclalign&amp;from=2576&amp;to=2583">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2576  CGTCGTGA  2583</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit89>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description89">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/520729408?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/520729408?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, Crystal Structure Of The 70s Ribosome Bound With The Q253p Mutant Of Release Factor Rf2. 50s Of The A Subunit </p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/520729408?report=genbank&amp;log$=nuclalign">pdb|4KFI|A</a>
+                    <span class=b>Length:</span> 2879
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+                <a class=showmoretitles onclick="toggle_visibility('moretitles89'); return false;" href=''>
+                  See 1 more title(s)
+                </a>
+
+                <div class=moretitles id=moretitles89 style="display: none">
+                  <div class=title>
+                    <p class=hittitle>Chain A, Crystal Structure Of The 70s Ribosome Bound With The Q253p Mutant Of Release Factor Rf2. 50s Of The B Subunit</p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/520729463?report=genbank&amp;log$=nuclalign">pdb|4KFL|A</a>
+                    </p>
+                  </div>
+                </div>
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2021 to 2028</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/520729408?report=genbank&amp;log$=nuclalign&amp;from=2021&amp;to=2028">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/520729408?report=graph&amp;log$=nuclalign&amp;from=2021&amp;to=2028">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        8  CGTGAAGA  15
+                ||||||||
+Subject   2021  CGTGAAGA  2028</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2576 to 2583</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/520729408?report=genbank&amp;log$=nuclalign&amp;from=2576&amp;to=2583">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/520729408?report=graph&amp;log$=nuclalign&amp;from=2576&amp;to=2583">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2576  CGTCGTGA  2583</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit90>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description90">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/520728860?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/520728860?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, Crystal Structure Of Thermus Thermophilus 70s Containing Trnas And Mrna Stop Codon With Pseudouridine</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/520728860?report=genbank&amp;log$=nuclalign">pdb|4K0Q|A</a>
+                    <span class=b>Length:</span> 2915
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2048 to 2055</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/520728860?report=genbank&amp;log$=nuclalign&amp;from=2048&amp;to=2055">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/520728860?report=graph&amp;log$=nuclalign&amp;from=2048&amp;to=2055">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        8  CGTGAAGA  15
+                ||||||||
+Subject   2048  CGTGAAGA  2055</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2603 to 2610</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/520728860?report=genbank&amp;log$=nuclalign&amp;from=2603&amp;to=2610">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/520728860?report=graph&amp;log$=nuclalign&amp;from=2603&amp;to=2610">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2603  CGTCGTGA  2610</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit91>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description91">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/520728802?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/520728802?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, Crystal Structure Of Thermus Thermophilus 70s Containing Trnas And Mrna Stop Codon With Pseudouridine</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/520728802?report=genbank&amp;log$=nuclalign">pdb|4K0M|A</a>
+                    <span class=b>Length:</span> 2915
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2048 to 2055</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/520728802?report=genbank&amp;log$=nuclalign&amp;from=2048&amp;to=2055">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/520728802?report=graph&amp;log$=nuclalign&amp;from=2048&amp;to=2055">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        8  CGTGAAGA  15
+                ||||||||
+Subject   2048  CGTGAAGA  2055</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2603 to 2610</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/520728802?report=genbank&amp;log$=nuclalign&amp;from=2603&amp;to=2610">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/520728802?report=graph&amp;log$=nuclalign&amp;from=2603&amp;to=2610">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2603  CGTCGTGA  2610</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit92>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description92">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, Atomic Model Of The Immature 50s Subunit From Bacillus Subtilis (state I-a)</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=genbank&amp;log$=nuclalign">pdb|3J3V|A</a>
+                    <span class=b>Length:</span> 2927
+                    <span class=b>Number of Matches:</span> 5
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2620 to 2627</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=genbank&amp;log$=nuclalign&amp;from=2620&amp;to=2627">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=graph&amp;log$=nuclalign&amp;from=2620&amp;to=2627">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2620  CGTCGTGA  2627</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 340 to 346</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=genbank&amp;log$=nuclalign&amp;from=340&amp;to=346">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=graph&amp;log$=nuclalign&amp;from=340&amp;to=346">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query       10  TGAAGAG  16
+                |||||||
+Subject    340  TGAAGAG  346</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 440 to 446</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=genbank&amp;log$=nuclalign&amp;from=440&amp;to=446">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=graph&amp;log$=nuclalign&amp;from=440&amp;to=446">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        3  TCCGTCG  9
+                |||||||
+Subject    440  TCCGTCG  446</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 2056 to 2062</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=genbank&amp;log$=nuclalign&amp;from=2056&amp;to=2062">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=graph&amp;log$=nuclalign&amp;from=2056&amp;to=2062">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2056  GTGAAGA  2062</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 5: 2644 to 2650</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=genbank&amp;log$=nuclalign&amp;from=2644&amp;to=2650">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=graph&amp;log$=nuclalign&amp;from=2644&amp;to=2650">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        3  TCCGTCG  9
+                |||||||
+Subject   2644  TCCGTCG  2650</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit93>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description93">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, Atomic Model Of The Immature 50s Subunit From Bacillus Subtilis (state Ii-a)</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=genbank&amp;log$=nuclalign">pdb|3J3W|A</a>
+                    <span class=b>Length:</span> 2927
+                    <span class=b>Number of Matches:</span> 5
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2620 to 2627</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=genbank&amp;log$=nuclalign&amp;from=2620&amp;to=2627">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=graph&amp;log$=nuclalign&amp;from=2620&amp;to=2627">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2620  CGTCGTGA  2627</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 340 to 346</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=genbank&amp;log$=nuclalign&amp;from=340&amp;to=346">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=graph&amp;log$=nuclalign&amp;from=340&amp;to=346">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query       10  TGAAGAG  16
+                |||||||
+Subject    340  TGAAGAG  346</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 3: 440 to 446</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=genbank&amp;log$=nuclalign&amp;from=440&amp;to=446">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=graph&amp;log$=nuclalign&amp;from=440&amp;to=446">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        3  TCCGTCG  9
+                |||||||
+Subject    440  TCCGTCG  446</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 4: 2056 to 2062</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=genbank&amp;log$=nuclalign&amp;from=2056&amp;to=2062">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=graph&amp;log$=nuclalign&amp;from=2056&amp;to=2062">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        9  GTGAAGA  15
+                |||||||
+Subject   2056  GTGAAGA  2062</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 5: 2644 to 2650</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=genbank&amp;log$=nuclalign&amp;from=2644&amp;to=2650">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=graph&amp;log$=nuclalign&amp;from=2644&amp;to=2650">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        3  TCCGTCG  9
+                |||||||
+Subject   2644  TCCGTCG  2650</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit94>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description94">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/482676744?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/482676744?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, Crystal Structure Of The Bacterial Ribosome Ram Mutation G347u. This Entry Contains The 50s Ribosomal Subunit Of The Second 70s Molecule In The Asymmetric Unit</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/482676744?report=genbank&amp;log$=nuclalign">pdb|3V6X|A</a>
+                    <span class=b>Length:</span> 2916
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2048 to 2055</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/482676744?report=genbank&amp;log$=nuclalign&amp;from=2048&amp;to=2055">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/482676744?report=graph&amp;log$=nuclalign&amp;from=2048&amp;to=2055">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        8  CGTGAAGA  15
+                ||||||||
+Subject   2048  CGTGAAGA  2055</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2603 to 2610</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/482676744?report=genbank&amp;log$=nuclalign&amp;from=2603&amp;to=2610">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/482676744?report=graph&amp;log$=nuclalign&amp;from=2603&amp;to=2610">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2603  CGTCGTGA  2610</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit95>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description95">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/482676712?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/482676712?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, Crystal Structure Of The Bacterial Ribosome Ram Mutation G347u. This Entry Contains The 50s Ribosomal Subunit Of The First 70s Molecule In The Asymmetric Unit</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/482676712?report=genbank&amp;log$=nuclalign">pdb|3V6W|A</a>
+                    <span class=b>Length:</span> 2916
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2048 to 2055</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/482676712?report=genbank&amp;log$=nuclalign&amp;from=2048&amp;to=2055">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/482676712?report=graph&amp;log$=nuclalign&amp;from=2048&amp;to=2055">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        8  CGTGAAGA  15
+                ||||||||
+Subject   2048  CGTGAAGA  2055</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2603 to 2610</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/482676712?report=genbank&amp;log$=nuclalign&amp;from=2603&amp;to=2610">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/482676712?report=graph&amp;log$=nuclalign&amp;from=2603&amp;to=2610">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2603  CGTCGTGA  2610</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit96>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description96">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/428697829?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/428697829?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain d, The Cryo-Em Structure Of A 3d Dna-Origami Object</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/428697829?report=genbank&amp;log$=nuclalign">pdb|2YMI|DD</a>
+                    <span class=b>Length:</span> 56
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 52 to 45</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/428697829?report=genbank&amp;log$=nuclalign&amp;from=52&amp;to=45">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/428697829?report=graph&amp;log$=nuclalign&amp;from=52&amp;to=45">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject     52  CGTCGTGA  45</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit97>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description97">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/428697789?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/428697789?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, The Cryo-Em Structure Of A 3d Dna-Origami Object</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/428697789?report=genbank&amp;log$=nuclalign">pdb|2YMF|A</a>
+                    <span class=b>Length:</span> 4896
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 575 to 582</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/428697789?report=genbank&amp;log$=nuclalign&amp;from=575&amp;to=582">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/428697789?report=graph&amp;log$=nuclalign&amp;from=575&amp;to=582">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject    575  CGTCGTGA  582</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 561 to 567</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/428697789?report=genbank&amp;log$=nuclalign&amp;from=561&amp;to=567">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/428697789?report=graph&amp;log$=nuclalign&amp;from=561&amp;to=567">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.4 bits(7)</td>
+                      <td>185.8</td>
+                      <td>7/7(100%)</td>
+                      <td>0/7(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGT  10
+                |||||||
+Subject    561  CCGTCGT  567</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit98>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description98">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/396639330?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/396639330?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain A, Structure Of The Thermus Thermophilus 70s Ribosome Complexed With Mrna, Trna And Paromomycin (Part 2 Of 4). This File Contains The 50s Subunit From Molecule I. </p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/396639330?report=genbank&amp;log$=nuclalign">pdb|2J01|A</a>
+                    <span class=b>Length:</span> 2787
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+                <a class=showmoretitles onclick="toggle_visibility('moretitles98'); return false;" href=''>
+                  See 1 more title(s)
+                </a>
+
+                <div class=moretitles id=moretitles98 style="display: none">
+                  <div class=title>
+                    <p class=hittitle>Chain A, Structure Of The Thermus Thermophilus 70s Ribosome Complexed With Mrna, Trna And Paromomycin (Part 4 Of 4). This File Contains The 50s Subunit From Molecule Ii.</p>
+                    <p class=titleinfo>
+                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/396639355?report=genbank&amp;log$=nuclalign">pdb|2J03|A</a>
+                    </p>
+                  </div>
+                </div>
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 1948 to 1955</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/396639330?report=genbank&amp;log$=nuclalign&amp;from=1948&amp;to=1955">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/396639330?report=graph&amp;log$=nuclalign&amp;from=1948&amp;to=1955">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        8  CGTGAAGA  15
+                ||||||||
+Subject   1948  CGTGAAGA  1955</pre>
+                </div>
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 2: 2474 to 2481</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/396639330?report=genbank&amp;log$=nuclalign&amp;from=2474&amp;to=2481">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/396639330?report=graph&amp;log$=nuclalign&amp;from=2474&amp;to=2481">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject   2474  CGTCGTGA  2481</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit99>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description99">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/393715375?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/393715375?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain C, Crystal Structure Of I-Crei Complexed With Its Target Methylated At Position Plus 2 (In The B Strand) In The Presence Of Magnesium</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/393715375?report=genbank&amp;log$=nuclalign">pdb|4AQX|C</a>
+                    <span class=b>Length:</span> 14
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 7 to 14</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/393715375?report=genbank&amp;log$=nuclalign&amp;from=7&amp;to=14">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/393715375?report=graph&amp;log$=nuclalign&amp;from=7&amp;to=14">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject      7  CGTCGTGA  14</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit100>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description100">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/393715371?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/393715371?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain C, Crystal Structure Of I-Crei Complexed With Its Target Methylated At Position Plus 2 (In The B Strand) In The Presence Of Calcium</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/393715371?report=genbank&amp;log$=nuclalign">pdb|4AQU|C</a>
+                    <span class=b>Length:</span> 24
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 7 to 14</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/393715371?report=genbank&amp;log$=nuclalign&amp;from=7&amp;to=14">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/393715371?report=graph&amp;log$=nuclalign&amp;from=7&amp;to=14">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.4 bits(8)</td>
+                      <td>47.0</td>
+                      <td>8/8(100%)</td>
+                      <td>0/8(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        5  CGTCGTGA  12
+                ||||||||
+Subject      7  CGTCGTGA  14</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+
+    </div>
+
+    <footer>
+      This page was generated by <a href="...">blast2html</a>.
