Mercurial > repos > lz_hust > gatktools
changeset 15:01ff8dd37d4d draft default tip
Uploaded
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/base_recalibrator.xml Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,307 @@ +<tool id="gatk2_base_recalibrator" name="Base Recalibrator" version="@VERSION@.0"> + <description>calculates covariates used to recalibrate base quality scores of reads</description> + <macros> + <import>gatk2_macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="version_command" /> + <command interpreter="python"> + gatk2_wrapper.py + --stdout "${output_log}" + -d "-I" "${reference_source.input_bam}" "${reference_source.input_bam.ext}" "gatk_input" + #if str( $reference_source.input_bam.metadata.bam_index ) != "None": + -d "" "${reference_source.input_bam.metadata.bam_index}" "bam_index" "gatk_input" ##hardcode galaxy ext type as bam_index + #end if + -p ' + @JAR_PATH@ + -T "BaseRecalibrator" + \$GATK2_SITE_OPTIONS + + ## according to http://www.broadinstitute.org/gatk/guide/article?id=1975 + --num_cpu_threads_per_data_thread \${GALAXY_SLOTS:-8} + + ## we set non standards at every run and the user can choose which ones are preferred + ## in our select box both standard options (ContextCovariate, CycleCovariate) are selected by default + --no_standard_covs + + #if $reference_source.reference_source_selector != "history": + -R "${reference_source.ref_file.fields.path}" + #end if + #if str($input_recal) != 'None': + --BQSR "${input_recal}" + #end if + --out "${output_recal}" + #if str( $covariates ) != "None": + #for $cov in str( $covariates ).split( ',' ): + -cov "${cov}" + #end for + #end if + ' + + #set $snp_dataset_provided = False + #set $rod_binding_names = dict() + #for $rod_binding in $rod_bind: + #if str( $rod_binding.rod_bind_type.rod_bind_type_selector ) == 'custom': + #set $rod_bind_name = $rod_binding.rod_bind_type.custom_rod_name + #else + #set $rod_bind_name = $rod_binding.rod_bind_type.rod_bind_type_selector + #end if + #if str( $rod_binding.rod_bind_type.rod_bind_type_selector ) == 'dbsnp': + #set $snp_dataset_provided = True + #end if + #set $rod_binding_names[$rod_bind_name] = $rod_binding_names.get( $rod_bind_name, -1 ) + 1 + -d "--knownSites:${rod_bind_name},%(file_type)s" "${rod_binding.rod_bind_type.input_rod}" "${rod_binding.rod_bind_type.input_rod.ext}" "input_${rod_bind_name}_${rod_binding_names[$rod_bind_name]}" + #end for + + #include source=$standard_gatk_options# + + ##start analysis specific options + #if $analysis_param_type.analysis_param_type_selector == "advanced": + -p ' + #if $analysis_param_type.default_read_group_type.default_read_group_type_selector == "set": + --default_read_group "${analysis_param_type.default_read_group_type.default_read_group}" + #end if + #if str( $analysis_param_type.default_platform ) != "default": + --default_platform "${analysis_param_type.default_platform}" + #end if + #if str( $analysis_param_type.force_read_group_type.force_read_group_type_selector ) == "set": + --force_read_group "${analysis_param_type.force_read_group_type.force_read_group}" + #end if + #if str( $analysis_param_type.force_platform ) != "default": + --force_platform "${analysis_param_type.force_platform}" + #end if + ${analysis_param_type.exception_if_no_tile} + #if str( $analysis_param_type.solid_options_type.solid_options_type_selector ) == "set": + #if str( $analysis_param_type.solid_options_type.solid_recal_mode ) != "default": + --solid_recal_mode "${analysis_param_type.solid_options_type.solid_recal_mode}" + #end if + #if str( $analysis_param_type.solid_options_type.solid_nocall_strategy ) != "default": + --solid_nocall_strategy "${analysis_param_type.solid_options_type.solid_nocall_strategy}" + #end if + #end if + --window_size_nqs "${analysis_param_type.window_size_nqs}" + --homopolymer_nback "${analysis_param_type.homopolymer_nback}" + ' + #end if + #if not $snp_dataset_provided: + -p '--run_without_dbsnp_potentially_ruining_quality' + #end if + </command> + <inputs> + <conditional name="reference_source"> + <expand macro="reference_source_selector_param" /> + <when value="cached"> + <param name="input_bam" type="data" format="bam" label="BAM file" help="-I,--input_file &lt;input_file&gt;"> + <validator type="unspecified_build" /> + <validator type="dataset_metadata_in_data_table" table_name="gatk2_picard_indexes" metadata_name="dbkey" metadata_column="dbkey" message="Sequences are not currently available for the specified build." /> <!-- fixme!!! this needs to be a select --> + </param> + <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &lt;reference_sequence&gt;" > + <options from_data_table="gatk2_picard_indexes"> + <filter type="data_meta" key="dbkey" ref="input_bam" column="dbkey"/> + </options> + <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> + </param> + </when> + <when value="history"> + <param name="input_bam" type="data" format="bam" label="BAM file" help="-I,--input_file &lt;input_file&gt;" /> + <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &lt;reference_sequence&gt;"> + <options> + <filter type="data_meta" key="dbkey" ref="input_bam" /> + </options> + </param> + </when> + </conditional> + <param name="input_recal" type="data" format="gatk_report" optional="true" label="Covariates table recalibration file" help="The input covariates table file which enables on-the-fly base quality score recalibration. Enables on-the-fly recalibrate of base qualities. The covariates tables are produced by the BaseQualityScoreRecalibrator tool. Please be aware that one should only run recalibration with the covariates file created on the same input bam(s) (-BQSR,--BQSR &lt;recal_file&gt;)" /> + + <param name="covariates" type="select" multiple="True" display="checkboxes" label="Covariates to be used in the recalibration" help="-cov,--covariate &lt;covariate&gt;" > + <!