<tool id="fastq_mcf" name="FastqMcf" version="1.0">
  <description>sequence quality filtering and clipping</description>
  <requirements>
    <requirement type="package" version="1.1.2-484">ea-utils</requirement>
  </requirements>
  <version_string>fastq-mcf -V</version_string>
  <command>fastq-mcf 
    #if $trimming.choice == 'disable':
      -0
    #elif $trimming.choice == 'user_set':
      #if len($trimming.scale.__str__) > 0
        -s $trimming.scale
      #end if
      #if len($trimming.minpct.__str__) > 0
        -t $trimming.minpct
      #end if
      #if len($trimming.nmin.__str__) > 0
        -m $trimming.nmin
      #end if
      #if len($trimming.pctdiff.__str__) > 0
        -p $trimming.pctdiff
      #end if
      #if len($trimming.nmax.__str__) > 0
        -L $trimming.nmax
      #end if
      #if len($trimming.nkeep.__str__) > 0
        -l $trimming.nkeep
      #end if
      #if len($trimming.skewpct.__str__) > 0
        -k $trimming.skewpct
      #end if
      #if len($trimming.qthr.__str__) > 0
        -q $trimming.qthr
      #end if
      #if len($trimming.qwin.__str__) > 0
        -w $trimming.qwin
      #end if
      #if len($trimming.pctns.__str__) > 0
        -x $trimming.pctns
      #end if
      #if len($trimming.sampcnt.__str__) > 0
        -s $trimming.sampcnt
      #end if
      #if len($trimming.ilv3.__str__.strip()) > 0
        -$trimming.ilv3
      #end if
      $trimming.rmns
    #end if
    #if $noclip == True :
      $noclip
    #else :
      -o $reads_out
      #if $mates.__str__ != 'None' :
        -o $mates_out
      #end if
    #end if
    $adpaters 
    $reads
    #if $mates.__str__ != 'None' :
      $mates
    #end if
    > $log
  </command>
  <inputs>
    <param name="adpaters" type="data" format="fasta" label="A fasta formatted adapter list" />
    <param name="reads" type="data" format="fastqsanger,fastqillumina" label="Reads: single or Left-hand of Paired End Reads" />
    <param name="mates" type="data" format="fastqsanger,fastqillumina" optional="true" label="Right-hand mates for Paired End Reads" />
    <!--
 -s N.N Log scale for clip pct to threshold (2.5)
 -t N % occurance threshold before clipping (0.25)
 -m N Minimum clip length, overrides scaled auto (1)
 -p N Maximum adapter difference percentage (20)
 -l N Minimum remaining sequence length (15)
 -L N   Maximum sequence length (none)
 -k N sKew percentage causing trimming (2)
 -q N quality threshold causing trimming (10)
 -f force output, even if not much will be done
 -0     Set all trimming parameters to zero
 -U|u   Force disable/enable illumina PF filtering
 -P N phred-scale (64)
 -x N 'N' (Bad read) percentage causing trimming (10)
 -R      Don't remove N's from the fronts/ends of reads
 -n Don't clip, just output what would be done
 -C N   Number of reads to use for subsampling (200000)
 -d     Output lots of random debugging stuff
    -->


    <conditional name="trimming">
        <param name="choice" type="select" label="Trimming Options">
           <option value="defaults">Use Defaults</option>
           <option value="user_set">Set Values</option>
           <option value="disable">Set all trimming parameters to zero</option>
        </param>
      <when value="defaults"/>
      <when value="disable"/>
      <when value="user_set">
        <param name="sampcnt" type="integer" optional="true" label="-C Number of reads to use for subsampling (100000)"> 
        </param>
        <param name="scale" type="float" optional="true" label="-s N.N Log scale for clip pct to threshold (2.5)"> 
        </param>
        <param name="minpct" type="float" optional="true" label="-t % occurance threshold before clipping (0.25)"> 
        </param>
        <param name="nmin" type="integer" optional="true" label="-m Minimum clip length, overrides scaled auto (1)"> 
        </param>
        <param name="pctdiff" type="integer" optional="true" label="-p Maximum adapter difference percentage (20)"> 
        </param>

