cutadapt: cutadapt.xml annotate

annotate cutadapt.xml @ 11:8665bcc8b847 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4

author	iuc
date	Mon, 05 Mar 2018 11:02:48 -0500
parents	01d94df2e32a
children	78e1cf88d133

rev	line source
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	1 <tool id="cutadapt" name="Cutadapt" version="1.16">
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	2 <description>Remove adapter sequences from Fastq/Fasta</description>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	3 <macros>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	4 <import>macros.xml</import>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	5 </macros>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	6 <requirements>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	7 <requirement type="package" version="1.16">cutadapt</requirement>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	8 </requirements>
10 01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	9
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	10 <version_command>cutadapt --version</version_command>
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	11
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	12 <command detect_errors="exit_code"><![CDATA[
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	13
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	14 ## Link in the input and output files, so Cutadapt can tell their type
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	15
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	16 #set compressed="False"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	17 #set format = "fastq"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	18
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	19 #if str($library.type) == 'paired':
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	20
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	21 #if $library.input_1.is_of_type("fastq.gz", "fastqsanger.gz"):
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	22 #set read1 = "input_f.fastq.gz"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	23 #set compressed = "GZ"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	24 #set out1 = "out1.gz"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	25 #else if $library.input_1.is_of_type("fastq.bz2", "fastqsanger.bz2"):
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	26 #set read1 = "input_f.fastq.bz2"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	27 #set compressed = "BZ2"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	28 #set out1 = "out1.bz2"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	29 #else if $library.input_1.is_of_type('fasta'):
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	30 #set format = "fasta"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	31 #set read1 = "input_f.fasta"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	32 #set out1 = "out1.fa"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	33 #else:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	34 #set read1 = "input_f.fastq"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	35 #set out1 = "out1.fq"
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	36 #end if
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	37 ln -f -s '${library.input_1}' ${read1} &&
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	38
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	39 #if $library.input_2.is_of_type("fastq.gz", "fastqsanger.gz"):
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	40 #set read2 = "input_r.fastq.gz"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	41 #set compressed = "GZ"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	42 #set out2 = "out2.gz"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	43 #else if $library.input_2.is_of_type("fastq.bz2", "fastqsanger.bz2"):
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	44 #set read2 = "input_r.fastq.bz2"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	45 #set compressed = "BZ2"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	46 #set out2 = "out2.bz2"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	47 #else if $library.input_2.is_of_type('fasta'):
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	48 #set read2 = "input_r.fasta"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	49 #set out2 = "out2.fa"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	50 #set format = "fasta"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	51 #else:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	52 #set read2 = "input_r.fastq"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	53 #set out2 = "out2.fq"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	54 #end if
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	55 ln -f -s '${library.input_2}' ${read2} &&
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	56
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	57
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	58 #else if str($library.type) == 'paired_collection':
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	59
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	60 #if $library.input_1.forward.is_of_type("fastq.gz", "fastqsanger.gz"):
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	61 #set read1 = "input_f.fastq.gz"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	62 #set compressed = "GZ"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	63 #set out1 = "out1.gz"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	64 #else if $library.input_1.forward.is_of_type("fastq.bz2", "fastqsanger.bz2"):
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	65 #set read1 = "input_f.fastq.bz2"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	66 #set compressed = "BZ2"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	67 #set out1 = "out1.bz2"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	68 #else if $library.input_1.forward.is_of_type('fasta'):
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	69 #set format = "fasta"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	70 #set read1 = "input_f.fasta"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	71 #set out1 = "out1.fa"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	72 #else:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	73 #set read1 = "input_f.fastq"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	74 #set out1 = "out1.fq"
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	75 #end if
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	76 ln -s '${library.input_1.forward}' ${read1} &&
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	77
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	78 #if $library.input_1.reverse.is_of_type("fastq.gz", "fastqsanger.gz"):
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	79 #set read2 = "input_r.fastq.gz"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	80 #set compressed = "GZ"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	81 #set out1 = "out2.gz"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	82 #else if $library.input_1.reverse.is_of_type("fastq.bz2", "fastqsanger.bz2"):
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	83 #set read2 = "input_r.fastq.bz2"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	84 #set compressed = "BZ2"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	85 #set out2 = "out2.bz2"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	86 #else if $library.input_1.reverse.is_of_type("fasta"):