+    </footer>
+  </body>
+</html>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/blast xml example2.html	Thu May 15 17:22:02 2014 +0200
@@ -0,0 +1,424 @@
+<!DOCTYPE html>
+<html>
+  <head>
+    <meta charset="UTF-8">
+    <meta name=generator content="blast2html; see ...">
+    
+    <title>Blast output</title>
+    
+    <style>
+      body {
+      color: #333333;
+      font-family: Arial,Sans-Serif;
+      }
+
+      :link {
+      color: #336699;
+      }
+
+      .right {
+      float: right;
+      }
+
+      /* Galaxy with html sanitization enabled strips the header of this html page. If so, show the user a warning.*/
+      #strip_html_warning {
+      display: none;
+      }
+      
+      #content {
+      margin: 0 2em;
+      padding: 0.5em;
+      border: 1px solid #888888;
+      background-color: #d3dff5;
+      }
+
+      h1, h2, h3, h4, h5, h6 {
+      color: #2A6979;
+      font-family: arial,verdana,sans-serif;
+      letter-spacing: -1px;
+      margin: 1.2em 0 0.3em;
+      }
+
+      h1 {
+      border-bottom: 1px solid #CCCCCC;
+      font-size: 150%;
+      padding-bottom: 0.1em;
+      }
+
+      h2 {
+      font-size: 120%;
+      font-weight: bold;
+      }
+
+      h4.darkHeader {
+      color: #4D4D4D;
+      letter-spacing: 0;
+      font-weight: bold;
+      }
+
+      #nodata {
+      font-weight: bold;
+      }
+
+      .index {
+      margin-bottom: 3em;
+      }
+      .index div.indexentry {
+      margin: 1.2em 1.6em;
+      font-weight: bold;
+      font-size: 100%;
+      }
+      
+      .headerdata {
+      font-size: 90%;
+      }
+      .headerdata .param {
+      font-weight: bold;
+      text-align: right;
+      padding: 0 1em;
+      }
+
+      .grey {
+      background-color: #eeeeee;
+      border: 1px solid #cccccc;
+      padding: 1em;
+      }
+
+      .white {
+      background-color: white;
+      border: 1px solid #cccccc;
+      padding: 1.5em 2%;
+      }
+
+      .graphicrow {
+      clear: left;
+      width: 100%;
+      }
+
+      .graphicitem {
+      float: left;
+      }
+
+
+      
+      .graphics .grey {
+      text-align: center;
+      }
+
+      .graphic {
+      background-color: white;
+      border: 2px solid black;
+      padding: 1.5em;
+      margin: auto;
+      }
+
+      .centered, .defline, div.legend, div.tablewrapper {
+      margin-left: auto;
+      margin-right: auto;
+      }
+
+      .defline {
+      background-color: white;
+      border: 1px solid black;
+      margin: .5em auto;
+      padding-left: .2em;
+      padding-right: .2em;
+      max-width: 50em;
+      text-align: left;
+      height: 2.8em;
+      overflow-y: hidden;
+      }
+
+      div.legend {
+      max-width: 40em;
+      }
+      div.legend div {
+      width: 100%;
+      color: white;
+      font-weight: bold;
+      border-spacing: 0;
+      }
+      div.legend div .graphicitem {
+      width: 20%;
+      padding: 0;
+      margin: 0;
+      border: none;
+      }
+
+      div.tablewrapper {
+      width: 50%;
+      min-width: 60em;
+      }
+
+      /* For small widths we give the graphic 100% */
+      @media (max-width: 72.5em) {
+      div.tablewrapper {
+      width: 100%;
+      min-width: 0px;
+      }
+      }
+
+      .scale {
+      width: 100%;
+      margin: .5em 0;
+      font-weight: bold;
+      }
+      .scale div {
+      color: red;
+      text-align: left;
+      }
+      .scale .graphicrow {
+      margin: .5em 0 .5em 0;
+      color: white;
+      }
+      .scale .graphicitem {
+      position: relative;
+      }
+      .scale .graphicitem div {
+      margin: 0 1px;
+      padding: 0 2px;
+      text-align: right;
+      background-color: red;
+      color: white;
+      }
+      .scale .graphicitem:first-child div {
+      margin-left: 0px;
+      }
+      .scale .graphicitem:last-child div {
+      margin-right: 0px;
+      }
+      .scale .graphicitem .lastlabel {
+      position: absolute;
+      top: 0px;
+      left: 100%;
+      background-color: transparent;
+      color: red;
+      }
+
+      a.matchresult {
+      display: block;
+      margin: 0;
+      padding: 0;
+      }
+      div.matchrow {
+      margin-top: 4px;
+      }
+      div.matchrow, div.matchitem {
+      height: 4px;
+      }
+
+      
+      table.descriptiontable {
+      font-size: 85%;
+      border: 1px solid #97b0c8;
+      border-spacing: 0;
+      color: #222222;
+      line-height: 1.3em;
+      background-color: white;
+      }
+      table.descriptiontable col:first-child {
+      width: 100%;
+      }
+      table.descriptiontable tr:hover {
+      background-color: #D5DEE3;
+      }
+      table.descriptiontable th {
+      color: #14376C;
+      font-weight: normal;
+      background-color: #F0F0F0;
+      background: linear-gradient(#FFFFFF, #F0F0F0);
+      border-bottom: 1px solid #D4DFE9;
+      border-right: 1px solid #CFCFCF;
+      border-left: 0px solid black;
+      border-top: 0px solid black;
+      }
+      table.descriptiontable td {
+      overflow: hidden;
+      text-align: center;
+      padding: .4em .8em;
+      }
+      table.descriptiontable td div {
+      width: 1em;
+      overflow: visible;
+      white-space: nowrap;
+      text-align: left;
+      }
+
+
+      
+      .alignments .white {
+      padding: 1.5em 1em;
+      }
+      
+      .alignment {
+      border-top: 1px solid black;
+      padding-left: 1em;
+      padding-right: 1em;
+      }
+      
+      div.linkheader {
+      padding-top: .2em;
+      font-size: 85%;
+      color: #14376C;
+      }
+      div.linkheader a.linkheader {
+      margin-right: 1em;
+      }
+      div.linkheader .right a {
+      text-decoration: none;
+      }
+
+      .title .hittitle {
+      color: #222222;
+      margin-bottom: .3em;
+      }
+      .title .titleinfo {
+      font-size: 80%;
+      margin-top: 0;
+      margin-bottom: .3em;
+      }
+      .title .titleinfo .b {
+      color: #606060;
+      font-weight: bold;
+      font-size: 90%;
+      }
+
+      .moretitles {
+      margin: 1.2em;
+      }
+      .moretitles .titleinfo {
+      margin: 0;
+      padding: 0;
+      }
+      .moretitles .hittitle {
+      margin: .4em 0 .2em 0;
+      padding: 0;
+      }
+      
+      a.showmoretitles {
+      font-size: 75%;
+      color: #336699;
+      font-weight: bold;
+      margin-top: 0;
+      }
+      a.showmoretitles:hover {
+      }
+
+      .hotspot {
+      color: #606060;
+      font-family: verdana, arial, sans-serif;
+      margin-bottom: 2.5em;
+      }
+
+      .hotspot p.range {
+      font-size: 70%;
+      margin-top: 0;
+      margin-top: 1em;
+      margin-bottom: .2em;
+      }
+      .hotspot p.range span.range {
+      font-weight: bold;
+      }
+      .hotspot p.range a.range {
+      margin-left: .5em;
+      }
+
+      table.hotspotstable {
+      border-top: 1px solid;
+      border-bottom: 1px solid;
+      text-align: left;
+      border-collapse: collapse;
+      }
+      table.hotspotstable th, table.hotspotstable td {
+      padding: .1em 1em;
+      }
+      table.hotspotstable th {
+      font-size: 70%;
+      }
+      table.hotspotstable td {
+      min-width: 7em;
+      color: #222222;
+      font-size: 80%;
+      }
+
+      pre.alignmentgraphic {
+      color: #222222;
+      }
+
+      footer {
+      text-align: center;
+      color: #cccccc;
+      font-size: 70%;
+      margin-top: 1em;
+      }
+      footer :link {
+      color: #5588cc;
+      }
+      
+    </style>
+
+    <script type="text/javascript">
+      function toggle_visibility(id) {
+          var e = document.getElementById(id);
+          if(e.style.display != 'block')
+              e.style.display = 'block';
+          else
+              e.style.display = 'none';
+      }
+    </script>
+
+  </head>
+
+  
+  <body>
+    
+    <div id="strip_html_warning">
+      <!-- This div should be hidden by the header css block. Galaxy
+      strips all css, breaking this page but making this warning
+      visible. This warning contains some ugly old skool tabular html
+      layout that is not stripped. -->
+      <table bgcolor="#FFE5C9"><tr><td><font color="red"><b>
+                <font size=5><center>This html page seems to have been stripped by Galaxy.</center></font>
+                Disable Galaxy's html sanitization feature to view the full page (see <font face=monospace>sanitize_all_html</font> in your galaxy's universe_wsgi.ini), or download this page instead of viewing it in Galaxy.
+      </b></font></td></tr></table>
+    </div>
+    
+    <div id=content>
+
+
+
+      
+      <section class=match id=match1>
+      
+        <h1>Nucleotide Sequence (16 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>No definition line</td></tr>
+            <tr><td class=param>Query length:</td><td>16</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.28+</td></tr>
+            <tr><td class=param>Database:</td><td>/share/BlastDB/nt</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+
+    </div>
+
+    <footer>
+      This page was generated by <a href="...">blast2html</a>.
+    </footer>
+  </body>
+</html>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/blast xml example3.html	Thu May 15 17:22:02 2014 +0200
@@ -0,0 +1,3530 @@
+<!DOCTYPE html>
+<html>
+  <head>
+    <meta charset="UTF-8">
+    <meta name=generator content="blast2html; see ...">
+    
+    <title>Blast output</title>
+    
+    <style>
+      body {
+      color: #333333;
+      font-family: Arial,Sans-Serif;
+      }
+
+      :link {
+      color: #336699;
+      }
+
+      .right {
+      float: right;
+      }
+
+      /* Galaxy with html sanitization enabled strips the header of this html page. If so, show the user a warning.*/
+      #strip_html_warning {
+      display: none;
+      }
+      
+      #content {
+      margin: 0 2em;
+      padding: 0.5em;
+      border: 1px solid #888888;
+      background-color: #d3dff5;
+      }
+
+      h1, h2, h3, h4, h5, h6 {
+      color: #2A6979;
+      font-family: arial,verdana,sans-serif;
+      letter-spacing: -1px;
+      margin: 1.2em 0 0.3em;
+      }
+
+      h1 {
+      border-bottom: 1px solid #CCCCCC;
+      font-size: 150%;
+      padding-bottom: 0.1em;
+      }
+
+      h2 {
+      font-size: 120%;
+      font-weight: bold;
+      }
+
+      h4.darkHeader {
+      color: #4D4D4D;
+      letter-spacing: 0;
+      font-weight: bold;
+      }
+
+      #nodata {
+      font-weight: bold;
+      }
+
+      .index {
+      margin-bottom: 3em;
+      }
+      .index div.indexentry {
+      margin: 1.2em 1.6em;
+      font-weight: bold;
+      font-size: 100%;
+      }
+      
+      .headerdata {
+      font-size: 90%;
+      }
+      .headerdata .param {
+      font-weight: bold;
+      text-align: right;
+      padding: 0 1em;
+      }
+
+      .grey {
+      background-color: #eeeeee;
+      border: 1px solid #cccccc;
+      padding: 1em;
+      }
+
+      .white {
+      background-color: white;
+      border: 1px solid #cccccc;
+      padding: 1.5em 2%;
+      }
+
+      .graphicrow {
+      clear: left;
+      width: 100%;
+      }
+
+      .graphicitem {
+      float: left;
+      }
+
+
+      
+      .graphics .grey {
+      text-align: center;
+      }
+
+      .graphic {
+      background-color: white;
+      border: 2px solid black;
+      padding: 1.5em;
+      margin: auto;
+      }
+
+      .centered, .defline, div.legend, div.tablewrapper {
+      margin-left: auto;
+      margin-right: auto;
+      }
+
+      .defline {
+      background-color: white;
+      border: 1px solid black;
+      margin: .5em auto;
+      padding-left: .2em;
+      padding-right: .2em;
+      max-width: 50em;
+      text-align: left;
+      height: 2.8em;
+      overflow-y: hidden;
+      }
+
+      div.legend {
+      max-width: 40em;
+      }
+      div.legend div {
+      width: 100%;
+      color: white;
+      font-weight: bold;
+      border-spacing: 0;
+      }
+      div.legend div .graphicitem {
+      width: 20%;
+      padding: 0;
+      margin: 0;
+      border: none;
+      }
+
+      div.tablewrapper {
+      width: 50%;
+      min-width: 60em;
+      }
+
+      /* For small widths we give the graphic 100% */
+      @media (max-width: 72.5em) {
+      div.tablewrapper {
+      width: 100%;
+      min-width: 0px;
+      }
+      }
+
+      .scale {
+      width: 100%;
+      margin: .5em 0;
+      font-weight: bold;
+      }
+      .scale div {
+      color: red;
+      text-align: left;
+      }
+      .scale .graphicrow {
+      margin: .5em 0 .5em 0;
+      color: white;
+      }
+      .scale .graphicitem {
+      position: relative;
+      }
+      .scale .graphicitem div {
+      margin: 0 1px;
+      padding: 0 2px;
+      text-align: right;
+      background-color: red;
+      color: white;
+      }
+      .scale .graphicitem:first-child div {
+      margin-left: 0px;
+      }
+      .scale .graphicitem:last-child div {
+      margin-right: 0px;
+      }
+      .scale .graphicitem .lastlabel {
+      position: absolute;
+      top: 0px;
+      left: 100%;
+      background-color: transparent;
+      color: red;
+      }
+
+      a.matchresult {
+      display: block;
+      margin: 0;
+      padding: 0;
+      }
+      div.matchrow {
+      margin-top: 4px;
+      }
+      div.matchrow, div.matchitem {
+      height: 4px;
+      }
+
+      
+      table.descriptiontable {
+      font-size: 85%;
+      border: 1px solid #97b0c8;
+      border-spacing: 0;
+      color: #222222;
+      line-height: 1.3em;
+      background-color: white;
+      }
+      table.descriptiontable col:first-child {
+      width: 100%;
+      }
+      table.descriptiontable tr:hover {
+      background-color: #D5DEE3;
+      }
+      table.descriptiontable th {
+      color: #14376C;
+      font-weight: normal;
+      background-color: #F0F0F0;
+      background: linear-gradient(#FFFFFF, #F0F0F0);
+      border-bottom: 1px solid #D4DFE9;
+      border-right: 1px solid #CFCFCF;
+      border-left: 0px solid black;
+      border-top: 0px solid black;
+      }
+      table.descriptiontable td {
+      overflow: hidden;
+      text-align: center;
+      padding: .4em .8em;
+      }
+      table.descriptiontable td div {
+      width: 1em;
+      overflow: visible;
+      white-space: nowrap;
+      text-align: left;
+      }
+
+
+      
+      .alignments .white {
+      padding: 1.5em 1em;
+      }
+      
+      .alignment {
+      border-top: 1px solid black;
+      padding-left: 1em;
+      padding-right: 1em;
+      }
+      
+      div.linkheader {
+      padding-top: .2em;
+      font-size: 85%;
+      color: #14376C;
+      }
+      div.linkheader a.linkheader {
+      margin-right: 1em;
+      }
+      div.linkheader .right a {
+      text-decoration: none;
+      }
+
+      .title .hittitle {
+      color: #222222;
+      margin-bottom: .3em;
+      }
+      .title .titleinfo {
+      font-size: 80%;
+      margin-top: 0;
+      margin-bottom: .3em;
+      }
+      .title .titleinfo .b {
+      color: #606060;
+      font-weight: bold;
+      font-size: 90%;
+      }
+
+      .moretitles {
+      margin: 1.2em;
+      }
+      .moretitles .titleinfo {
+      margin: 0;
+      padding: 0;
+      }
+      .moretitles .hittitle {
+      margin: .4em 0 .2em 0;
+      padding: 0;
+      }
+      
+      a.showmoretitles {
+      font-size: 75%;
+      color: #336699;
+      font-weight: bold;
+      margin-top: 0;
+      }
+      a.showmoretitles:hover {
+      }
+
+      .hotspot {
+      color: #606060;
+      font-family: verdana, arial, sans-serif;
+      margin-bottom: 2.5em;
+      }
+
+      .hotspot p.range {
+      font-size: 70%;
+      margin-top: 0;
+      margin-top: 1em;
+      margin-bottom: .2em;
+      }
+      .hotspot p.range span.range {
+      font-weight: bold;
+      }
+      .hotspot p.range a.range {
+      margin-left: .5em;
+      }
+
+      table.hotspotstable {
+      border-top: 1px solid;
+      border-bottom: 1px solid;
+      text-align: left;
+      border-collapse: collapse;
+      }
+      table.hotspotstable th, table.hotspotstable td {
+      padding: .1em 1em;
+      }
+      table.hotspotstable th {
+      font-size: 70%;
+      }
+      table.hotspotstable td {
+      min-width: 7em;
+      color: #222222;
+      font-size: 80%;
+      }
+
+      pre.alignmentgraphic {
+      color: #222222;
+      }
+
+      footer {
+      text-align: center;
+      color: #cccccc;
+      font-size: 70%;
+      margin-top: 1em;
+      }
+      footer :link {
+      color: #5588cc;
+      }
+      
+    </style>
+
+    <script type="text/javascript">
+      function toggle_visibility(id) {
+          var e = document.getElementById(id);
+          if(e.style.display != 'block')
+              e.style.display = 'block';
+          else
+              e.style.display = 'none';
+      }
+    </script>
+
+  </head>
+
+  
+  <body>
+    
+    <div id="strip_html_warning">
+      <!-- This div should be hidden by the header css block. Galaxy
+      strips all css, breaking this page but making this warning
+      visible. This warning contains some ugly old skool tabular html
+      layout that is not stripped. -->
+      <table bgcolor="#FFE5C9"><tr><td><font color="red"><b>
+                <font size=5><center>This html page seems to have been stripped by Galaxy.</center></font>
+                Disable Galaxy's html sanitization feature to view the full page (see <font face=monospace>sanitize_all_html</font> in your galaxy's universe_wsgi.ini), or download this page instead of viewing it in Galaxy.