        <param name="nmax" type="integer" optional="true" label="-L Maximum sequence length (none)"> 
        </param>
        <param name="nkeep" type="integer" optional="true" label="-l  Minimum remaining sequence length (15)"> 
        </param>
        <param name="skewpct" type="float" optional="true" label="-k sKew percentage causing trimming (2)"> 
        </param>
        <param name="qthr" type="integer" optional="true" label="-q quality threshold causing trimming (7)" 
               help="remove end of-read with quality &lt; threshold"> 
        </param>
        <param name="qwin" type="integer" optional="true" label="-w mean quality threshold causing trimming (1)" 
               help="remove end of read with mean quality &lt; threshold"> 
        </param>
        <param name="pctns" type="float" optional="true" label="-x  'N' (Bad read) percentage causing trimming (10)"> 
        </param>
        <param name="rmns" type="boolean" truevalue="-R" falsevalue="" checked="false" label="-R Don't remove N's from the fronts/ends of reads"/>
        <param name="ilv3" type="select" label="illumina PF filtering">
           <option value="">Default</option>
           <option value="U">Disable illumina PF filtering</option>
           <option value="u">Enable illumina PF filtering</option>
        </param>
      </when>
    </conditional>

    
    <param name="phred" type="integer" optional="true" label="-P phred-scale (64)" help="Default is to determine automatically"> 
    </param>

    <param name="noclip" type="boolean" truevalue="-n" falsevalue="" checked="false" label="-n Don't clip, just output what would be done"/>

  </inputs>
  <outputs>
    <data name="log"   format="txt" label="${tool.name} on ${on_string}: log"/>
    <data name="reads_out"   format_source="reads" label="${tool.name} on ${on_string}: reads">
      <filter>noclip == False</filter>
    </data>
    <data name="mates_out" format_source="mates" label="${tool.name} on ${on_string}: mates">
      <filter>(noclip == False and mates != None)</filter>
    </data>
  </outputs>
  <stdio>
    <exit_code range="1:"  level="fatal"   description="Error" />
  </stdio>
  <tests>
    <test>
      <param name="adpaters" ftype="fasta" value="adapters.fa" />
      <param name="reads" ftype="fastqillumina" value="test_mcf_reads.fq" />
      <param name="mates" ftype="fastqillumina" value="test_mcf_mates.fq" />
      <param name="choice" value="user_set" />
      <param name="nkeep" value="16" />
      <param name="qthr" value="15" />
      <param name="qwin" value="5" />
      <param name="pctns" value="10" />
      <param name="ilv3" value="u" />
      <param name="phred" value="33" />
      <output name="reads_out" file="testout_mcf_reads.fq" />
      <output name="mates_out" file="testout_mcf_mates.fq" />
    </test>
  </tests>
  <help>
**What it does**

fastq-mcf_ attempts to:

  Detect and remove sequencing adapters and primers
  Detect limited skewing at the ends of reads and clip
  Detect poor quality at the ends of reads and clip
  Detect N's, and remove from ends
  Remove reads with CASAVA 'Y' flag (purity filtering)
  Discard sequences that are too short after all of the above


  Keep multiple mate-reads in sync while doing all of the above

.. _fastq-mcf: http://code.google.com/p/ea-utils/wiki/FastqMcf
-----

**Input**

Fasta file of adapter sequences, for example::

    > Genomic_DNA_oligonucleotide_sequences_Adapters_F
    GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
    > Genomic_DNA_oligonucleotide_sequences_Adapters_R
    ACACTCTTTCCCTACACGACGCTCTTCCGATCT
    > Genomic_DNA_Sequencing_Primer
    ACACTCTTTCCCTACACGACGCTCTTCCGATCT



Reads or Left-hand mates, for example::

    @1539:931/1
    ACTTCCCGCGCGTGAAGGCGCCGGCAAACGAGGCTCGGGAAGGGGCTCCCG
    +1539:931/1
    BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

Right-hand mates, for example::

    @1539:931/2
    CGCCATTCCGAATCGTAGTTGTCGGCGTCTTCCAGTGCGGCAAGGCATCGT
    +1539:931/2
    WNUUZ\P^`BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

-----

**Output**

A log file

A trimmed fastq of the reads

A trimmed fastq of the mates



  </help>
</tool>