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	87 #set format = "fasta"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	88 #set read2 = "input_r.fasta"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	89 #set out2 = "out2.fa"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	90 #else:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	91 #set read2 = "input_r.fastq"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	92 #set out2 = "out2.fq"
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	93 #end if
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	94 ln -s '${library.input_1.reverse}' ${read2} &&
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	95
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	96 #else:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	97 #if $library.input_1.is_of_type("fastq.gz", "fastqsanger.gz"):
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	98 #set read1 = "input_f.fastq.gz"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	99 #set compressed = "GZ"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	100 #set out1 = "out1.gz"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	101 #else if $library.input_1.is_of_type("fastq.bz2", "fastqsanger.bz2"):
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	102 #set read1 = "input_f.fastq.bz2"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	103 #set compressed = "BZ2"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	104 #set out1 = "out1.bz2"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	105 #else if $library.input_1.is_of_type('fasta'):
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	106 #set format = "fasta"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	107 #set read1 = "input_f.fasta"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	108 #set out1 = "out1.fa"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	109 #else:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	110 #set read1 = "input_f.fastq"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	111 #set out1 = "out1.fq"
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	112 #end if
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	113 ln -f -s '${library.input_1}' ${read1} &&
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	114 #end if
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	115
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	116
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	117 ## Run Cutadapt
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	118
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	119 cutadapt
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	120
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	121 -j \${GALAXY_SLOTS:-4}
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	122
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	123 --format=$format
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	124
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	125 #if str( $library.type ) == "single":
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	126 @read1_options@
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	127 --output='$out1'
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	128 #else:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	129 @read1_options@
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	130 @read2_options@
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	131 --output='$out1'
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	132 --paired-output='$out2'
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	133 #end if
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	134
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	135 --error-rate=$adapter_options.error_rate
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	136 --times=$adapter_options.count
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	137 --overlap=$adapter_options.overlap
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	138 $adapter_options.no_indels
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	139 $adapter_options.match_read_wildcards
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	140
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	141
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	142 $filter_options.discard
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	143 $filter_options.discard_untrimmed
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	144 $filter_options.no_trim
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	145 $filter_options.mask_adapter
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	146 #if str($filter_options.min) != '0':
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	147 --minimum-length=$filter_options.min
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	148 #end if
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	149 #if str($filter_options.max) != '0':
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	150 --maximum-length=$filter_options.max
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	151 #end if
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	152 #if $filter_options.max_n:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	153 --max-n=$filter_options.max_n
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	154 #end if
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	155 #if str( $library.type ) != "single":
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	156 #if $filter_options.pair_filter:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	157 --pair-filter=$filter_options.pair_filter
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	158 #end if
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	159 #end if
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	160
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	161
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	162 #if str($read_mod_options.quality_cutoff) != '0':
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	163 --quality-cutoff=$read_mod_options.quality_cutoff
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	164 #end if
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	165 #if str($read_mod_options.nextseq_trim) != '0':
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	166 --nextseq-trim=$read_mod_options.nextseq_trim
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	167 #end if
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	168 $read_mod_options.trim_n
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	169 #if $read_mod_options.prefix != '':
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	170 --prefix="$read_mod_options.prefix"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	171 #end if
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	172 #if $read_mod_options.suffix != '':
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	173 --suffix="$read_mod_options.suffix"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	174 #end if
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	175 #if str($read_mod_options.length) != '0':
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	176 --length=$$read_mod_options.length
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	177 #end if
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	178 #if $read_mod_options.length_tag != '':
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	179 --length-tag="$read_mod_options.length_tag"
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	180 #end if
2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	181
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	182 #if str( $library.type ) == "single":
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	183 '${read1}'