+      </b></font></td></tr></table>
+    </div>
+    
+    <div id=content>
+
+
+      <section class=index>
+        <h1>Queries</h1>
+
+        <div class=indexentry><a href="#match1">
+            Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match2">
+            Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match3">
+            Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 1 hits)
+        </a></div>
+        <div class=indexentry><a href="#match4">
+            Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match5">
+            Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match6">
+            Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 1 hits)
+        </a></div>
+        <div class=indexentry><a href="#match7">
+            Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match8">
+            Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match9">
+            Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match10">
+            Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match11">
+            Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match12">
+            Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match13">
+            Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match14">
+            Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match15">
+            Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match16">
+            Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match17">
+            Query_3: Probe|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match18">
+            Query_3: Probe|NOST-Spec_(Genetic_ID)
+            (20 letters, 1 hits)
+        </a></div>
+        <div class=indexentry><a href="#match19">
+            Query_3: Probe|NOST-Spec_(Genetic_ID)
+            (20 letters, 1 hits)
+        </a></div>
+        <div class=indexentry><a href="#match20">
+            Query_3: Probe|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match21">
+            Query_3: Probe|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match22">
+            Query_3: Probe|NOST-Spec_(Genetic_ID)
+            (20 letters, 1 hits)
+        </a></div>
+        <div class=indexentry><a href="#match23">
+            Query_3: Probe|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match24">
+            Query_3: Probe|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match25">
+            Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (24 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match26">
+            Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (24 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match27">
+            Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (24 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match28">
+            Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (24 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match29">
+            Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (24 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match30">
+            Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (24 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match31">
+            Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (24 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match32">
+            Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (24 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match33">
+            Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match34">
+            Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match35">
+            Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match36">
+            Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match37">
+            Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match38">
+            Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match39">
+            Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match40">
+            Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match41">
+            Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+            (25 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match42">
+            Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+            (25 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match43">
+            Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+            (25 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match44">
+            Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+            (25 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match45">
+            Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+            (25 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match46">
+            Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+            (25 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match47">
+            Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+            (25 letters, 1 hits)
+        </a></div>
+        <div class=indexentry><a href="#match48">
+            Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+            (25 letters, 1 hits)
+        </a></div>
+        <div class=indexentry><a href="#match49">
+            Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+            (74 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match50">
+            Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+            (74 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match51">
+            Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+            (74 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match52">
+            Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+            (74 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match53">
+            Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+            (74 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match54">
+            Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+            (74 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match55">
+            Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+            (74 letters, 1 hits)
+        </a></div>
+        <div class=indexentry><a href="#match56">
+            Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+            (74 letters, 1 hits)
+        </a></div>
+
+      </section>
+
+      
+      <section class=match id=match1>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match2>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match3>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h2>Graphic Summary</h2>
+
+          <div class=grey>
+            <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+
+            <div class=defline id=defline3>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">200≤</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>2</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>4</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>6</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>8</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>10</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>12</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>14</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>16</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>18</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>20</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit1"
+                   onmouseover='document.getElementById("defline3").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"'
+                   onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h2>Descriptions</h2>
+
+          <div class=grey><div class=white>
+              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit1"
+                              title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"
+                              id="description1">
+                        DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000
+                  </a></div></td>
+                  <td>37.4</td>
+                  <td>37.4</td>
+                  <td>100%</td>
+                  <td>7.011e-08</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&amp;log$=nuclalign">Subject_3</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h2>Alignments</h2>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description1">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&amp;log$=nuclalign">Subject_3</a>
+                    <span class=b>Length:</span> 323
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 200 to 219</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&amp;log$=nuclalign&amp;from=200&amp;to=219">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=graph&amp;log$=nuclalign&amp;from=200&amp;to=219">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>37.4 bits(40)</td>
+                      <td>0.0</td>
+                      <td>20/20(100%)</td>
+                      <td>0/20(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  AGCGCGCAAACTAGGATAAA  20
+                ||||||||||||||||||||
+Subject    200  AGCGCGCAAACTAGGATAAA  219</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+      
+      <section class=match id=match4>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match5>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match6>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h2>Graphic Summary</h2>
+
+          <div class=grey>
+            <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+
+            <div class=defline id=defline6>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">200≤</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>2</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>4</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>6</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>8</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>10</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>12</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>14</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>16</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>18</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>20</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit1"
+                   onmouseover='document.getElementById("defline6").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"'
+                   onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h2>Descriptions</h2>
+
+          <div class=grey><div class=white>
+              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit1"
+                              title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"
+                              id="description1">
+                        AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000
+                  </a></div></td>
+                  <td>37.4</td>
+                  <td>37.4</td>
+                  <td>100%</td>
+                  <td>7.011e-08</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&amp;log$=nuclalign">Subject_6</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h2>Alignments</h2>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description1">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&amp;log$=nuclalign">Subject_6</a>
+                    <span class=b>Length:</span> 2457
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2119 to 2138</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&amp;log$=nuclalign&amp;from=2119&amp;to=2138">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=graph&amp;log$=nuclalign&amp;from=2119&amp;to=2138">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>37.4 bits(40)</td>
+                      <td>0.0</td>
+                      <td>20/20(100%)</td>
+                      <td>0/20(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  AGCGCGCAAACTAGGATAAA  20
+                ||||||||||||||||||||
+Subject   2119  AGCGCGCAAACTAGGATAAA  2138</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+      
+      <section class=match id=match7>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match8>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match9>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match10>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match11>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match12>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match13>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match14>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match15>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match16>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match17>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match18>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h2>Graphic Summary</h2>
+
+          <div class=grey>
+            <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+
+            <div class=defline id=defline18>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">200≤</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>2</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>4</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>6</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>8</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>10</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>12</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>14</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>16</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>18</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>20</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit1"
+                   onmouseover='document.getElementById("defline18").innerHTML="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3\u0027UTR/plant_junction_region.|-9105899556052450000"'
+                   onmouseout='document.getElementById("defline18").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3&#39;UTR/plant_junction_region.|-9105899556052450000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 15.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 85.0%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h2>Descriptions</h2>
+
+          <div class=grey><div class=white>
+              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit1"
+                              title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3&#39;UTR/plant_junction_region.|-9105899556052450000"
+                              id="description1">
+                        AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3&#39;UTR/plant_junction_region.|-9105899556052450000
+                  </a></div></td>
+                  <td>31.9</td>
+                  <td>31.9</td>
+                  <td>85%</td>
+                  <td>2.981e-06</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=genbank&amp;log$=nuclalign">Subject_2</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h2>Alignments</h2>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description1">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3&#39;UTR/plant_junction_region.|-9105899556052450000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=genbank&amp;log$=nuclalign">Subject_2</a>
+                    <span class=b>Length:</span> 1045
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2 to 18</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=genbank&amp;log$=nuclalign&amp;from=2&amp;to=18">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=graph&amp;log$=nuclalign&amp;from=2&amp;to=18">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>31.9 bits(34)</td>
+                      <td>0.0</td>
+                      <td>17/17(100%)</td>
+                      <td>0/17(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  GCGCGGTGTCATCTATG  20
+                |||||||||||||||||
+Subject      2  GCGCGGTGTCATCTATG  18</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+      
+      <section class=match id=match19>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h2>Graphic Summary</h2>
+
+          <div class=grey>
+            <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+
+            <div class=defline id=defline19>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">200≤</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>2</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>4</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>6</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>8</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>10</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>12</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>14</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>16</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>18</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>20</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit1"
+                   onmouseover='document.getElementById("defline19").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"'
+                   onmouseout='document.getElementById("defline19").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h2>Descriptions</h2>
+
+          <div class=grey><div class=white>
