|
0
|
1 <tool id="regex1" name="Regex Find And Replace" version="0.1.0">
|
|
|
2 <description></description>
|
|
|
3 <command interpreter="python">regex.py --input $input --output $out_file1
|
|
|
4 #for $check in $checks:
|
|
|
5 --pattern='$check.pattern' --replacement='$check.replacement'
|
|
|
6 #end for
|
|
|
7 </command>
|
|
|
8 <inputs>
|
|
|
9 <param format="txt" name="input" type="data" label="Select lines from"/>
|
|
|
10 <repeat name="checks" title="Check">
|
|
|
11 <param name="pattern" size="40" type="text" value="chr([0-9A-Za-z])+" label="Find Regex" help="here you can enter text or regular expression (for syntax check lower part of this frame)">
|
|
|
12 <sanitizer>
|
|
|
13 <valid>
|
|
|
14 <add preset="string.printable"/>
|
|
|
15 <remove value="\" />
|
|
|
16 <remove value="'" />
|
|
|
17 </valid>
|
|
|
18 <mapping initial="none">
|
|
|
19 <add source="\" target="__backslash__" />
|
|
|
20 <add source="'" target="__sq__"/>
|
|
|
21 </mapping>
|
|
|
22 </sanitizer>
|
|
|
23 </param>
|
|
|
24 <param name="replacement" size="40" type="text" value="newchr\1" label="Replacement">
|
|
|
25 <sanitizer>
|
|
|
26 <valid>
|
|
|
27 <add preset="string.printable"/>
|
|
|
28 <remove value="\" />
|
|
|
29 <remove value="'" />
|
|
|
30 </valid>
|
|
|
31 <mapping initial="none">
|
|
|
32 <add source="\" target="__backslash__" />
|
|
|
33 <add source="'" target="__sq__"/>
|
|
|
34 </mapping>
|
|
|
35 </sanitizer>
|
|
|
36 </param>
|
|
|
37 </repeat>
|
|
|
38 </inputs>
|
|
|
39 <outputs>
|
|
|
40 <data format="input" name="out_file1" metadata_source="input"/>
|
|
|
41 </outputs>
|
|
|
42 <tests>
|
|
|
43 <test>
|
|
|
44 <param name="input" value="find1.txt"/>
|
|
|
45 <param name="pattern" value="(T\w+)"/>
|
|
|
46 <param name="replacement" value="\1 \1" />
|
|
|
47 <output name="out_file1" file="replace1.txt"/>
|
|
|
48 </test>
|
|
|
49 <test>
|
|
|
50 <param name="input" value="find1.txt"/>
|
|
|
51 <param name="pattern" value="f"/>
|
|
|
52 <param name="replacement" value="'"" />
|
|
|
53 <output name="out_file1" file="replace2.txt"/>
|
|
|
54 </test>
|
|
|
55 </tests>
|
|
|
56 <help>
|
|
|
57 This tool goes line by line through the specified input file and
|
|
|
58 replaces text which matches the specified regular expression patterns
|
|
|
59 with its corresponding specified replacement.
|
|
|
60
|
|
|
61 This tool uses Python regular expressions. More information about
|
|
|
62 Python regular expressions can be found here:
|
|
|
63 http://docs.python.org/library/re.html.
|
|
|
64
|
|
|
65 To convert an Ilumina FATSQ sequence id from the CAVASA 8 format::
|
|
|
66
|
|
|
67 @EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG
|
|
|
68 GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC
|
|
|
69 +EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG
|
|
|
70 IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC
|
|
|
71
|
|
|
72 To the CASAVA 7 format::
|
|
|
73
|
|
|
74 @EAS139_FC706VJ:2:2104:15343:197393#0/1
|
|
|
75 GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC
|
|
|
76 +EAS139_FC706VJ:2:2104:15343:197393#0/1
|
|
|
77 IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC
|
|
|
78
|
|
|
79 Use Settings::
|
|
|
80
|
|
|
81 Find Regex: ^([@+][A-Z0-9]+):\d+:(\S+)\s(\d).*$
|
|
|
82 Replacement: \1_\2#0/\3
|
|
|
83
|
|
|
84 Note that the parentheses **()** capture patterns in the text that can be used in the replacement text by using a backslash-number reference: **\\1**
|
|
|
85
|
|
|
86 The regex **^([@+][A-Z0-9]+):\d+:(\S+) (\d).*$** means::
|
|
|
87
|
|
|
88 ^ - start the match at the beginning of the line of text
|
|
|
89 ( - start a group (1), that is a string of matched text, that can be back-referenced in the replacement as \1
|
|
|
90 [@+] - matches either a @ or + character
|
|
|
91 [A-Z0-9]+ - matches an uppercase letter or a digit, the plus sign means to match 1 or more such characters
|
|
|
92 ) - end a group (1), that is a string of matched text, that can be back-referenced in the replacement as \1
|
|
|
93 :\d+: - matches a colon followed by one or more digits followed by a colon character
|
|
|
94 (\S+) - matches one or more non-whitespace charcters, the enclosing parentheses make this a group (2) that can back-referenced in the replacement text as \2
|
|
|
95 \s - matches a whitespace character
|
|
|
96 (\d) - matches a single digit character, the enclosing parentheses make this a group (3) that can back-referenced in the replacement text as \3
|
|
|
97 .* - dot means match any character, asterisk means zero more more matches
|
|
|
98 $ - the regex must match to the end of the line of text
|
|
|
99
|
|
|
100
|
|
|
101
|
|
|
102 Galaxy aggressively escapes input supplied to tools, so if something
|
|
|
103 is not working please let us know and we can look into whether this is
|
|
|
104 the cause. Also if you would like help constructing regular
|
|
|
105 expressions for your inputs, please let us know at help@msi.umn.edu.
|
|
|
106 </help>
|
|
|
107 </tool>
|