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	184 #else:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	185 '${read1}'
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	186 '${read2}'
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	187 #end if
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	188
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	189 #if $output_options.report:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	190 > report.txt
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	191 #end if
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	192
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	193 ]]></command>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	194
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	195 <inputs>
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	196
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	197 <!-- Reads -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	198 <conditional name="library">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	199 <param name="type" type="select" label="Single-end or Paired-end reads?">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	200 <option value="single">Single-end</option>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	201 <option value="paired">Paired-end</option>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	202 <option value="paired_collection">Paired-end Collection</option>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	203 </param>
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	204
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	205 <when value="single">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	206 <param name="input_1" format="fastq.gz,fastq,fastqsanger,fastqsanger.gz,fastqsanger.bz2,fasta" type="data" label="FASTQ/A file" help="Should be of datatype "fastq.gz" or "fasta"" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	207 <expand macro="single_end_options" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	208 </when>
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	209
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	210 <when value="paired">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	211 <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2,fasta" type="data" label="FASTQ/A file #1" help="Should be of datatype "fastq.gz"or "fasta"" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	212 <param name="input_2" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2,fasta" type="data" label="FASTQ/A file #2" help="Should be of datatype "fastq.gz"or "fasta"" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	213 <expand macro="paired_end_options" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	214 </when>
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	215
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	216 <when value="paired_collection">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	217 <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2,fasta" type="data_collection" collection_type="paired" label="Paired Collection" help="Should be of datatype "fastq.gz" or "fasta"" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	218 <expand macro="paired_end_options" />
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	219 </when>
2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	220 </conditional>
2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	221
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	222 <!-- Adapter Options -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	223 <section name="adapter_options" title="Adapter Options">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	224 <param name="error_rate" argument="--error-rate" type="float" min="0" max="1" value="0.1" label="Maximum error rate" help="Maximum allowed error rate (no. of errors divided by the length of the matching region)." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	225 <param name="no_indels" argument="--no-indels" type="boolean" value="False" truevalue="--no-indels" falsevalue="" label="Do not allow indels (Use ONLY with anchored 5' (front) adapters)." help="Do not allow indels in the alignments. That is, allow only mismatches. This option is currently only supported for anchored 5' adapters ('^ADAPTER') (default: both mismatches and indels are allowed)." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	226 <param name="count" argument="--times" type="integer" min="1" value="1" label="Match times" help="Try to remove adapters at most COUNT times. Useful when an adapter gets appended multiple times." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	227 <param name="overlap" argument="--overlap" type="integer" min="1" value="3" label="Minimum overlap length" help="Minimum overlap length. If the overlap between the adapter and the sequence is shorter than LENGTH, the read is not modified. This reduces the number of bases trimmed purely due to short random adapter matches." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	228 <param name="match_read_wildcards" argument="--match-read-wildcards" type="boolean" value="False" truevalue="--match-read-wildcards" falsevalue="" label="Match Read Wildcards" help="Allow 'N's in the read as matches to the adapter." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	229 </section>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	230
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	231 <!-- Filter Options -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	232 <section name="filter_options" title="Filter Options">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	233 <param name="discard" argument="--discard-trimmed" type="boolean" value="False" truevalue="--discard" falsevalue="" label="Discard Trimmed Reads" help="Discard reads that contain the adapter instead of trimming them. Use the 'Minimum overlap length' option in order to avoid throwing away too many randomly matching reads!" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	234 <param name="discard_untrimmed" argument="--discard_untrimmed" type="boolean" value="False" truevalue="--discard-untrimmed" falsevalue="" label="Discard Untrimmed Reads" help="Discard reads that do not contain the adapter." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	235 <param name="min" argument="--minimum-length" type="integer" min="0" optional="True" value="0" label="Minimum length" help="Discard trimmed reads that are shorter than LENGTH. Reads that are too short even before adapter removal are also discarded. In colorspace, an initial primer is not counted. Value of 0 means no minimum length." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	236 <param name="max" argument="--maximum-length" type="integer" min="0" optional="True" value="0" label="Maximum length" help="Discard trimmed reads that are longer than LENGTH. Reads that are too long even before adapter removal are also discarded. In colorspace, an initial primer is not counted. Value of 0 means no maximum length." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	237 <param name="no_trim" argument="--no-trim" type="boolean" value="False" truevalue="--no-trim" falsevalue="" label="Do not trim adapters" help="Match and redirect reads to output/untrimmed-output as usual, but don't remove the adapters (default: trim the adapters)." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	238 <param name="mask_adapter" argument="--mask-adapter" type="boolean" value="False" truevalue="--mask-adapter" falsevalue="" label="Mask Adapters" help="Mask adapter bases with 'N' instead of trimming them (default: trim adapters)." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	239 <param name="max_n" argument="--max-n" type="float" min="0" optional="True" label="Max N" help="Discard reads with more than this number of 'N' bases. A number between 0 and 1 is interpreted as a fraction of the read length." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	240 <param name="pair_filter" argument="--pair-filter" type="select" optional="True" label="Pair filter" help="Which of the reads in a paired-end read have to match the filtering criterion in order for the pair to be filtered. Default: any">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	241 <option value="any" selected="True">any</option>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	242 <option value="both">both</option>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	243 </param>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	244 </section>