+              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit1"
+                              title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"
+                              id="description1">
+                        DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000
+                  </a></div></td>
+                  <td>37.4</td>
+                  <td>37.4</td>
+                  <td>100%</td>
+                  <td>7.011e-08</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&amp;log$=nuclalign">Subject_3</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h2>Alignments</h2>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description1">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&amp;log$=nuclalign">Subject_3</a>
+                    <span class=b>Length:</span> 323
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 224 to 243</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&amp;log$=nuclalign&amp;from=224&amp;to=243">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=graph&amp;log$=nuclalign&amp;from=224&amp;to=243">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>37.4 bits(40)</td>
+                      <td>0.0</td>
+                      <td>20/20(100%)</td>
+                      <td>0/20(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGCGCGCGGTGTCATCTATG  20
+                ||||||||||||||||||||
+Subject    224  CGCGCGCGGTGTCATCTATG  243</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+      
+      <section class=match id=match20>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match21>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match22>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h2>Graphic Summary</h2>
+
+          <div class=grey>
+            <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+
+            <div class=defline id=defline22>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">200≤</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>2</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>4</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>6</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>8</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>10</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>12</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>14</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>16</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>18</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>20</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit1"
+                   onmouseover='document.getElementById("defline22").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"'
+                   onmouseout='document.getElementById("defline22").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h2>Descriptions</h2>
+
+          <div class=grey><div class=white>
+              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit1"
+                              title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"
+                              id="description1">
+                        AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000
+                  </a></div></td>
+                  <td>37.4</td>
+                  <td>37.4</td>
+                  <td>100%</td>
+                  <td>7.011e-08</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&amp;log$=nuclalign">Subject_6</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h2>Alignments</h2>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description1">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&amp;log$=nuclalign">Subject_6</a>
+                    <span class=b>Length:</span> 2457
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2143 to 2162</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&amp;log$=nuclalign&amp;from=2143&amp;to=2162">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=graph&amp;log$=nuclalign&amp;from=2143&amp;to=2162">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>37.4 bits(40)</td>
+                      <td>0.0</td>
+                      <td>20/20(100%)</td>
+                      <td>0/20(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGCGCGCGGTGTCATCTATG  20
+                ||||||||||||||||||||
+Subject   2143  CGCGCGCGGTGTCATCTATG  2162</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+      
+      <section class=match id=match23>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match24>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match25>
+      
+        <h1>Nucleotide Sequence (24 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match26>
+      
+        <h1>Nucleotide Sequence (24 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match27>
+      
+        <h1>Nucleotide Sequence (24 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match28>
+      
+        <h1>Nucleotide Sequence (24 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match29>
+      
+        <h1>Nucleotide Sequence (24 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match30>
+      
+        <h1>Nucleotide Sequence (24 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match31>
+      
+        <h1>Nucleotide Sequence (24 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match32>
+      
+        <h1>Nucleotide Sequence (24 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match33>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match34>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match35>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match36>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match37>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match38>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match39>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match40>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match41>
+      
+        <h1>Nucleotide Sequence (25 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match42>
+      
+        <h1>Nucleotide Sequence (25 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match43>
+      
+        <h1>Nucleotide Sequence (25 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match44>
+      
+        <h1>Nucleotide Sequence (25 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match45>
+      
+        <h1>Nucleotide Sequence (25 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match46>
+      
+        <h1>Nucleotide Sequence (25 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match47>
+      
+        <h1>Nucleotide Sequence (25 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h2>Graphic Summary</h2>
+
+          <div class=grey>
+            <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+
+            <div class=defline id=defline47>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">200≤</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 12.0%">
+                        <div>3</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.0%">
+                        <div>6</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.0%">
+                        <div>9</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.0%">
+                        <div>12</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.0%">
+                        <div>15</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.0%">
+                        <div>18</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.0%">
+                        <div>21</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.0%">
+                        <div>24</div>
+                      </div>
+                      <div class=graphicitem style="width: 4.0%">
+                        <div>25</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit1"
+                   onmouseover='document.getElementById("defline47").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"'
+                   onmouseout='document.getElementById("defline47").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h2>Descriptions</h2>
+
+          <div class=grey><div class=white>
+              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit1"
+                              title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"
+                              id="description1">
+                        AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000
+                  </a></div></td>
+                  <td>37.4</td>
+                  <td>37.4</td>
+                  <td>100%</td>
+                  <td>9.338e-08</td>
+                  <td>92%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&amp;log$=nuclalign">Subject_7</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h2>Alignments</h2>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description1">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&amp;log$=nuclalign">Subject_7</a>
+                    <span class=b>Length:</span> 4180
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 1541 to 1565</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&amp;log$=nuclalign&amp;from=1541&amp;to=1565">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=graph&amp;log$=nuclalign&amp;from=1541&amp;to=1565">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>37.4 bits(40)</td>
+                      <td>0.0</td>
+                      <td>23/25(92%)</td>
+                      <td>0/25(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  ACATGAACAGCGCCTTGACCACAGC  25
+                |||||||||||||| ||||||| ||
+Subject   1541  ACATGAACAGCGCCCTGACCACCGC  1565</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+      
+      <section class=match id=match48>
+      
+        <h1>Nucleotide Sequence (25 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h2>Graphic Summary</h2>
+
+          <div class=grey>
+            <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+
+            <div class=defline id=defline48>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">200≤</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 12.0%">
+                        <div>3</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.0%">
+                        <div>6</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.0%">
+                        <div>9</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.0%">
+                        <div>12</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.0%">
+                        <div>15</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.0%">
+                        <div>18</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.0%">
+                        <div>21</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.0%">
+                        <div>24</div>
+                      </div>
+                      <div class=graphicitem style="width: 4.0%">
+                        <div>25</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit1"
+                   onmouseover='document.getElementById("defline48").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"'
+                   onmouseout='document.getElementById("defline48").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h2>Descriptions</h2>
+
+          <div class=grey><div class=white>
+              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit1"
+                              title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"
+                              id="description1">
+                        EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000
+                  </a></div></td>
+                  <td>37.4</td>
+                  <td>37.4</td>
+                  <td>100%</td>
+                  <td>9.338e-08</td>
+                  <td>92%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&amp;log$=nuclalign">Subject_8</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h2>Alignments</h2>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description1">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&amp;log$=nuclalign">Subject_8</a>
+                    <span class=b>Length:</span> 4983
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2344 to 2368</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&amp;log$=nuclalign&amp;from=2344&amp;to=2368">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=graph&amp;log$=nuclalign&amp;from=2344&amp;to=2368">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>37.4 bits(40)</td>
+                      <td>0.0</td>
+                      <td>23/25(92%)</td>
+                      <td>0/25(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  ACATGAACAGCGCCTTGACCACAGC  25
+                |||||||||||||| ||||||| ||
+Subject   2344  ACATGAACAGCGCCCTGACCACCGC  2368</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+      
+      <section class=match id=match49>
+      
+        <h1>Nucleotide Sequence (74 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match50>
+      
+        <h1>Nucleotide Sequence (74 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match51>
+      
+        <h1>Nucleotide Sequence (74 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match52>
+      
+        <h1>Nucleotide Sequence (74 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match53>
+      
+        <h1>Nucleotide Sequence (74 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match54>
+      
+        <h1>Nucleotide Sequence (74 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match55>
+      
+        <h1>Nucleotide Sequence (74 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h2>Graphic Summary</h2>
+
+          <div class=grey>
+            <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+
+            <div class=defline id=defline55>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">200≤</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>8</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>16</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>24</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>32</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>40</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>48</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>56</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>64</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>72</div>
+                      </div>
+                      <div class=graphicitem style="width: 2.7027027027027026%">
+                        <div>&nbsp;</div>
+                        <div class=lastlabel>74</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit1"
+                   onmouseover='document.getElementById("defline55").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"'
+                   onmouseout='document.getElementById("defline55").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: green; width: 100.0%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h2>Descriptions</h2>
+
+          <div class=grey><div class=white>
+              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit1"
+                              title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"
+                              id="description1">
+                        AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000
+                  </a></div></td>
+                  <td>89.7</td>
+                  <td>89.7</td>
+                  <td>100%</td>
+                  <td>6.629e-23</td>
+                  <td>86%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&amp;log$=nuclalign">Subject_7</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h2>Alignments</h2>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description1">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&amp;log$=nuclalign">Subject_7</a>
+                    <span class=b>Length:</span> 4180
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 1516 to 1589</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&amp;log$=nuclalign&amp;from=1516&amp;to=1589">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=graph&amp;log$=nuclalign&amp;from=1516&amp;to=1589">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>89.7 bits(98)</td>
+                      <td>0.0</td>
+                      <td>64/74(86%)</td>
+                      <td>0/74(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTGTTCGCAGTCCAGAA  74
+                ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | ||||| ||||||||
+Subject   1516  GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA  1589</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+      
+      <section class=match id=match56>
+      
+        <h1>Nucleotide Sequence (74 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td></td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h2>Graphic Summary</h2>
+
+          <div class=grey>
+            <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+
+            <div class=defline id=defline56>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">200≤</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>8</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>16</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>24</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>32</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>40</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>48</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>56</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>64</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>72</div>
