Mercurial > repos > jjohnson > fastqc
diff fastqc/fastqc.xml @ 0:1d373f219445 default tip
Migrated tool version 1.0.0 from old tool shed archive to new tool shed repository
author | jjohnson |
---|---|
date | Tue, 07 Jun 2011 17:22:05 -0400 |
parents | |
children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastqc/fastqc.xml Tue Jun 07 17:22:05 2011 -0400 @@ -0,0 +1,94 @@ +<tool id="FastQC" name="FastQC" version="1.0.0"> + <description>quality control checks on raw sequence data</description> + <command interpreter="python">fastqc.py + #if $input.extension.startswith( "fastq"): + --format=fastq + #else + --format=$input.extension + #end if + --input='$input' + --name='$input.name' + --dir='$report.extra_files_path' + --report='$report' + #if $contaminants != None and $contaminants != "None" and $contaminants != "": + --contaminants=$contaminants + #end if + </command> + <inputs> + <param name="input" type="data" format="fastq,sam,bam" label="FASTQ reads" /> + <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminants" + help="Two fields per line separated by a TAB: name DNA_sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/> + </inputs> + <outputs> + <data name="report" format="html" /> + </outputs> + <tests> + <!-- + <test> + <param name="input1_file" value="3.fastqsanger" ftype="fastqsanger" /> + <output name="output1_file" file="split_pair_reads_1.fastqsanger" /> + <output name="output2_file" file="split_pair_reads_2.fastqsanger" /> + </test> + --> + </tests> + <help> +**What it does** + +FastQC_ is a product of Bioinformatics Group at the Babraham Institute. FastQC aims to provide a simple way to do some quality control checks on raw sequence data coming from high throughput sequencing pipelines. It provides a modular set of analyses which you can use to give a quick impression of whether your data has any problems of which you should be aware before doing any further analysis. + +The main functions of FastQC are:: + + - Import of data from BAM, SAM or FastQ files (any variant) + - Provding a quick overview to tell you in which areas there may be problems + - Summary graphs and tables to quickly assess your data + - Export of results to an HTML based permanent report + - Offline operation to allow automated generation of reports without running the interactive application + + +.. _FastQC: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/ + +----- + +**Input format** + +Any fastq file, for example:: + + @HWI-EAS91_1_30788AAXX:7:21:1542:1758 + GTCAATTGTACTGGTCAATACTAAAAGAATAGGATCGCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA + +HWI-EAS91_1_30788AAXX:7:21:1542:1758 + hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR + +**Contaminants format** + +An optional contaminant file (otherwise FastQC will use the default):: + + # This file contains a list of potential contaminants which are + # frequently found in high throughput sequencing reactions. These + # are mostly sequences of adapters / primers used in the various + # sequencing chemistries. + # + # You can add more sequences to the file by putting one line per entry + # and specifying a name[tab]sequence. If the contaminant you add is + # likely to be of use to others please consider sending it to the FastQ + # authors, either via a bug report at www.bioinformatics.bbsrc.ac.uk/bugzilla/ + # or by directly emailing simon.andrews@bbsrc.ac.uk so other users of + # the program can benefit. + Illumina Single End Apapter 1 ACACTCTTTCCCTACACGACGCTGTTCCATCT + Illumina Single End Apapter 2 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT + Illumina Single End PCR Primer 1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT + Illumina Single End PCR Primer 2 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT + Illumina Single End Sequencing Primer ACACTCTTTCCCTACACGACGCTCTTCCGATCT + + +----- + +**Outputs** + +An HTML file with links to:: + + - fastqc_report.html + - summary.txt + - fastqc_data.txt + + </help> +</tool>