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	245
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	246 <!-- Read Modification Options -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	247 <section name="read_mod_options" title="Read Modification Options">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	248 <param name="quality_cutoff" argument="--quality-cutoff" type="text" value="0" label="Quality cutoff" help=" Trim low-quality bases from 5' and/or 3' ends of each read before adapter removal. Applied to both reads if data is paired. If one value is given, only the 3' end is trimmed. If two comma-separated cutoffs are given, the 5' end is trimmed with the first cutoff, the 3' end with the second.">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	249 <sanitizer>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	250 <valid initial="string.digits"><add value="," /></valid>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	251 </sanitizer>
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	252 </param>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	253 <param name="nextseq_trim" argument="--nextseq-trim" type="integer" value="0" label="NextSeq trimming" help="Experimental option for quality trimming of NextSeq data. This is necessary because that machine cannot distinguish between G and reaching the end of the fragment (it encodes G as ‘black’). This option works like regular quality trimming (where one would use -q 20 instead), except that the qualities of G bases are ignored." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	254 <param name="trim_n" argument="--trim-n" type="boolean" truevalue="--trim-n" falsevalue="" checked="False" label="Trim Ns" help="Trim N's on ends of reads." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	255 <param name="prefix" argument="--prefix" label="Prefix" type="text" help="Add this prefix to read names" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	256 <param name="suffix" argument="--suffix" label="Suffix" type="text" help="Add this suffix to read names" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	257 <param name="strip_suffix" argument="--strip-suffix" label="Strip suffix" type="text" help="Remove this suffix from read names if present." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	258 <param name="length" argument="--length" type="integer" value="0" label="Length" help="Shorten reads to this length. This modification is applied after adapter trimming." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	259 <param name="length_tag" argument="--length-tag" label="Length Tag" type="text" help="Search for TAG followed by a decimal number in the name of the read (description/comment field of the FASTA or FASTQ file). Replace the decimal number with the correct length of the trimmed read. For example, use --length-tag 'length=' to search for fields like 'length=123'." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	260 </section>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	261
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	262 <!-- Output Options -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	263 <section name="output_options" title="Output Options">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	264 <param name="report" type="boolean" value="False" label="Report" help="Cutadapt's per-adapter statistics."/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	265 <param name="info_file" argument="--info-file" type="boolean" value="False" label="Info File" help="Write information about each read and its adapter matches to a file."/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	266 <param name="rest_file" argument="--rest-file" type="boolean" value="False" label="Rest of Read" help="When the adapter matches in the middle of a read, write the rest (after the adapter) into a file."/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	267 <param name="wildcard_file" argument="--wildcard-file" type="boolean" value="False" label="Wildcard File" help="When the adapter has wildcard bases ('N's) write adapter bases matching wildcard positions to file."/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	268 <param name="too_short_file" argument="--too-short-output" type="boolean" value="False" label="Too Short Reads" help="Write reads that are too short (according to minimum length specified) to a file. (default: discard reads)"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	269 <param name="too_long_file" argument="--too-long-output" type="boolean" value="False" label="Too Long Reads" help="Write reads that are too long (according to maximum length specified) to a file. (default: discard reads)"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	270 <param name="untrimmed_file" argument="--untrimmed-output" type="boolean" value="False" label="Untrimmed Reads" help="Write reads that do not contain the adapter to a separate file, instead of writing them to the regular output file. (default: output to same file as trimmed)"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	271 </section>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	272
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	273 </inputs>
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	274
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	275 <outputs>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	276 <data name="out1" format_source="input_1" metadata_source="input_1" from_work_dir="out1*" label="${tool.name} on ${on_string}: Read 1 Output"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	277 <data name="out2" format_source="input_2" metadata_source="input_2" from_work_dir="out2*" label="${tool.name} on ${on_string}: Read 2 Output" >
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	278 <filter>(library['type'] == 'paired' or library['type'] == 'paired_collection')</filter>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	279 </data>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	280
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	281 <data name="report" format="txt" from_work_dir="report.txt" label="${tool.name} on ${on_string}: Report">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	282 <filter>(output_options['report'] is True)</filter>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	283 </data>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	284
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	285 <data name="info_file" format_source="txt" metadata_source="input_1" label="${tool.name} on ${on_string}: Info File" >
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	286 <filter>(output_options['info_file'] is True)</filter>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	287 </data>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	288