+                      </div>
+                      <div class=graphicitem style="width: 2.7027027027027026%">
+                        <div>&nbsp;</div>
+                        <div class=lastlabel>74</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit1"
+                   onmouseover='document.getElementById("defline56").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"'
+                   onmouseout='document.getElementById("defline56").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: green; width: 100.0%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h2>Descriptions</h2>
+
+          <div class=grey><div class=white>
+              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit1"
+                              title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"
+                              id="description1">
+                        EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000
+                  </a></div></td>
+                  <td>89.7</td>
+                  <td>89.7</td>
+                  <td>100%</td>
+                  <td>6.629e-23</td>
+                  <td>86%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&amp;log$=nuclalign">Subject_8</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h2>Alignments</h2>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description1">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&amp;log$=nuclalign">Subject_8</a>
+                    <span class=b>Length:</span> 4983
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2319 to 2392</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&amp;log$=nuclalign&amp;from=2319&amp;to=2392">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=graph&amp;log$=nuclalign&amp;from=2319&amp;to=2392">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>89.7 bits(98)</td>
+                      <td>0.0</td>
+                      <td>64/74(86%)</td>
+                      <td>0/74(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTGTTCGCAGTCCAGAA  74
+                ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | ||||| ||||||||
+Subject   2319  GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA  2392</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+
+    </div>
+
+    <footer>
+      This page was generated by <a href="...">blast2html</a>.
+    </footer>
+  </body>
+</html>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/blast xml example3.xml	Thu May 15 17:22:02 2014 +0200
@@ -0,0 +1,1387 @@
+<?xml version="1.0"?>
+<!DOCTYPE BlastOutput PUBLIC "-//NCBI//NCBI BlastOutput/EN" "http://www.ncbi.nlm.nih.gov/dtd/NCBI_BlastOutput.dtd">
+<BlastOutput>
+  <BlastOutput_program>blastn</BlastOutput_program>
+  <BlastOutput_version>BLASTN 2.2.29+</BlastOutput_version>
+  <BlastOutput_reference>Stephen F. Altschul, Thomas L. Madden, Alejandro A. Sch&amp;auml;ffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), &quot;Gapped BLAST and PSI-BLAST: a new generation of protein database search programs&quot;, Nucleic Acids Res. 25:3389-3402.</BlastOutput_reference>
+  <BlastOutput_db></BlastOutput_db>
+  <BlastOutput_query-ID>Query_1</BlastOutput_query-ID>
+  <BlastOutput_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</BlastOutput_query-def>
+  <BlastOutput_query-len>20</BlastOutput_query-len>
+  <BlastOutput_param>
+    <Parameters>
+      <Parameters_expect>0.001</Parameters_expect>
+      <Parameters_sc-match>2</Parameters_sc-match>
+      <Parameters_sc-mismatch>-3</Parameters_sc-mismatch>
+      <Parameters_gap-open>5</Parameters_gap-open>
+      <Parameters_gap-extend>2</Parameters_gap-extend>
+      <Parameters_filter>L;m;</Parameters_filter>
+    </Parameters>
+  </BlastOutput_param>
+<BlastOutput_iterations>
+<Iteration>
+  <Iteration_iter-num>1</Iteration_iter-num>
+  <Iteration_query-ID>Query_1</Iteration_query-ID>
+  <Iteration_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>2</Iteration_iter-num>
+  <Iteration_query-ID>Query_1</Iteration_query-ID>
+  <Iteration_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>3</Iteration_iter-num>
+  <Iteration_query-ID>Query_1</Iteration_query-ID>
+  <Iteration_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+<Hit>
+  <Hit_num>1</Hit_num>
+  <Hit_id>Subject_3</Hit_id>
+  <Hit_def>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</Hit_def>
+  <Hit_accession>Subject_3</Hit_accession>
+  <Hit_len>323</Hit_len>
+  <Hit_hsps>
+    <Hsp>
+      <Hsp_num>1</Hsp_num>
+      <Hsp_bit-score>37.3537</Hsp_bit-score>
+      <Hsp_score>40</Hsp_score>
+      <Hsp_evalue>7.01052e-08</Hsp_evalue>
+      <Hsp_query-from>1</Hsp_query-from>
+      <Hsp_query-to>20</Hsp_query-to>
+      <Hsp_hit-from>200</Hsp_hit-from>
+      <Hsp_hit-to>219</Hsp_hit-to>
+      <Hsp_query-frame>1</Hsp_query-frame>
+      <Hsp_hit-frame>1</Hsp_hit-frame>
+      <Hsp_identity>20</Hsp_identity>
+      <Hsp_positive>20</Hsp_positive>
+      <Hsp_gaps>0</Hsp_gaps>
+      <Hsp_align-len>20</Hsp_align-len>
+      <Hsp_qseq>AGCGCGCAAACTAGGATAAA</Hsp_qseq>
+      <Hsp_hseq>AGCGCGCAAACTAGGATAAA</Hsp_hseq>
+      <Hsp_midline>||||||||||||||||||||</Hsp_midline>
+    </Hsp>
+  </Hit_hsps>
+</Hit>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>4</Iteration_iter-num>
+  <Iteration_query-ID>Query_1</Iteration_query-ID>
+  <Iteration_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>5</Iteration_iter-num>
+  <Iteration_query-ID>Query_1</Iteration_query-ID>
+  <Iteration_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>6</Iteration_iter-num>
+  <Iteration_query-ID>Query_1</Iteration_query-ID>
+  <Iteration_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+<Hit>
+  <Hit_num>1</Hit_num>
+  <Hit_id>Subject_6</Hit_id>
+  <Hit_def>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</Hit_def>
+  <Hit_accession>Subject_6</Hit_accession>
+  <Hit_len>2457</Hit_len>
+  <Hit_hsps>
+    <Hsp>
+      <Hsp_num>1</Hsp_num>
+      <Hsp_bit-score>37.3537</Hsp_bit-score>
+      <Hsp_score>40</Hsp_score>
+      <Hsp_evalue>7.01052e-08</Hsp_evalue>
+      <Hsp_query-from>1</Hsp_query-from>
+      <Hsp_query-to>20</Hsp_query-to>
+      <Hsp_hit-from>2119</Hsp_hit-from>
+      <Hsp_hit-to>2138</Hsp_hit-to>
+      <Hsp_query-frame>1</Hsp_query-frame>
+      <Hsp_hit-frame>1</Hsp_hit-frame>
+      <Hsp_identity>20</Hsp_identity>
+      <Hsp_positive>20</Hsp_positive>
+      <Hsp_gaps>0</Hsp_gaps>
+      <Hsp_align-len>20</Hsp_align-len>
+      <Hsp_qseq>AGCGCGCAAACTAGGATAAA</Hsp_qseq>
+      <Hsp_hseq>AGCGCGCAAACTAGGATAAA</Hsp_hseq>
+      <Hsp_midline>||||||||||||||||||||</Hsp_midline>
+    </Hsp>
+  </Hit_hsps>
+</Hit>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>7</Iteration_iter-num>
+  <Iteration_query-ID>Query_1</Iteration_query-ID>
+  <Iteration_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>8</Iteration_iter-num>
+  <Iteration_query-ID>Query_1</Iteration_query-ID>
+  <Iteration_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>9</Iteration_iter-num>
+  <Iteration_query-ID>Query_2</Iteration_query-ID>
+  <Iteration_query-def>Reverse_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>10</Iteration_iter-num>
+  <Iteration_query-ID>Query_2</Iteration_query-ID>
+  <Iteration_query-def>Reverse_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>11</Iteration_iter-num>
+  <Iteration_query-ID>Query_2</Iteration_query-ID>
+  <Iteration_query-def>Reverse_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>12</Iteration_iter-num>
+  <Iteration_query-ID>Query_2</Iteration_query-ID>
+  <Iteration_query-def>Reverse_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>13</Iteration_iter-num>
+  <Iteration_query-ID>Query_2</Iteration_query-ID>
+  <Iteration_query-def>Reverse_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>14</Iteration_iter-num>
+  <Iteration_query-ID>Query_2</Iteration_query-ID>
+  <Iteration_query-def>Reverse_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>15</Iteration_iter-num>
+  <Iteration_query-ID>Query_2</Iteration_query-ID>
+  <Iteration_query-def>Reverse_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>16</Iteration_iter-num>
+  <Iteration_query-ID>Query_2</Iteration_query-ID>
+  <Iteration_query-def>Reverse_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>17</Iteration_iter-num>
+  <Iteration_query-ID>Query_3</Iteration_query-ID>
+  <Iteration_query-def>Probe|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>18</Iteration_iter-num>
+  <Iteration_query-ID>Query_3</Iteration_query-ID>
+  <Iteration_query-def>Probe|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+<Hit>
+  <Hit_num>1</Hit_num>
+  <Hit_id>Subject_2</Hit_id>
+  <Hit_def>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3&apos;UTR/plant_junction_region.|-9105899556052450000</Hit_def>
+  <Hit_accession>Subject_2</Hit_accession>
+  <Hit_len>1045</Hit_len>
+  <Hit_hsps>
+    <Hsp>
+      <Hsp_num>1</Hsp_num>
+      <Hsp_bit-score>31.9436</Hsp_bit-score>
+      <Hsp_score>34</Hsp_score>
+      <Hsp_evalue>2.98095e-06</Hsp_evalue>
+      <Hsp_query-from>4</Hsp_query-from>
+      <Hsp_query-to>20</Hsp_query-to>
+      <Hsp_hit-from>2</Hsp_hit-from>
+      <Hsp_hit-to>18</Hsp_hit-to>
+      <Hsp_query-frame>1</Hsp_query-frame>
+      <Hsp_hit-frame>1</Hsp_hit-frame>
+      <Hsp_identity>17</Hsp_identity>
+      <Hsp_positive>17</Hsp_positive>
+      <Hsp_gaps>0</Hsp_gaps>
+      <Hsp_align-len>17</Hsp_align-len>
+      <Hsp_qseq>GCGCGGTGTCATCTATG</Hsp_qseq>
+      <Hsp_hseq>GCGCGGTGTCATCTATG</Hsp_hseq>
+      <Hsp_midline>|||||||||||||||||</Hsp_midline>
+    </Hsp>
+  </Hit_hsps>
+</Hit>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>19</Iteration_iter-num>
+  <Iteration_query-ID>Query_3</Iteration_query-ID>
+  <Iteration_query-def>Probe|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+<Hit>
+  <Hit_num>1</Hit_num>
+  <Hit_id>Subject_3</Hit_id>
+  <Hit_def>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</Hit_def>
+  <Hit_accession>Subject_3</Hit_accession>
+  <Hit_len>323</Hit_len>
+  <Hit_hsps>
+    <Hsp>
+      <Hsp_num>1</Hsp_num>
+      <Hsp_bit-score>37.3537</Hsp_bit-score>
+      <Hsp_score>40</Hsp_score>
+      <Hsp_evalue>7.01052e-08</Hsp_evalue>
+      <Hsp_query-from>1</Hsp_query-from>
+      <Hsp_query-to>20</Hsp_query-to>
+      <Hsp_hit-from>224</Hsp_hit-from>
+      <Hsp_hit-to>243</Hsp_hit-to>
+      <Hsp_query-frame>1</Hsp_query-frame>
+      <Hsp_hit-frame>1</Hsp_hit-frame>
+      <Hsp_identity>20</Hsp_identity>
+      <Hsp_positive>20</Hsp_positive>
+      <Hsp_gaps>0</Hsp_gaps>
+      <Hsp_align-len>20</Hsp_align-len>
+      <Hsp_qseq>CGCGCGCGGTGTCATCTATG</Hsp_qseq>
+      <Hsp_hseq>CGCGCGCGGTGTCATCTATG</Hsp_hseq>
+      <Hsp_midline>||||||||||||||||||||</Hsp_midline>
+    </Hsp>
+  </Hit_hsps>
+</Hit>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>20</Iteration_iter-num>
+  <Iteration_query-ID>Query_3</Iteration_query-ID>
+  <Iteration_query-def>Probe|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>21</Iteration_iter-num>
+  <Iteration_query-ID>Query_3</Iteration_query-ID>
+  <Iteration_query-def>Probe|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>22</Iteration_iter-num>
+  <Iteration_query-ID>Query_3</Iteration_query-ID>
+  <Iteration_query-def>Probe|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+<Hit>
+  <Hit_num>1</Hit_num>
+  <Hit_id>Subject_6</Hit_id>
+  <Hit_def>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</Hit_def>
+  <Hit_accession>Subject_6</Hit_accession>
+  <Hit_len>2457</Hit_len>
+  <Hit_hsps>
+    <Hsp>
+      <Hsp_num>1</Hsp_num>
+      <Hsp_bit-score>37.3537</Hsp_bit-score>
+      <Hsp_score>40</Hsp_score>
+      <Hsp_evalue>7.01052e-08</Hsp_evalue>
+      <Hsp_query-from>1</Hsp_query-from>
+      <Hsp_query-to>20</Hsp_query-to>
+      <Hsp_hit-from>2143</Hsp_hit-from>
+      <Hsp_hit-to>2162</Hsp_hit-to>
+      <Hsp_query-frame>1</Hsp_query-frame>
+      <Hsp_hit-frame>1</Hsp_hit-frame>
+      <Hsp_identity>20</Hsp_identity>
+      <Hsp_positive>20</Hsp_positive>
+      <Hsp_gaps>0</Hsp_gaps>
+      <Hsp_align-len>20</Hsp_align-len>
+      <Hsp_qseq>CGCGCGCGGTGTCATCTATG</Hsp_qseq>
+      <Hsp_hseq>CGCGCGCGGTGTCATCTATG</Hsp_hseq>
+      <Hsp_midline>||||||||||||||||||||</Hsp_midline>
+    </Hsp>
+  </Hit_hsps>
+</Hit>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>23</Iteration_iter-num>
+  <Iteration_query-ID>Query_3</Iteration_query-ID>
+  <Iteration_query-def>Probe|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>24</Iteration_iter-num>
+  <Iteration_query-ID>Query_3</Iteration_query-ID>
+  <Iteration_query-def>Probe|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>25</Iteration_iter-num>
+  <Iteration_query-ID>Query_4</Iteration_query-ID>
+  <Iteration_query-def>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>24</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>9</Statistics_hsp-len>
+      <Statistics_eff-space>15375</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>26</Iteration_iter-num>
+  <Iteration_query-ID>Query_4</Iteration_query-ID>
+  <Iteration_query-def>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>24</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>9</Statistics_hsp-len>
+      <Statistics_eff-space>15375</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>27</Iteration_iter-num>
+  <Iteration_query-ID>Query_4</Iteration_query-ID>
+  <Iteration_query-def>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>24</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>9</Statistics_hsp-len>
+      <Statistics_eff-space>15375</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>28</Iteration_iter-num>
+  <Iteration_query-ID>Query_4</Iteration_query-ID>
+  <Iteration_query-def>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>24</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>9</Statistics_hsp-len>
+      <Statistics_eff-space>15375</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>29</Iteration_iter-num>
+  <Iteration_query-ID>Query_4</Iteration_query-ID>
+  <Iteration_query-def>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>24</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>9</Statistics_hsp-len>
+      <Statistics_eff-space>15375</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>30</Iteration_iter-num>
+  <Iteration_query-ID>Query_4</Iteration_query-ID>
+  <Iteration_query-def>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>24</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>9</Statistics_hsp-len>
+      <Statistics_eff-space>15375</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>31</Iteration_iter-num>
+  <Iteration_query-ID>Query_4</Iteration_query-ID>
+  <Iteration_query-def>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>24</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>9</Statistics_hsp-len>
+      <Statistics_eff-space>15375</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>32</Iteration_iter-num>
+  <Iteration_query-ID>Query_4</Iteration_query-ID>
+  <Iteration_query-def>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>24</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>9</Statistics_hsp-len>
+      <Statistics_eff-space>15375</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>33</Iteration_iter-num>
+  <Iteration_query-ID>Query_5</Iteration_query-ID>
+  <Iteration_query-def>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>34</Iteration_iter-num>
+  <Iteration_query-ID>Query_5</Iteration_query-ID>
+  <Iteration_query-def>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>35</Iteration_iter-num>
+  <Iteration_query-ID>Query_5</Iteration_query-ID>
+  <Iteration_query-def>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>36</Iteration_iter-num>
+  <Iteration_query-ID>Query_5</Iteration_query-ID>
+  <Iteration_query-def>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>37</Iteration_iter-num>
+  <Iteration_query-ID>Query_5</Iteration_query-ID>
+  <Iteration_query-def>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>38</Iteration_iter-num>
+  <Iteration_query-ID>Query_5</Iteration_query-ID>
+  <Iteration_query-def>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>39</Iteration_iter-num>
+  <Iteration_query-ID>Query_5</Iteration_query-ID>
+  <Iteration_query-def>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>40</Iteration_iter-num>
+  <Iteration_query-ID>Query_5</Iteration_query-ID>
+  <Iteration_query-def>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>12312</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>41</Iteration_iter-num>
+  <Iteration_query-ID>Query_6</Iteration_query-ID>
+  <Iteration_query-def>Probe|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>25</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>9</Statistics_hsp-len>
+      <Statistics_eff-space>16400</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>42</Iteration_iter-num>
+  <Iteration_query-ID>Query_6</Iteration_query-ID>
+  <Iteration_query-def>Probe|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>25</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>9</Statistics_hsp-len>
+      <Statistics_eff-space>16400</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>43</Iteration_iter-num>
+  <Iteration_query-ID>Query_6</Iteration_query-ID>
+  <Iteration_query-def>Probe|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>25</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>9</Statistics_hsp-len>
