Mercurial > repos > jjohnson > fastqc
view fastqc/fastqc.xml @ 0:1d373f219445 default tip
Migrated tool version 1.0.0 from old tool shed archive to new tool shed repository
author | jjohnson |
---|---|
date | Tue, 07 Jun 2011 17:22:05 -0400 |
parents | |
children |
line wrap: on
line source
<tool id="FastQC" name="FastQC" version="1.0.0"> <description>quality control checks on raw sequence data</description> <command interpreter="python">fastqc.py #if $input.extension.startswith( "fastq"): --format=fastq #else --format=$input.extension #end if --input='$input' --name='$input.name' --dir='$report.extra_files_path' --report='$report' #if $contaminants != None and $contaminants != "None" and $contaminants != "": --contaminants=$contaminants #end if </command> <inputs> <param name="input" type="data" format="fastq,sam,bam" label="FASTQ reads" /> <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminants" help="Two fields per line separated by a TAB: name DNA_sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/> </inputs> <outputs> <data name="report" format="html" /> </outputs> <tests> <!-- <test> <param name="input1_file" value="3.fastqsanger" ftype="fastqsanger" /> <output name="output1_file" file="split_pair_reads_1.fastqsanger" /> <output name="output2_file" file="split_pair_reads_2.fastqsanger" /> </test> --> </tests> <help> **What it does** FastQC_ is a product of Bioinformatics Group at the Babraham Institute. FastQC aims to provide a simple way to do some quality control checks on raw sequence data coming from high throughput sequencing pipelines. It provides a modular set of analyses which you can use to give a quick impression of whether your data has any problems of which you should be aware before doing any further analysis. The main functions of FastQC are:: - Import of data from BAM, SAM or FastQ files (any variant) - Provding a quick overview to tell you in which areas there may be problems - Summary graphs and tables to quickly assess your data - Export of results to an HTML based permanent report - Offline operation to allow automated generation of reports without running the interactive application .. _FastQC: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/ ----- **Input format** Any fastq file, for example:: @HWI-EAS91_1_30788AAXX:7:21:1542:1758 GTCAATTGTACTGGTCAATACTAAAAGAATAGGATCGCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA +HWI-EAS91_1_30788AAXX:7:21:1542:1758 hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR **Contaminants format** An optional contaminant file (otherwise FastQC will use the default):: # This file contains a list of potential contaminants which are # frequently found in high throughput sequencing reactions. These # are mostly sequences of adapters / primers used in the various # sequencing chemistries. # # You can add more sequences to the file by putting one line per entry # and specifying a name[tab]sequence. If the contaminant you add is # likely to be of use to others please consider sending it to the FastQ # authors, either via a bug report at www.bioinformatics.bbsrc.ac.uk/bugzilla/ # or by directly emailing simon.andrews@bbsrc.ac.uk so other users of # the program can benefit. Illumina Single End Apapter 1 ACACTCTTTCCCTACACGACGCTGTTCCATCT Illumina Single End Apapter 2 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT Illumina Single End PCR Primer 1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT Illumina Single End PCR Primer 2 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT Illumina Single End Sequencing Primer ACACTCTTTCCCTACACGACGCTCTTCCGATCT ----- **Outputs** An HTML file with links to:: - fastqc_report.html - summary.txt - fastqc_data.txt </help> </tool>