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	289 <data name="rest_output" format_source="input_1" metadata_source="input_1" label="${tool.name} on ${on_string}: Rest of Reads (R1 only)" >
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	290 <filter>(output_options['rest_file'] is True)</filter>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	291 </data>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	292
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	293 <data name="wild_output" format_source="txt" metadata_source="input_1" label="${tool.name} on ${on_string}: Wildcard File" >
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	294 <filter>(output_options['wildcard_file'] is True)</filter>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	295 </data>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	296
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	297 <data name="untrimmed_output" format_source="input_1" metadata_source="input_1" label="${tool.name} on ${on_string}: Untrimmed Read 1" >
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	298 <filter>(output_options['untrimmed_file'] is True)</filter>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	299 </data>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	300 <data name="untrimmed_paired_output" format_source="input_2" metadata_source="input_2" label="${tool.name} on ${on_string}: Untrimmed Read 2" >
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	301 <filter>(library['type'] == 'paired' or library['type'] == 'paired_collection')</filter>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	302 <filter>(output_options['untrimmed_file'] is True)</filter>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	303 </data>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	304
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	305 <data name="too_short_output" format_source="input_1" metadata_source="input_1" label="${tool.name} on ${on_string}: Too Short Read 1" >
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	306 <filter>(output_options['too_short_file'] is True)</filter>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	307 </data>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	308 <data name="too_short_paired_output" format_source="input_2" metadata_source="input_2" label="${tool.name} on ${on_string}: Too Short Read 2" >
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	309 <filter>(library['type'] == 'paired' or library['type'] == 'paired_collection')</filter>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	310 <filter>(output_options['too_short_file'] is True)</filter>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	311 </data>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	312
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	313 <data name="too_long_output" format_source="input_1" metadata_source="input_1" label="${tool.name} on ${on_string}: Too Long Read 1" >
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	314 <filter>(output_options['too_long_file'] is True)</filter>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	315 </data>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	316 <data name="too_long_paired_output" format_source="input_2" metadata_source="input_2" label="${tool.name} on ${on_string}: Too Long Read 2" >
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	317 <filter>(library['type'] == 'paired' or library['type'] == 'paired_collection')</filter>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	318 <filter>(output_options['too_long_file'] is True)</filter>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	319 </data>
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	320 </outputs>
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	321
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	322 <tests>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	323 <!-- Ensure fastq works -->
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	324 <test>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	325 <param name="type" value="single" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	326 <param name="input_1" ftype="fastq" value="cutadapt_small.fastq" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	327 <param name="adapter_source_list" value="user"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	328 <param name="adapter" value="AGATCGGAAGAGC"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	329 <output name="out1" file="cutadapt_small.out"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	330 </test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	331 <!-- Ensure single end fastq.gz works -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	332 <test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	333 <param name="type" value="single" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	334 <param name="input_1" ftype="fastq.gz" value="bwa-mem-fastq1.fq.gz" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	335 <param name="adapter_source_list" value="user"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	336 <param name="adapter" value="AGATCGGAAGAGC"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	337 <output name="out1" decompress="True" file="cutadapt_out1.fq.gz"/>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	338 </test>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	339 <!-- Ensure paired end fastq.gz works -->
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	340 <test>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	341 <param name="type" value="paired" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	342 <param name="input_1" ftype="fastq.gz" value="bwa-mem-fastq1.fq.gz" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	343 <param name="input_2" ftype="fastq.gz" value="bwa-mem-fastq2.fq.gz" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	344 <param name="adapter_source_list" value="user"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	345 <param name="adapter" value="AGATCGGAAGAGC"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	346 <param name="adapter_source_list2" value="user"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	347 <param name="adapter2" value="AGATCGGAAGAGC"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	348 <output name="out1" decompress="True" file="cutadapt_out1.fq.gz"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	349 <output name="out2" decompress="True" file="cutadapt_out2.fq.gz"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	350 </test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	351 <!-- Ensure built-in adapters work -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	352 <test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	353 <param name="type" value="single" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	354 <param name="input_1" ftype="fastq" value="cutadapt_small.fastq" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	355 <param name="adapter_source_list" value="builtin"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	356 <param name="adapter" value="TGTAGGCC"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	357 <output name="out1" file="cutadapt_builtin.out"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	358 </test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	359 <!-- Ensure discard file output works -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	360 <test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	361 <param name="input_1" ftype="fastq" value="cutadapt_small.fastq" />