+      <Statistics_eff-space>16400</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>44</Iteration_iter-num>
+  <Iteration_query-ID>Query_6</Iteration_query-ID>
+  <Iteration_query-def>Probe|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>25</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>9</Statistics_hsp-len>
+      <Statistics_eff-space>16400</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>45</Iteration_iter-num>
+  <Iteration_query-ID>Query_6</Iteration_query-ID>
+  <Iteration_query-def>Probe|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>25</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>9</Statistics_hsp-len>
+      <Statistics_eff-space>16400</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>46</Iteration_iter-num>
+  <Iteration_query-ID>Query_6</Iteration_query-ID>
+  <Iteration_query-def>Probe|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>25</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>9</Statistics_hsp-len>
+      <Statistics_eff-space>16400</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>47</Iteration_iter-num>
+  <Iteration_query-ID>Query_6</Iteration_query-ID>
+  <Iteration_query-def>Probe|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>25</Iteration_query-len>
+<Iteration_hits>
+<Hit>
+  <Hit_num>1</Hit_num>
+  <Hit_id>Subject_7</Hit_id>
+  <Hit_def>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</Hit_def>
+  <Hit_accession>Subject_7</Hit_accession>
+  <Hit_len>4180</Hit_len>
+  <Hit_hsps>
+    <Hsp>
+      <Hsp_num>1</Hsp_num>
+      <Hsp_bit-score>37.3537</Hsp_bit-score>
+      <Hsp_score>40</Hsp_score>
+      <Hsp_evalue>9.33825e-08</Hsp_evalue>
+      <Hsp_query-from>1</Hsp_query-from>
+      <Hsp_query-to>25</Hsp_query-to>
+      <Hsp_hit-from>1541</Hsp_hit-from>
+      <Hsp_hit-to>1565</Hsp_hit-to>
+      <Hsp_query-frame>1</Hsp_query-frame>
+      <Hsp_hit-frame>1</Hsp_hit-frame>
+      <Hsp_identity>23</Hsp_identity>
+      <Hsp_positive>23</Hsp_positive>
+      <Hsp_gaps>0</Hsp_gaps>
+      <Hsp_align-len>25</Hsp_align-len>
+      <Hsp_qseq>ACATGAACAGCGCCTTGACCACAGC</Hsp_qseq>
+      <Hsp_hseq>ACATGAACAGCGCCCTGACCACCGC</Hsp_hseq>
+      <Hsp_midline>|||||||||||||| ||||||| ||</Hsp_midline>
+    </Hsp>
+  </Hit_hsps>
+</Hit>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>9</Statistics_hsp-len>
+      <Statistics_eff-space>16400</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>48</Iteration_iter-num>
+  <Iteration_query-ID>Query_6</Iteration_query-ID>
+  <Iteration_query-def>Probe|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>25</Iteration_query-len>
+<Iteration_hits>
+<Hit>
+  <Hit_num>1</Hit_num>
+  <Hit_id>Subject_8</Hit_id>
+  <Hit_def>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</Hit_def>
+  <Hit_accession>Subject_8</Hit_accession>
+  <Hit_len>4983</Hit_len>
+  <Hit_hsps>
+    <Hsp>
+      <Hsp_num>1</Hsp_num>
+      <Hsp_bit-score>37.3537</Hsp_bit-score>
+      <Hsp_score>40</Hsp_score>
+      <Hsp_evalue>9.33825e-08</Hsp_evalue>
+      <Hsp_query-from>1</Hsp_query-from>
+      <Hsp_query-to>25</Hsp_query-to>
+      <Hsp_hit-from>2344</Hsp_hit-from>
+      <Hsp_hit-to>2368</Hsp_hit-to>
+      <Hsp_query-frame>1</Hsp_query-frame>
+      <Hsp_hit-frame>1</Hsp_hit-frame>
+      <Hsp_identity>23</Hsp_identity>
+      <Hsp_positive>23</Hsp_positive>
+      <Hsp_gaps>0</Hsp_gaps>
+      <Hsp_align-len>25</Hsp_align-len>
+      <Hsp_qseq>ACATGAACAGCGCCTTGACCACAGC</Hsp_qseq>
+      <Hsp_hseq>ACATGAACAGCGCCCTGACCACCGC</Hsp_hseq>
+      <Hsp_midline>|||||||||||||| ||||||| ||</Hsp_midline>
+    </Hsp>
+  </Hit_hsps>
+</Hit>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>9</Statistics_hsp-len>
+      <Statistics_eff-space>16400</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>49</Iteration_iter-num>
+  <Iteration_query-ID>Query_7</Iteration_query-ID>
+  <Iteration_query-def>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>74</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>11</Statistics_hsp-len>
+      <Statistics_eff-space>64449</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>50</Iteration_iter-num>
+  <Iteration_query-ID>Query_7</Iteration_query-ID>
+  <Iteration_query-def>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>74</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>11</Statistics_hsp-len>
+      <Statistics_eff-space>64449</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>51</Iteration_iter-num>
+  <Iteration_query-ID>Query_7</Iteration_query-ID>
+  <Iteration_query-def>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>74</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>11</Statistics_hsp-len>
+      <Statistics_eff-space>64449</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>52</Iteration_iter-num>
+  <Iteration_query-ID>Query_7</Iteration_query-ID>
+  <Iteration_query-def>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>74</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>11</Statistics_hsp-len>
+      <Statistics_eff-space>64449</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>53</Iteration_iter-num>
+  <Iteration_query-ID>Query_7</Iteration_query-ID>
+  <Iteration_query-def>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>74</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>11</Statistics_hsp-len>
+      <Statistics_eff-space>64449</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>54</Iteration_iter-num>
+  <Iteration_query-ID>Query_7</Iteration_query-ID>
+  <Iteration_query-def>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>74</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>11</Statistics_hsp-len>
+      <Statistics_eff-space>64449</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>55</Iteration_iter-num>
+  <Iteration_query-ID>Query_7</Iteration_query-ID>
+  <Iteration_query-def>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>74</Iteration_query-len>
+<Iteration_hits>
+<Hit>
+  <Hit_num>1</Hit_num>
+  <Hit_id>Subject_7</Hit_id>
+  <Hit_def>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</Hit_def>
+  <Hit_accession>Subject_7</Hit_accession>
+  <Hit_len>4180</Hit_len>
+  <Hit_hsps>
+    <Hsp>
+      <Hsp_num>1</Hsp_num>
+      <Hsp_bit-score>89.6514</Hsp_bit-score>
+      <Hsp_score>98</Hsp_score>
+      <Hsp_evalue>6.62923e-23</Hsp_evalue>
+      <Hsp_query-from>1</Hsp_query-from>
+      <Hsp_query-to>74</Hsp_query-to>
+      <Hsp_hit-from>1516</Hsp_hit-from>
+      <Hsp_hit-to>1589</Hsp_hit-to>
+      <Hsp_query-frame>1</Hsp_query-frame>
+      <Hsp_hit-frame>1</Hsp_hit-frame>
+      <Hsp_identity>64</Hsp_identity>
+      <Hsp_positive>64</Hsp_positive>
+      <Hsp_gaps>0</Hsp_gaps>
+      <Hsp_align-len>74</Hsp_align-len>
+      <Hsp_qseq>GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTGTTCGCAGTCCAGAA</Hsp_qseq>
+      <Hsp_hseq>GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA</Hsp_hseq>
+      <Hsp_midline>||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | ||||| ||||||||</Hsp_midline>
+    </Hsp>
+  </Hit_hsps>
+</Hit>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>11</Statistics_hsp-len>
+      <Statistics_eff-space>64449</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>56</Iteration_iter-num>
+  <Iteration_query-ID>Query_7</Iteration_query-ID>
+  <Iteration_query-def>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>74</Iteration_query-len>
+<Iteration_hits>
+<Hit>
+  <Hit_num>1</Hit_num>
+  <Hit_id>Subject_8</Hit_id>
+  <Hit_def>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</Hit_def>
+  <Hit_accession>Subject_8</Hit_accession>
+  <Hit_len>4983</Hit_len>
+  <Hit_hsps>
+    <Hsp>
+      <Hsp_num>1</Hsp_num>
+      <Hsp_bit-score>89.6514</Hsp_bit-score>
+      <Hsp_score>98</Hsp_score>
+      <Hsp_evalue>6.62923e-23</Hsp_evalue>
+      <Hsp_query-from>1</Hsp_query-from>
+      <Hsp_query-to>74</Hsp_query-to>
+      <Hsp_hit-from>2319</Hsp_hit-from>
+      <Hsp_hit-to>2392</Hsp_hit-to>
+      <Hsp_query-frame>1</Hsp_query-frame>
+      <Hsp_hit-frame>1</Hsp_hit-frame>
+      <Hsp_identity>64</Hsp_identity>
+      <Hsp_positive>64</Hsp_positive>
+      <Hsp_gaps>0</Hsp_gaps>
+      <Hsp_align-len>74</Hsp_align-len>
+      <Hsp_qseq>GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTGTTCGCAGTCCAGAA</Hsp_qseq>
+      <Hsp_hseq>GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA</Hsp_hseq>
+      <Hsp_midline>||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | ||||| ||||||||</Hsp_midline>
+    </Hsp>
+  </Hit_hsps>
+</Hit>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>0</Statistics_db-num>
+      <Statistics_db-len>0</Statistics_db-len>
+      <Statistics_hsp-len>11</Statistics_hsp-len>
+      <Statistics_eff-space>64449</Statistics_eff-space>
+      <Statistics_kappa>0.41</Statistics_kappa>
+      <Statistics_lambda>0.625</Statistics_lambda>
+      <Statistics_entropy>0.78</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+</Iteration>
+</BlastOutput_iterations>
+</BlastOutput>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/blast xml example4.html	Thu May 15 17:22:02 2014 +0200
@@ -0,0 +1,1606 @@
+<!DOCTYPE html>
+<html>
+  <head>
+    <meta charset="UTF-8">
+    <meta name=generator content="blast2html; see ...">
+    
+    <title>Blast output</title>
+    
+    <style>
+      body {
+      color: #333333;
+      font-family: Arial,Sans-Serif;
+      }
+
+      :link {
+      color: #336699;
+      }
+
+      .right {
+      float: right;
+      }
+
+      /* Galaxy with html sanitization enabled strips the header of this html page. If so, show the user a warning.*/
+      #strip_html_warning {
+      display: none;
+      }
+      
+      #content {
+      margin: 0 2em;
+      padding: 0.5em;
+      border: 1px solid #888888;
+      background-color: #d3dff5;
+      }
+
+      h1, h2, h3, h4, h5, h6 {
+      color: #2A6979;
+      font-family: arial,verdana,sans-serif;
+      letter-spacing: -1px;
+      margin: 1.2em 0 0.3em;
+      }
+
+      h1 {
+      border-bottom: 1px solid #CCCCCC;
+      font-size: 150%;
+      padding-bottom: 0.1em;
+      }
+
+      h2 {
+      font-size: 120%;
+      font-weight: bold;
+      }
+
+      h4.darkHeader {
+      color: #4D4D4D;
+      letter-spacing: 0;
+      font-weight: bold;
+      }
+
+      #nodata {
+      font-weight: bold;
+      }
+
+      .index {
+      margin-bottom: 3em;
+      }
+      .index div.indexentry {
+      margin: 1.2em 1.6em;
+      font-weight: bold;
+      font-size: 100%;
+      }
+      
+      .headerdata {
+      font-size: 90%;
+      }
+      .headerdata .param {
+      font-weight: bold;
+      text-align: right;
+      padding: 0 1em;
+      }
+
+      .grey {
+      background-color: #eeeeee;
+      border: 1px solid #cccccc;
+      padding: 1em;
+      }
+
+      .white {
+      background-color: white;
+      border: 1px solid #cccccc;
+      padding: 1.5em 2%;
+      }
+
+      .graphicrow {
+      clear: left;
+      width: 100%;
+      }
+
+      .graphicitem {
+      float: left;
+      }
+
+
+      
+      .graphics .grey {
+      text-align: center;
+      }
+
+      .graphic {
+      background-color: white;
+      border: 2px solid black;
+      padding: 1.5em;
+      margin: auto;
+      }
+
+      .centered, .defline, div.legend, div.tablewrapper {
+      margin-left: auto;
+      margin-right: auto;
+      }
+
+      .defline {
+      background-color: white;
+      border: 1px solid black;
+      margin: .5em auto;
+      padding-left: .2em;
+      padding-right: .2em;
+      max-width: 50em;
+      text-align: left;
+      height: 2.8em;
+      overflow-y: hidden;
+      }
+
+      div.legend {
+      max-width: 40em;
+      }
+      div.legend div {
+      width: 100%;
+      color: white;
+      font-weight: bold;
+      border-spacing: 0;
+      }
+      div.legend div .graphicitem {
+      width: 20%;
+      padding: 0;
+      margin: 0;
+      border: none;
+      }
+
+      div.tablewrapper {
+      width: 50%;
+      min-width: 60em;
+      }
+
+      /* For small widths we give the graphic 100% */
+      @media (max-width: 72.5em) {
+      div.tablewrapper {
+      width: 100%;
+      min-width: 0px;
+      }
+      }
+
+      .scale {
+      width: 100%;
+      margin: .5em 0;
+      font-weight: bold;
+      }
+      .scale div {
+      color: red;
+      text-align: left;
+      }
+      .scale .graphicrow {
+      margin: .5em 0 .5em 0;
+      color: white;
+      }
+      .scale .graphicitem {
+      position: relative;
+      }
+      .scale .graphicitem div {
+      margin: 0 1px;
+      padding: 0 2px;
+      text-align: right;
+      background-color: red;
+      color: white;
+      }
+      .scale .graphicitem:first-child div {
+      margin-left: 0px;
+      }
+      .scale .graphicitem:last-child div {
+      margin-right: 0px;
+      }
+      .scale .graphicitem .lastlabel {
+      position: absolute;
+      top: 0px;
+      left: 100%;
+      background-color: transparent;
+      color: red;
+      }
+
+      a.matchresult {
+      display: block;
+      margin: 0;
+      padding: 0;
+      }
+      div.matchrow {
+      margin-top: 4px;
+      }
+      div.matchrow, div.matchitem {
+      height: 4px;
+      }
+
+      
+      table.descriptiontable {
+      font-size: 85%;
+      border: 1px solid #97b0c8;
+      border-spacing: 0;
+      color: #222222;
+      line-height: 1.3em;
+      background-color: white;
+      }
+      table.descriptiontable col:first-child {
+      width: 100%;
+      }
+      table.descriptiontable tr:hover {
+      background-color: #D5DEE3;
+      }
+      table.descriptiontable th {
+      color: #14376C;
+      font-weight: normal;
+      background-color: #F0F0F0;
+      background: linear-gradient(#FFFFFF, #F0F0F0);
+      border-bottom: 1px solid #D4DFE9;
+      border-right: 1px solid #CFCFCF;
+      border-left: 0px solid black;
+      border-top: 0px solid black;
+      }
+      table.descriptiontable td {
+      overflow: hidden;
+      text-align: center;
+      padding: .4em .8em;
+      }
+      table.descriptiontable td div {
+      width: 1em;
+      overflow: visible;
+      white-space: nowrap;
+      text-align: left;
+      }
+
+
+      
+      .alignments .white {
+      padding: 1.5em 1em;
+      }
+      
+      .alignment {
+      border-top: 1px solid black;
+      padding-left: 1em;
+      padding-right: 1em;
+      }
+      
+      div.linkheader {
+      padding-top: .2em;
+      font-size: 85%;
+      color: #14376C;
+      }
+      div.linkheader a.linkheader {
+      margin-right: 1em;
+      }
+      div.linkheader .right a {
+      text-decoration: none;
+      }
+
+      .title .hittitle {
+      color: #222222;
+      margin-bottom: .3em;
+      }
+      .title .titleinfo {
+      font-size: 80%;
+      margin-top: 0;
+      margin-bottom: .3em;
+      }
+      .title .titleinfo .b {
+      color: #606060;
+      font-weight: bold;
+      font-size: 90%;
+      }
+
+      .moretitles {
+      margin: 1.2em;
+      }
+      .moretitles .titleinfo {
+      margin: 0;
+      padding: 0;
+      }
+      .moretitles .hittitle {
+      margin: .4em 0 .2em 0;
+      padding: 0;
+      }
+      
+      a.showmoretitles {
+      font-size: 75%;
+      color: #336699;
+      font-weight: bold;
+      margin-top: 0;
+      }
+      a.showmoretitles:hover {
+      }
+
+      .hotspot {
+      color: #606060;
+      font-family: verdana, arial, sans-serif;
+      margin-bottom: 2.5em;
+      }
+
+      .hotspot p.range {
+      font-size: 70%;
+      margin-top: 0;
+      margin-top: 1em;
+      margin-bottom: .2em;
+      }
+      .hotspot p.range span.range {
+      font-weight: bold;
+      }
+      .hotspot p.range a.range {
+      margin-left: .5em;
+      }
+
+      table.hotspotstable {
+      border-top: 1px solid;
+      border-bottom: 1px solid;
+      text-align: left;
+      border-collapse: collapse;
+      }
+      table.hotspotstable th, table.hotspotstable td {
+      padding: .1em 1em;
+      }
+      table.hotspotstable th {
+      font-size: 70%;
+      }
+      table.hotspotstable td {
+      min-width: 7em;
+      color: #222222;
+      font-size: 80%;
+      }
+
+      pre.alignmentgraphic {
+      color: #222222;
+      }
+
+      footer {
+      text-align: center;
+      color: #cccccc;
+      font-size: 70%;
+      margin-top: 1em;
+      }
+      footer :link {
+      color: #5588cc;
+      }
+      
+    </style>
+
+    <script type="text/javascript">
+      function toggle_visibility(id) {
+          var e = document.getElementById(id);
+          if(e.style.display != 'block')
+              e.style.display = 'block';
+          else
+              e.style.display = 'none';
+      }
+    </script>
+
+  </head>
+
+  
+  <body>
+    
+    <div id="strip_html_warning">
+      <!-- This div should be hidden by the header css block. Galaxy
+      strips all css, breaking this page but making this warning
+      visible. This warning contains some ugly old skool tabular html
+      layout that is not stripped. -->
+      <table bgcolor="#FFE5C9"><tr><td><font color="red"><b>
+                <font size=5><center>This html page seems to have been stripped by Galaxy.</center></font>
+                Disable Galaxy's html sanitization feature to view the full page (see <font face=monospace>sanitize_all_html</font> in your galaxy's universe_wsgi.ini), or download this page instead of viewing it in Galaxy.