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	362 <param name="adapter_source_list" value="user"/>
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	363 <param name="adapter" value="TTAGACATATCTCCGTCG"/>
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	364 <param name="output_filtering" value="filter"/>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	365 <param name="discard" value="True"/>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	366 <param name="read_modification" value="none"/>
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	367 <param name="output_type" value="default"/>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	368 <output name="out1" file="cutadapt_discard.out"/>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	369 </test>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	370 <!-- Ensure rest file output works -->
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	371 <test>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	372 <param name="input_1" ftype="fasta" value="cutadapt_rest.fa" />
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	373 <param name="adapter_source_list" value="user"/>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	374 <param name="adapter" value="AAAGATG"/>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	375 <param name="output_filtering" value="default"/>
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	376 <param name="read_modification" value="none"/>
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	377 <param name="output_type" value="additional"/>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	378 <param name="rest_file" value="True"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	379 <output name="out1" file="cutadapt_rest.out"/>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	380 <output name="rest_output" file="cutadapt_rest2.out"/>
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	381 </test>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	382 <!-- Ensure nextseq-trim option works -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	383 <test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	384 <param name="type" value="single" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	385 <param name="input_1" ftype="fastq.gz" value="bwa-mem-fastq1.fq.gz" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	386 <param name="adapter_source_list" value="user"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	387 <param name="adapter" value="AGATCGGAAGAGC"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	388 <param name="read_modification" value="modify"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	389 <param name="nextseq_trim" value="20" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	390 <output name="out1" decompress="True" file="cutadapt_nextseq_out.fq.gz"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	391 </test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	392 <!-- Ensure Report and Info file output work -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	393 <test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	394 <param name="type" value="single" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	395 <param name="input_1" ftype="fastq" value="cutadapt_small.fastq" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	396 <param name="adapter_source_list" value="user"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	397 <param name="adapter" value="AGATCGGAAGAGC"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	398 <param name="report" value="True" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	399 <param name="info_file" value="True" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	400 <output name="out1" value="cutadapt_small.out"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	401 <output name="report">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	402 <assert_contents>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	403 <has_text text="Summary"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	404 </assert_contents>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	405 </output>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	406 <output name="info_file" value="cutadapt_info_out.txt"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	407 </test>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	408 </tests>
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	409
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	410 <help><![CDATA[
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	411
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	412 .. class:: infomark
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	413
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	414 What it does
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	415
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	416 -------------------
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	417
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	418 Cutadapt finds and removes adapter sequences, primers, poly-A tails and other types of unwanted sequence from your high-throughput sequencing reads.
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	419
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	420 Cleaning your data in this way is often required: Reads from small-RNA sequencing contain the 3’ sequencing adapter because the read is longer than the molecule that is sequenced, such as in microRNA, or CRISPR data, or Poly-A tails that are useful for pulling out RNA from your sample but often you don’t want them to be in your reads.
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	421
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	422 Cutadapt_ helps with these trimming tasks by finding the adapter or primer sequences in an error-tolerant way. It can also modify and filter reads in various ways. Cutadapt searches for the adapter in all reads and removes it when it finds it. Unless you use a filtering option, all reads that were present in the input file will also be present in the output file, some of them trimmed, some of them not. Even reads that were trimmed entirely (because the adapter was found in the very beginning) are output. All of this can be changed with options in the tool form above.
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	423
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	424 The tool is based on the Open Source Cutadapt_ tool. See the complete `Cutadapt documentation`_ for additional details. If you use Cutadapt, please cite Marcel, 2011 under Citations below.
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	425
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	426 -------------------
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	427
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	428 Inputs
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	429
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	430 -------------------
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	431
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	432 Input files for Cutadapt need to be:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	433
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	434 - FASTQ.GZ, FASTQ.BZ2, FASTQ or FASTA
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	435
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	436 To trim an adapter, input the ADAPTER sequence e.g. AACCGGTT (with the characters: $, ^, ..., if anchored or linked).