+      </b></font></td></tr></table>
+    </div>
+    
+    <div id=content>
+
+
+      <section class=index>
+        <h1>Queries</h1>
+
+        <div class=indexentry><a href="#match1">
+            Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 2 hits)
+        </a></div>
+        <div class=indexentry><a href="#match2">
+            Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match3">
+            Query_3: Probe|NOST-Spec_(Genetic_ID)
+            (20 letters, 3 hits)
+        </a></div>
+        <div class=indexentry><a href="#match4">
+            Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (24 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match5">
+            Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match6">
+            Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+            (25 letters, 2 hits)
+        </a></div>
+        <div class=indexentry><a href="#match7">
+            Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+            (74 letters, 2 hits)
+        </a></div>
+
+      </section>
+
+      
+      <section class=match id=match1>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h2>Graphic Summary</h2>
+
+          <div class=grey>
+            <h3 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h3>
+
+            <div class=defline id=defline1>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">200≤</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>2</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>4</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>6</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>8</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>10</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>12</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>14</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>16</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>18</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>20</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit1"
+                   onmouseover='document.getElementById("defline1").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit2"
+                   onmouseover='document.getElementById("defline1").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h2>Descriptions</h2>
+
+          <div class=grey><div class=white>
+              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit1"
+                              title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"
+                              id="description1">
+                        AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000
+                  </a></div></td>
+                  <td>40.1</td>
+                  <td>40.1</td>
+                  <td>100%</td>
+                  <td>1.513e-07</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">5</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit2"
+                              title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"
+                              id="description2">
+                        DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000
+                  </a></div></td>
+                  <td>40.1</td>
+                  <td>40.1</td>
+                  <td>100%</td>
+                  <td>1.513e-07</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">2</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h2>Alignments</h2>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description1">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">5</a>
+                    <span class=b>Length:</span> 2457
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2119 to 2138</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign&amp;from=2119&amp;to=2138">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign&amp;from=2119&amp;to=2138">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>40.1 bits(20)</td>
+                      <td>0.0</td>
+                      <td>20/20(100%)</td>
+                      <td>0/20(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  AGCGCGCAAACTAGGATAAA  20
+                ||||||||||||||||||||
+Subject   2119  AGCGCGCAAACTAGGATAAA  2138</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit2>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description2">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">2</a>
+                    <span class=b>Length:</span> 323
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 200 to 219</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign&amp;from=200&amp;to=219">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign&amp;from=200&amp;to=219">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>40.1 bits(20)</td>
+                      <td>0.0</td>
+                      <td>20/20(100%)</td>
+                      <td>0/20(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  AGCGCGCAAACTAGGATAAA  20
+                ||||||||||||||||||||
+Subject    200  AGCGCGCAAACTAGGATAAA  219</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+      
+      <section class=match id=match2>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match3>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h2>Graphic Summary</h2>
+
+          <div class=grey>
+            <h3 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h3>
+
+            <div class=defline id=defline3>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">200≤</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>2</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>4</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>6</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>8</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>10</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>12</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>14</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>16</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>18</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.0%">
+                        <div>20</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit1"
+                   onmouseover='document.getElementById("defline3").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"'
+                   onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit2"
+                   onmouseover='document.getElementById("defline3").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"'
+                   onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit3"
+                   onmouseover='document.getElementById("defline3").innerHTML="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3\u0027UTR/plant_junction_region.|-9105899556052450000"'
+                   onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3&#39;UTR/plant_junction_region.|-9105899556052450000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 15.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 85.0%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h2>Descriptions</h2>
+
+          <div class=grey><div class=white>
+              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit1"
+                              title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"
+                              id="description1">
+                        AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000
+                  </a></div></td>
+                  <td>40.1</td>
+                  <td>40.1</td>
+                  <td>100%</td>
+                  <td>1.513e-07</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">5</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit2"
+                              title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"
+                              id="description2">
+                        DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000
+                  </a></div></td>
+                  <td>40.1</td>
+                  <td>40.1</td>
+                  <td>100%</td>
+                  <td>1.513e-07</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">2</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit3"
+                              title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3&#39;UTR/plant_junction_region.|-9105899556052450000"
+                              id="description3">
+                        AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3&#39;UTR/plant_junction_region.|-9105899556052450000
+                  </a></div></td>
+                  <td>34.2</td>
+                  <td>34.2</td>
+                  <td>85%</td>
+                  <td>9.334e-06</td>
+                  <td>100%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">1</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h2>Alignments</h2>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description1">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">5</a>
+                    <span class=b>Length:</span> 2457
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2143 to 2162</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign&amp;from=2143&amp;to=2162">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign&amp;from=2143&amp;to=2162">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>40.1 bits(20)</td>
+                      <td>0.0</td>
+                      <td>20/20(100%)</td>
+                      <td>0/20(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGCGCGCGGTGTCATCTATG  20
+                ||||||||||||||||||||
+Subject   2143  CGCGCGCGGTGTCATCTATG  2162</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit2>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description2">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">2</a>
+                    <span class=b>Length:</span> 323
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 224 to 243</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign&amp;from=224&amp;to=243">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign&amp;from=224&amp;to=243">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>40.1 bits(20)</td>
+                      <td>0.0</td>
+                      <td>20/20(100%)</td>
+                      <td>0/20(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGCGCGCGGTGTCATCTATG  20
+                ||||||||||||||||||||
+Subject    224  CGCGCGCGGTGTCATCTATG  243</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit3>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description3">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3&#39;UTR/plant_junction_region.|-9105899556052450000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">1</a>
+                    <span class=b>Length:</span> 1045
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2 to 18</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign&amp;from=2&amp;to=18">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign&amp;from=2&amp;to=18">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>34.2 bits(17)</td>
+                      <td>0.0</td>
+                      <td>17/17(100%)</td>
+                      <td>0/17(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  GCGCGGTGTCATCTATG  20
+                |||||||||||||||||
+Subject      2  GCGCGGTGTCATCTATG  18</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+      
+      <section class=match id=match4>
+      
+        <h1>Nucleotide Sequence (24 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match5>
+      
+        <h1>Nucleotide Sequence (20 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h2>No Hits</h2>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match6>
+      
+        <h1>Nucleotide Sequence (25 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h2>Graphic Summary</h2>
+
+          <div class=grey>
+            <h3 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h3>
+
+            <div class=defline id=defline6>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">200≤</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 12.0%">
+                        <div>3</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.0%">
+                        <div>6</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.0%">
+                        <div>9</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.0%">
+                        <div>12</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.0%">
+                        <div>15</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.0%">
+                        <div>18</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.0%">
+                        <div>21</div>
+                      </div>
+                      <div class=graphicitem style="width: 12.0%">
+                        <div>24</div>
+                      </div>
+                      <div class=graphicitem style="width: 4.0%">
+                        <div>25</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit1"
+                   onmouseover='document.getElementById("defline6").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"'
+                   onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 88.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 12.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit2"
+                   onmouseover='document.getElementById("defline6").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"'
+                   onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 88.0%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 12.0%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h2>Descriptions</h2>
+
+          <div class=grey><div class=white>
+              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit1"
+                              title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"
+                              id="description1">
+                        EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000
+                  </a></div></td>
+                  <td>36.2</td>
+                  <td>36.2</td>
+                  <td>88%</td>
+                  <td>3.148e-06</td>
+                  <td>95%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">7</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit2"
+                              title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"
+                              id="description2">
+                        AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000
+                  </a></div></td>
+                  <td>36.2</td>
+                  <td>36.2</td>
+                  <td>88%</td>
+                  <td>3.148e-06</td>
+                  <td>95%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">6</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h2>Alignments</h2>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description1">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">7</a>
+                    <span class=b>Length:</span> 4983
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2344 to 2365</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign&amp;from=2344&amp;to=2365">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign&amp;from=2344&amp;to=2365">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>36.2 bits(18)</td>
+                      <td>0.0</td>
+                      <td>21/22(95%)</td>
+                      <td>0/22(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  ACATGAACAGCGCCTTGACCAC  22
+                |||||||||||||| |||||||
+Subject   2344  ACATGAACAGCGCCCTGACCAC  2365</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit2>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description2">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">6</a>
+                    <span class=b>Length:</span> 4180
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 1541 to 1562</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign&amp;from=1541&amp;to=1562">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign&amp;from=1541&amp;to=1562">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>36.2 bits(18)</td>
+                      <td>0.0</td>
+                      <td>21/22(95%)</td>
+                      <td>0/22(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  ACATGAACAGCGCCTTGACCAC  22
+                |||||||||||||| |||||||
+Subject   1541  ACATGAACAGCGCCCTGACCAC  1562</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+      
+      <section class=match id=match7>
+      
+        <h1>Nucleotide Sequence (74 letters)</h1>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Query length:</td><td>20</td></tr>
+            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+            <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h2>Graphic Summary</h2>
+
+          <div class=grey>
+            <h3 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h3>
+
+            <div class=defline id=defline7>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">200≤</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>8</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>16</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>24</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>32</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>40</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>48</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>56</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>64</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.81081081081081%">
+                        <div>72</div>
+                      </div>
+                      <div class=graphicitem style="width: 2.7027027027027026%">
+                        <div>&nbsp;</div>
+                        <div class=lastlabel>74</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit1"
+                   onmouseover='document.getElementById("defline7").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"'
+                   onmouseout='document.getElementById("defline7").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: green; width: 100.0%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit2"
+                   onmouseover='document.getElementById("defline7").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"'
+                   onmouseout='document.getElementById("defline7").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: green; width: 100.0%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h2>Descriptions</h2>
+
+          <div class=grey><div class=white>
+              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit1"
+                              title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"
+                              id="description1">
+                        EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000
+                  </a></div></td>
+                  <td>67.9</td>
+                  <td>67.9</td>