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	437
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	438 ============================================= ===================
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	439 Option Sequence
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	440 --------------------------------------------- -------------------
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	441 3’ (End) Adapter ADAPTER
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	442 Anchored 3’ Adapter ADAPTER$
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	443
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	444 5’ (Front) Adapter ADAPTER
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	445 Anchored 5’ Adapter ^ADAPTER
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	446
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	447 5’ or 3’ (Both possible) ADAPTER
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	448
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	449 Linked Adapter - 3' (End) only ADAPTER1...ADAPTER2
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	450 Non-anchored Linked Adapter - 5' (Front) only ADAPTER1...ADAPTER2
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	451 ============================================= ===================
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	452
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	453 Below is an illustration of the allowed adapter locations relative to the read and depending on the adapter type:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	454
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	455 .. image:: $PATH_TO_IMAGES/adapters.svg
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	456
8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	457
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	458 -------------------
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	459
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	460 Example: Illumina TruSeq Adapters
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	461
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	462 -------------------
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	463
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	464 If you have reads containing Illumina TruSeq adapters, for example, follow these steps.
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	465
8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	466
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	467 For Single-end reads as well as the first reads of Paired-end data:
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	468
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	469 Read 1
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	470
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	471 In the 3' (End) Adapters option above, insert A + the “TruSeq Indexed Adapter” prefix that is common to all Indexed Adapter sequences, e.g insert:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	472
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	473 AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	474
8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	475
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	476 For the second reads of Paired-end data:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	477
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	478 Read 2
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	479
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	480 In the 3' (End) Adapters option above, insert the reverse complement of the “TruSeq Universal Adapter”:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	481
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	482 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	483
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	484 The adapter sequences can be found in the document `Illumina TruSeq Adapters De-Mystified`_.
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	485
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	486 -----------
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	487
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	488 Outputs
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	489
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	490 -----------
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	491
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	492 - Trimmed reads
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	493
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	494 Optionally, under Output Options you can choose to output
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	495
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	496 * Report
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	497 * Info file
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	498
2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	499
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	500 Report
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	501
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	502 Cutadapt can output per-adapter statistics if you select to output the report above.
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	503
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	504 Example:
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	505
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	506 This is cutadapt 1.16 with Python 3.6.4
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	507
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	508 Command line parameters: -j 1 --format=fastq -a AGATCGGAAGAGC --info-file=/tmp/tmpX0DlY1/files/000/dataset_21.dat --output=out1.fq --error-rate=0.1 --times=1 --overlap=3 input_f.fastq
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	509 Running on 1 core
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	510 Trimming 1 adapter with at most 10.0% errors in single-end mode ...
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	511 Finished in 0.00 s (1426 us/read; 0.04 M reads/minute).
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	512
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	513 === Summary ===
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	514
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	515 * Total reads processed: 3*
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	516 * Reads with adapters: 0 (0.0%)*
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	517 * Reads written (passing filters): 3 (100.0%)*
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	518
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	519 * Total basepairs processed: 102 bp*
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	520 * Total written (filtered): 102 bp (100.0%)*
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	521
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	522 === Adapter 1 ===
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	523
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	524 Sequence: AGATCGGAAGAGC; Type: regular 3'; Length: 13; Trimmed: 0 times.
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	525
8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	526
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	527 Info file
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	528
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	529 The info file contains information about the found adapters. The output is a tab-separated text file. Each line corresponds to one read of the input file.
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	530
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	531 Columns contain the following data:
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	532
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	533 * 1st: Read name
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	534 * 2nd: Number of errors
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	535 * 3rd: 0-based start coordinate of the adapter match
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	536 * 4th: 0-based end coordinate of the adapter match
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	537 * 5th: Sequence of the read to the left of the adapter match (can be empty)
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	538 * 6th: Sequence of the read that was matched to the adapter
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	539 * 7th: Sequence of the read to the right of the adapter match (can be empty)
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	540 * 8th: Name of the found adapter
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	541 * 9th: Quality values corresponding to sequence left of the adapter match (can be empty)
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	542 * 10th: Quality values corresponding to sequence matched to the adapter (can be empty)
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	543 * 11th: Quality values corresponding to sequence to the right of the adapter (can be empty)
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	544
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	545 The concatenation of columns 5-7 yields the full read sequence. Column 8 identifies the found adapter. Adapters without a name are numbered starting from 1. Fields 9-11 are empty if quality values are not available. Concatenating them yields the full sequence of quality values.
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	546
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	547 If no adapter was found, the format is as follows:
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	548
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	549 #. Read name
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	550 #. The value -1
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	551 #. The read sequence
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	552 #. Quality values
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	553
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	554 When parsing the file, be aware that additional columns may be added in the future. Note also that some fields can be empty, resulting in consecutive tabs within a line.
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	555
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	556 If the --times option is used and greater than 1, each read can appear more than once in the info file. There will be one line for each found adapter, all with identical read names. Only for the first of those lines will the concatenation of columns 5-7 be identical to the original read sequence (and accordingly for columns 9-11). For subsequent lines, the shown sequence are the ones that were used in subsequent rounds of adapter trimming, that is, they get successively shorter.
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	557
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	558 --------------------
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	559
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	560 More Information
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	561
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	562 --------------------
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	563
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	564 See the excellent `Cutadapt documentation`_
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	565
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	566 .. _Cutadapt: https://cutadapt.readthedocs.io/en/stable/
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	567 .. _`Cutadapt documentation`: https://cutadapt.readthedocs.io/en/latest/index.html
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	568 .. _`Illumina TruSeq Adapters De-Mystified`: http://tucf-genomics.tufts.edu/documents/protocols/TUCF_Understanding_Illumina_TruSeq_Adapters.pdf
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	569
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	570
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	571 --------------------
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	572
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	573 Galaxy Wrapper Development
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	574
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	575 --------------------
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	576
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	577 Author: Lance Parsons <lparsons@princeton.edu>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	578
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	579 ]]></help>
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	580
10 01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	581 <citations>
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	582 <citation type="bibtex">
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	583 @article{marcel_cutadapt_2011,
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	584 title = {Cutadapt removes adapter sequences from high-throughput sequencing reads},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	585 volume = {17},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	586 copyright = {Authors who publish with this journal agree to the following terms: Authors retain copyright and grant the journal right of first publication with the work simultaneously licensed under a Creative Commons Attribution License that allows others to share the work with an acknowledgement of the work's authorship and initial publication in this journal. Authors are able to enter into separate, additional contractual arrangements for the non-exclusive distribution of the journal's published version of the work (e.g., post it to an institutional repository or publish it in a book), with an acknowledgement of its initial publication in this journal. Authors are permitted and encouraged to post their work online (e.g., in institutional repositories or on their website) prior to and during the submission process, as it can lead to productive exchanges, as well as earlier and greater citation of published work (See The Effect of Open Access ).},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	587 url = {http://journal.embnet.org/index.php/embnetjournal/article/view/200},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	588 abstract = {When small RNA is sequenced on current sequencing machines, the resulting reads are usually longer than the RNA and therefore contain parts of the 3' adapter. That adapter must be found and removed error-tolerantly from each read before read mapping. Previous solutions are either hard to use or do not offer required features, in particular support for color space data. As an easy to use alternative, we developed the command-line tool cutadapt, which supports 454, Illumina and SOLiD (color space) data, offers two adapter trimming algorithms, and has other useful features.
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	589
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	590 Cutadapt, including its MIT-licensed source code, is available for download at http://code.google.com/p/cutadapt/},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	591 number = {1},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	592 urldate = {2011-08-02},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	593 journal = {EMBnet.journal},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	594 author = {Marcel, Martin},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	595 year = {2011},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	596 note = {When small RNA is sequenced on current sequencing machines, the resulting reads are usually longer than the RNA and therefore contain parts of the 3' adapter. That adapter must be found and removed error-tolerantly from each read before read mapping. Previous solutions are either hard to use or do not offer required features, in particular support for color space data. As an easy to use alternative, we developed the command-line tool cutadapt, which supports 454, Illumina and SOLiD (color space) data, offers two adapter trimming algorithms, and has other useful features. Cutadapt, including its MIT-licensed source code, is available for download at http://code.google.com/p/cutadapt/},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	597 keywords = {Adapter removal;, fastq, MicroRNA, Sequencing, Small RNA, software},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	598 file = {Cutadapt removes adapter sequences from high-throughput sequencing reads \| Martin \| EMBnet.journal:/Users/lparsons/Library/Application Support/Firefox/Profiles/thd2t4je.default/zotero/storage/ZXZT4PSE/200.html:text/html}
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	599 }
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	600 </citation>
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	601 </citations>
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	602
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	603 </tool>

Mercurial > repos > lparsons > cutadapt

annotate cutadapt.xml @ 11:8665bcc8b847 draft