+                  <td>100%</td>
+                  <td>3.564e-15</td>
+                  <td>86%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">7</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit2"
+                              title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"
+                              id="description2">
+                        AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000
+                  </a></div></td>
+                  <td>67.9</td>
+                  <td>67.9</td>
+                  <td>100%</td>
+                  <td>3.564e-15</td>
+                  <td>86%</td>
+                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">6</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h2>Alignments</h2>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description1">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">7</a>
+                    <span class=b>Length:</span> 4983
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 2319 to 2392</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign&amp;from=2319&amp;to=2392">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign&amp;from=2319&amp;to=2392">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>67.9 bits(34)</td>
+                      <td>0.0</td>
+                      <td>64/74(86%)</td>
+                      <td>0/74(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTGTTCGCAGTCCAGAA  74
+                ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | ||||| ||||||||
+Subject   2319  GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA  2392</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit2>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description2">Descriptions</a></div>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">GenBank</a>
+                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign">Graphics</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">6</a>
+                    <span class=b>Length:</span> 4180
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot>
+                  <p class=range>
+                    <span class=range>Range 1: 1516 to 1589</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign&amp;from=1516&amp;to=1589">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign&amp;from=1516&amp;to=1589">Graphics</a>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>67.9 bits(34)</td>
+                      <td>0.0</td>
+                      <td>64/74(86%)</td>
+                      <td>0/74(0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTGTTCGCAGTCCAGAA  74
+                ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | ||||| ||||||||
+Subject   1516  GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA  1589</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+
+    </div>
+
+    <footer>
+      This page was generated by <a href="...">blast2html</a>.
+    </footer>
+  </body>
+</html>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/blast xml example4.xml	Thu May 15 17:22:02 2014 +0200
@@ -0,0 +1,412 @@
+<?xml version="1.0"?>
+<!DOCTYPE BlastOutput PUBLIC "-//NCBI//NCBI BlastOutput/EN" "http://www.ncbi.nlm.nih.gov/dtd/NCBI_BlastOutput.dtd">
+<BlastOutput>
+  <BlastOutput_program>blastn</BlastOutput_program>
+  <BlastOutput_version>BLASTN 2.2.29+</BlastOutput_version>
+  <BlastOutput_reference>Stephen F. Altschul, Thomas L. Madden, Alejandro A. Sch&amp;auml;ffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), &quot;Gapped BLAST and PSI-BLAST: a new generation of protein database search programs&quot;, Nucleic Acids Res. 25:3389-3402.</BlastOutput_reference>
+  <BlastOutput_db>/opt/galaxy/blastdbs/EUginius_plasmid_insert</BlastOutput_db>
+  <BlastOutput_query-ID>Query_1</BlastOutput_query-ID>
+  <BlastOutput_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</BlastOutput_query-def>
+  <BlastOutput_query-len>20</BlastOutput_query-len>
+  <BlastOutput_param>
+    <Parameters>
+      <Parameters_expect>0.001</Parameters_expect>
+      <Parameters_sc-match>1</Parameters_sc-match>
+      <Parameters_sc-mismatch>-3</Parameters_sc-mismatch>
+      <Parameters_gap-open>5</Parameters_gap-open>
+      <Parameters_gap-extend>2</Parameters_gap-extend>
+      <Parameters_filter>L;m;</Parameters_filter>
+    </Parameters>
+  </BlastOutput_param>
+<BlastOutput_iterations>
+<Iteration>
+  <Iteration_iter-num>1</Iteration_iter-num>
+  <Iteration_query-ID>Query_1</Iteration_query-ID>
+  <Iteration_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+<Hit>
+  <Hit_num>1</Hit_num>
+  <Hit_id>gnl|BL_ORD_ID|5</Hit_id>
+  <Hit_def>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</Hit_def>
+  <Hit_accession>5</Hit_accession>
+  <Hit_len>2457</Hit_len>
+  <Hit_hsps>
+    <Hsp>
+      <Hsp_num>1</Hsp_num>
+      <Hsp_bit-score>40.14</Hsp_bit-score>
+      <Hsp_score>20</Hsp_score>
+      <Hsp_evalue>1.51296e-07</Hsp_evalue>
+      <Hsp_query-from>1</Hsp_query-from>
+      <Hsp_query-to>20</Hsp_query-to>
+      <Hsp_hit-from>2119</Hsp_hit-from>
+      <Hsp_hit-to>2138</Hsp_hit-to>
+      <Hsp_query-frame>1</Hsp_query-frame>
+      <Hsp_hit-frame>1</Hsp_hit-frame>
+      <Hsp_identity>20</Hsp_identity>
+      <Hsp_positive>20</Hsp_positive>
+      <Hsp_gaps>0</Hsp_gaps>
+      <Hsp_align-len>20</Hsp_align-len>
+      <Hsp_qseq>AGCGCGCAAACTAGGATAAA</Hsp_qseq>
+      <Hsp_hseq>AGCGCGCAAACTAGGATAAA</Hsp_hseq>
+      <Hsp_midline>||||||||||||||||||||</Hsp_midline>
+    </Hsp>
+  </Hit_hsps>
+</Hit>
+<Hit>
+  <Hit_num>2</Hit_num>
+  <Hit_id>gnl|BL_ORD_ID|2</Hit_id>
+  <Hit_def>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</Hit_def>
+  <Hit_accession>2</Hit_accession>
+  <Hit_len>323</Hit_len>
+  <Hit_hsps>
+    <Hsp>
+      <Hsp_num>1</Hsp_num>
+      <Hsp_bit-score>40.14</Hsp_bit-score>
+      <Hsp_score>20</Hsp_score>
+      <Hsp_evalue>1.51296e-07</Hsp_evalue>
+      <Hsp_query-from>1</Hsp_query-from>
+      <Hsp_query-to>20</Hsp_query-to>
+      <Hsp_hit-from>200</Hsp_hit-from>
+      <Hsp_hit-to>219</Hsp_hit-to>
+      <Hsp_query-frame>1</Hsp_query-frame>
+      <Hsp_hit-frame>1</Hsp_hit-frame>
+      <Hsp_identity>20</Hsp_identity>
+      <Hsp_positive>20</Hsp_positive>
+      <Hsp_gaps>0</Hsp_gaps>
+      <Hsp_align-len>20</Hsp_align-len>
+      <Hsp_qseq>AGCGCGCAAACTAGGATAAA</Hsp_qseq>
+      <Hsp_hseq>AGCGCGCAAACTAGGATAAA</Hsp_hseq>
+      <Hsp_midline>||||||||||||||||||||</Hsp_midline>
+    </Hsp>
+  </Hit_hsps>
+</Hit>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>8</Statistics_db-num>
+      <Statistics_db-len>15339</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>183300</Statistics_eff-space>
+      <Statistics_kappa>0.710602795216363</Statistics_kappa>
+      <Statistics_lambda>1.37406312246009</Statistics_lambda>
+      <Statistics_entropy>1.30724660390929</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>2</Iteration_iter-num>
+  <Iteration_query-ID>Query_2</Iteration_query-ID>
+  <Iteration_query-def>Reverse_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>8</Statistics_db-num>
+      <Statistics_db-len>15339</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>183300</Statistics_eff-space>
+      <Statistics_kappa>0.710602795216363</Statistics_kappa>
+      <Statistics_lambda>1.37406312246009</Statistics_lambda>
+      <Statistics_entropy>1.30724660390929</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>3</Iteration_iter-num>
+  <Iteration_query-ID>Query_3</Iteration_query-ID>
+  <Iteration_query-def>Probe|NOST-Spec_(Genetic_ID)</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+<Hit>
+  <Hit_num>1</Hit_num>
+  <Hit_id>gnl|BL_ORD_ID|5</Hit_id>
+  <Hit_def>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</Hit_def>
+  <Hit_accession>5</Hit_accession>
+  <Hit_len>2457</Hit_len>
+  <Hit_hsps>
+    <Hsp>
+      <Hsp_num>1</Hsp_num>
+      <Hsp_bit-score>40.14</Hsp_bit-score>
+      <Hsp_score>20</Hsp_score>
+      <Hsp_evalue>1.51296e-07</Hsp_evalue>
+      <Hsp_query-from>1</Hsp_query-from>
+      <Hsp_query-to>20</Hsp_query-to>
+      <Hsp_hit-from>2143</Hsp_hit-from>
+      <Hsp_hit-to>2162</Hsp_hit-to>
+      <Hsp_query-frame>1</Hsp_query-frame>
+      <Hsp_hit-frame>1</Hsp_hit-frame>
+      <Hsp_identity>20</Hsp_identity>
+      <Hsp_positive>20</Hsp_positive>
+      <Hsp_gaps>0</Hsp_gaps>
+      <Hsp_align-len>20</Hsp_align-len>
+      <Hsp_qseq>CGCGCGCGGTGTCATCTATG</Hsp_qseq>
+      <Hsp_hseq>CGCGCGCGGTGTCATCTATG</Hsp_hseq>
+      <Hsp_midline>||||||||||||||||||||</Hsp_midline>
+    </Hsp>
+  </Hit_hsps>
+</Hit>
+<Hit>
+  <Hit_num>2</Hit_num>
+  <Hit_id>gnl|BL_ORD_ID|2</Hit_id>
+  <Hit_def>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</Hit_def>
+  <Hit_accession>2</Hit_accession>
+  <Hit_len>323</Hit_len>
+  <Hit_hsps>
+    <Hsp>
+      <Hsp_num>1</Hsp_num>
+      <Hsp_bit-score>40.14</Hsp_bit-score>
+      <Hsp_score>20</Hsp_score>
+      <Hsp_evalue>1.51296e-07</Hsp_evalue>
+      <Hsp_query-from>1</Hsp_query-from>
+      <Hsp_query-to>20</Hsp_query-to>
+      <Hsp_hit-from>224</Hsp_hit-from>
+      <Hsp_hit-to>243</Hsp_hit-to>
+      <Hsp_query-frame>1</Hsp_query-frame>
+      <Hsp_hit-frame>1</Hsp_hit-frame>
+      <Hsp_identity>20</Hsp_identity>
+      <Hsp_positive>20</Hsp_positive>
+      <Hsp_gaps>0</Hsp_gaps>
+      <Hsp_align-len>20</Hsp_align-len>
+      <Hsp_qseq>CGCGCGCGGTGTCATCTATG</Hsp_qseq>
+      <Hsp_hseq>CGCGCGCGGTGTCATCTATG</Hsp_hseq>
+      <Hsp_midline>||||||||||||||||||||</Hsp_midline>
+    </Hsp>
+  </Hit_hsps>
+</Hit>
+<Hit>
+  <Hit_num>3</Hit_num>
+  <Hit_id>gnl|BL_ORD_ID|1</Hit_id>
+  <Hit_def>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3&apos;UTR/plant_junction_region.|-9105899556052450000</Hit_def>
+  <Hit_accession>1</Hit_accession>
+  <Hit_len>1045</Hit_len>
+  <Hit_hsps>
+    <Hsp>
+      <Hsp_num>1</Hsp_num>
+      <Hsp_bit-score>34.1929</Hsp_bit-score>
+      <Hsp_score>17</Hsp_score>
+      <Hsp_evalue>9.33411e-06</Hsp_evalue>
+      <Hsp_query-from>4</Hsp_query-from>
+      <Hsp_query-to>20</Hsp_query-to>
+      <Hsp_hit-from>2</Hsp_hit-from>
+      <Hsp_hit-to>18</Hsp_hit-to>
+      <Hsp_query-frame>1</Hsp_query-frame>
+      <Hsp_hit-frame>1</Hsp_hit-frame>
+      <Hsp_identity>17</Hsp_identity>
+      <Hsp_positive>17</Hsp_positive>
+      <Hsp_gaps>0</Hsp_gaps>
+      <Hsp_align-len>17</Hsp_align-len>
+      <Hsp_qseq>GCGCGGTGTCATCTATG</Hsp_qseq>
+      <Hsp_hseq>GCGCGGTGTCATCTATG</Hsp_hseq>
+      <Hsp_midline>|||||||||||||||||</Hsp_midline>
+    </Hsp>
+  </Hit_hsps>
+</Hit>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>8</Statistics_db-num>
+      <Statistics_db-len>15339</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>183300</Statistics_eff-space>
+      <Statistics_kappa>0.710602795216363</Statistics_kappa>
+      <Statistics_lambda>1.37406312246009</Statistics_lambda>
+      <Statistics_entropy>1.30724660390929</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>4</Iteration_iter-num>
+  <Iteration_query-ID>Query_4</Iteration_query-ID>
+  <Iteration_query-def>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>24</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>8</Statistics_db-num>
+      <Statistics_db-len>15339</Statistics_db-len>
+      <Statistics_hsp-len>9</Statistics_hsp-len>
+      <Statistics_eff-space>229005</Statistics_eff-space>
+      <Statistics_kappa>0.710602795216363</Statistics_kappa>
+      <Statistics_lambda>1.37406312246009</Statistics_lambda>
+      <Statistics_entropy>1.30724660390929</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>5</Iteration_iter-num>
+  <Iteration_query-ID>Query_5</Iteration_query-ID>
+  <Iteration_query-def>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>20</Iteration_query-len>
+<Iteration_hits>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>8</Statistics_db-num>
+      <Statistics_db-len>15339</Statistics_db-len>
+      <Statistics_hsp-len>8</Statistics_hsp-len>
+      <Statistics_eff-space>183300</Statistics_eff-space>
+      <Statistics_kappa>0.710602795216363</Statistics_kappa>
+      <Statistics_lambda>1.37406312246009</Statistics_lambda>
+      <Statistics_entropy>1.30724660390929</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+  <Iteration_message>No hits found</Iteration_message>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>6</Iteration_iter-num>
+  <Iteration_query-ID>Query_6</Iteration_query-ID>
+  <Iteration_query-def>Probe|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>25</Iteration_query-len>
+<Iteration_hits>
+<Hit>
+  <Hit_num>1</Hit_num>
+  <Hit_id>gnl|BL_ORD_ID|7</Hit_id>
+  <Hit_def>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</Hit_def>
+  <Hit_accession>7</Hit_accession>
+  <Hit_len>4983</Hit_len>
+  <Hit_hsps>
+    <Hsp>
+      <Hsp_num>1</Hsp_num>
+      <Hsp_bit-score>36.1753</Hsp_bit-score>
+      <Hsp_score>18</Hsp_score>
+      <Hsp_evalue>3.14801e-06</Hsp_evalue>
+      <Hsp_query-from>1</Hsp_query-from>
+      <Hsp_query-to>22</Hsp_query-to>
+      <Hsp_hit-from>2344</Hsp_hit-from>
+      <Hsp_hit-to>2365</Hsp_hit-to>
+      <Hsp_query-frame>1</Hsp_query-frame>
+      <Hsp_hit-frame>1</Hsp_hit-frame>
+      <Hsp_identity>21</Hsp_identity>
+      <Hsp_positive>21</Hsp_positive>
+      <Hsp_gaps>0</Hsp_gaps>
+      <Hsp_align-len>22</Hsp_align-len>
+      <Hsp_qseq>ACATGAACAGCGCCTTGACCAC</Hsp_qseq>
+      <Hsp_hseq>ACATGAACAGCGCCCTGACCAC</Hsp_hseq>
+      <Hsp_midline>|||||||||||||| |||||||</Hsp_midline>
+    </Hsp>
+  </Hit_hsps>
+</Hit>
+<Hit>
+  <Hit_num>2</Hit_num>
+  <Hit_id>gnl|BL_ORD_ID|6</Hit_id>
+  <Hit_def>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</Hit_def>
+  <Hit_accession>6</Hit_accession>
+  <Hit_len>4180</Hit_len>
+  <Hit_hsps>
+    <Hsp>
+      <Hsp_num>1</Hsp_num>
+      <Hsp_bit-score>36.1753</Hsp_bit-score>
+      <Hsp_score>18</Hsp_score>
+      <Hsp_evalue>3.14801e-06</Hsp_evalue>
+      <Hsp_query-from>1</Hsp_query-from>
+      <Hsp_query-to>22</Hsp_query-to>
+      <Hsp_hit-from>1541</Hsp_hit-from>
+      <Hsp_hit-to>1562</Hsp_hit-to>
+      <Hsp_query-frame>1</Hsp_query-frame>
+      <Hsp_hit-frame>1</Hsp_hit-frame>
+      <Hsp_identity>21</Hsp_identity>
+      <Hsp_positive>21</Hsp_positive>
+      <Hsp_gaps>0</Hsp_gaps>
+      <Hsp_align-len>22</Hsp_align-len>
+      <Hsp_qseq>ACATGAACAGCGCCTTGACCAC</Hsp_qseq>
+      <Hsp_hseq>ACATGAACAGCGCCCTGACCAC</Hsp_hseq>
+      <Hsp_midline>|||||||||||||| |||||||</Hsp_midline>
+    </Hsp>
+  </Hit_hsps>
+</Hit>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>8</Statistics_db-num>
+      <Statistics_db-len>15339</Statistics_db-len>
+      <Statistics_hsp-len>9</Statistics_hsp-len>
+      <Statistics_eff-space>244272</Statistics_eff-space>
+      <Statistics_kappa>0.710602795216363</Statistics_kappa>
+      <Statistics_lambda>1.37406312246009</Statistics_lambda>
+      <Statistics_entropy>1.30724660390929</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+</Iteration>
+<Iteration>
+  <Iteration_iter-num>7</Iteration_iter-num>
+  <Iteration_query-ID>Query_7</Iteration_query-ID>
+  <Iteration_query-def>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
+  <Iteration_query-len>74</Iteration_query-len>
+<Iteration_hits>
+<Hit>
+  <Hit_num>1</Hit_num>
+  <Hit_id>gnl|BL_ORD_ID|7</Hit_id>
+  <Hit_def>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</Hit_def>
+  <Hit_accession>7</Hit_accession>
+  <Hit_len>4983</Hit_len>
+  <Hit_hsps>
+    <Hsp>
+      <Hsp_num>1</Hsp_num>
+      <Hsp_bit-score>67.8929</Hsp_bit-score>
+      <Hsp_score>34</Hsp_score>
+      <Hsp_evalue>3.56369e-15</Hsp_evalue>
+      <Hsp_query-from>1</Hsp_query-from>
+      <Hsp_query-to>74</Hsp_query-to>
+      <Hsp_hit-from>2319</Hsp_hit-from>
+      <Hsp_hit-to>2392</Hsp_hit-to>
+      <Hsp_query-frame>1</Hsp_query-frame>
+      <Hsp_hit-frame>1</Hsp_hit-frame>
+      <Hsp_identity>64</Hsp_identity>
+      <Hsp_positive>64</Hsp_positive>
+      <Hsp_gaps>0</Hsp_gaps>
+      <Hsp_align-len>74</Hsp_align-len>
+      <Hsp_qseq>GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTGTTCGCAGTCCAGAA</Hsp_qseq>
+      <Hsp_hseq>GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA</Hsp_hseq>
+      <Hsp_midline>||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | ||||| ||||||||</Hsp_midline>
+    </Hsp>
+  </Hit_hsps>
+</Hit>
+<Hit>
+  <Hit_num>2</Hit_num>
+  <Hit_id>gnl|BL_ORD_ID|6</Hit_id>
+  <Hit_def>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</Hit_def>
+  <Hit_accession>6</Hit_accession>
+  <Hit_len>4180</Hit_len>
+  <Hit_hsps>
+    <Hsp>
+      <Hsp_num>1</Hsp_num>
+      <Hsp_bit-score>67.8929</Hsp_bit-score>
+      <Hsp_score>34</Hsp_score>
+      <Hsp_evalue>3.56369e-15</Hsp_evalue>
+      <Hsp_query-from>1</Hsp_query-from>
+      <Hsp_query-to>74</Hsp_query-to>
+      <Hsp_hit-from>1516</Hsp_hit-from>
+      <Hsp_hit-to>1589</Hsp_hit-to>
+      <Hsp_query-frame>1</Hsp_query-frame>
+      <Hsp_hit-frame>1</Hsp_hit-frame>
+      <Hsp_identity>64</Hsp_identity>
+      <Hsp_positive>64</Hsp_positive>
+      <Hsp_gaps>0</Hsp_gaps>
+      <Hsp_align-len>74</Hsp_align-len>
+      <Hsp_qseq>GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTGTTCGCAGTCCAGAA</Hsp_qseq>
+      <Hsp_hseq>GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA</Hsp_hseq>
+      <Hsp_midline>||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | ||||| ||||||||</Hsp_midline>
+    </Hsp>
+  </Hit_hsps>
+</Hit>
+</Iteration_hits>
+  <Iteration_stat>
+    <Statistics>
+      <Statistics_db-num>8</Statistics_db-num>
+      <Statistics_db-len>15339</Statistics_db-len>
+      <Statistics_hsp-len>10</Statistics_hsp-len>
+      <Statistics_eff-space>976576</Statistics_eff-space>
+      <Statistics_kappa>0.710602795216363</Statistics_kappa>
+      <Statistics_lambda>1.37406312246009</Statistics_lambda>
+      <Statistics_entropy>1.30724660390929</Statistics_entropy>
+    </Statistics>
+  </Iteration_stat>
+</Iteration>
+</BlastOutput_iterations>
+</BlastOutput>
+
--- a/tool_dependencies.xml	Thu May 15 16:59:18 2014 +0200
+++ b/tool_dependencies.xml	Thu May 15 17:22:02 2014 +0200
@@ -19,12 +19,20 @@
     
     <tests>
         <test>
-            <param name="input" value="blast-view_test1_in.xml"/>
-            <output name="out_file1" file="blast-view_test1_out.html"/>
+            <param name="input" value="blast xml example1.xml"/>
+            <output name="out_file1" file="blast xml example1.html"/>
         </test>
         <test>
-            <param name="input" value="blast-view_test2_in.xml"/>
-            <output name="out_file1" file="blast-view_test2_out.html"/>
+            <param name="input" value="blast xml example2.xml"/>
+            <output name="out_file1" file="blast xml example2.html"/>
+        </test>
+        <test>
+            <param name="input" value="blast xml example3.xml"/>
+            <output name="out_file1" file="blast xml example3.html"/>
+        </test>
+        <test>
+            <param name="input" value="blast xml example4.xml"/>
+            <output name="out_file1" file="blast xml example4.html"/>
         </test>
     </tests>