-- might we want to load the available covariates from an external configuration file, since additional ones can be added to local installs? --> + <option value="ContextCovariate" selected="true"/> + <option value="CycleCovariate" selected="true"/> + <option value="RepeatLengthCovariate" /> + <option value="RepeatUnitCovariate" /> + <option value="RepeatUnitAndLengthCovariate" /> + <!-- + Note: ReadGroupCovariate and QualityScoreCovariate are required covariates and will + be added for the user regardless of whether or not they were specified. + <option value="QualityScoreCovariate" /> + <option value="ReadGroupCovariate" /> + --> + </param> + + <repeat name="rod_bind" title="Known Variants" help="Using data sets of known variants (-knownSites,--knownSites &lt;knownSites&gt;)"> + <conditional name="rod_bind_type"> + <param name="rod_bind_type_selector" type="select" label="Variant Type"> + <option value="dbsnp" selected="True">dbSNP</option> + <option value="snps">SNPs</option> + <option value="indels">INDELs</option> + <option value="mask">Mask</option> + <option value="custom">Custom</option> + </param> + <when value="dbsnp"> + <param name="input_rod" type="data" format="vcf,gatk_dbsnp,bed" label="Variant file" /> + </when> + <when value="snps"> + <param name="input_rod" type="data" format="vcf,gatk_dbsnp,bed" label="Variant file" /> + </when> + <when value="indels"> + <param name="input_rod" type="data" format="vcf,gatk_dbsnp,bed" label="Variant file" /> + </when> + <when value="mask"> + <param name="input_rod" type="data" format="vcf,gatk_dbsnp,bed" label="Variant file" /> + </when> + <when value="custom"> + <param name="custom_rod_name" type="text" value="Unknown" label="Customer's variant file"/> + <param name="input_rod" type="data" format="vcf,gatk_dbsnp,bed" label="Variant file" /> + </when> + </conditional> + </repeat> + + <expand macro="gatk_param_type_conditional" /> + + <conditional name="analysis_param_type"> + <param name="analysis_param_type_selector" type="select" label="Basic or Advanced Analysis options"> + <option value="basic" selected="True">Basic</option> + <option value="advanced">Advanced</option> + </param> + <when value="basic"> + <!-- Do nothing here --> + </when> + <when value="advanced"> + <conditional name="default_read_group_type"> + <param name="default_read_group_type_selector" type="select" label="Set default Read Group" help="--default_read_group"> + <option value="default" selected="True">Don't Set</option> + <option value="set">Set</option> + </param> + <when value="default"> + <!-- do nothing here --> + </when> + <when value="set"> + <param name="default_read_group" type="text" value="Unknown" label="If a read has no read group then default to the provided String"/> + </when> + </conditional> + <param name="default_platform" type="select" label="Set default Platform" help="--default_platform"> + <option value="default" selected="True">Don't Set</option> + <option value="illumina">illumina</option> + <option value="454">454</option> + <option value="solid">solid</option> + </param> + <conditional name="force_read_group_type"> + <param name="force_read_group_type_selector" type="select" label="Force Read Group" help="--force_read_group"> + <option value="default" selected="True">Don't Force</option> + <option value="set">Force</option> + </param> + <when value="default"> + <!-- do nothing here --> + </when> + <when value="set"> + <param name="force_read_group" type="text" value="Unknown" label="If provided, the read group ID of EVERY read will be forced to be the provided String."/> + </when> + </conditional> + <param name="force_platform" type="select" label="Force Platform" help="--force_platform"> + <option value="default" selected="True">Don't Force</option> + <option value="illumina">illumina</option> + <option value="454">454</option> + <option value="solid">solid</option> + </param> + <param name="exception_if_no_tile" type="boolean" checked="False" truevalue="--exception_if_no_tile" falsevalue="" label="Throw an exception when no tile can be found" help="--exception_if_no_tile"/> + <conditional name="solid_options_type"> + <param name="solid_options_type_selector" type="select" label="Set SOLiD specific options"> + <option value="default" selected="True">Don't Set</option> + <option value="set">Set</option> + </param> + <when value="default"> + <!-- do nothing here --> + </when> + <when value="set"> + <param name="solid_recal_mode" type="select" label="How should we recalibrate solid bases in which the reference was inserted" help="-sMode,--solid_recal_mode &lt;solid_recal_mode&gt;"> + <option value="default" selected="True">Don't set</option> + <option value="DO_NOTHING">DO_NOTHING</option> + <option value="SET_Q_ZERO">SET_Q_ZERO</option> + <option value="SET_Q_ZERO_BASE_N">SET_Q_ZERO_BASE_N</option> + <option value="REMOVE_REF_BIAS">REMOVE_REF_BIAS</option> + </param> + <param name="solid_nocall_strategy" type="select" label="Behavior of the recalibrator when it encounters no calls" help="-solid_nocall_strategy,--solid_nocall_strategy &lt;solid_nocall_strategy&gt;"> + <option value="default" selected="True">Don't set</option> + <option value="THROW_EXCEPTION">THROW_EXCEPTION</option> + <option value="LEAVE_READ_UNRECALIBRATED">LEAVE_READ_UNRECALIBRATED</option> + <option value="PURGE_READ">PURGE_READ</option> + </param> + </when> + </conditional> + <param name="window_size_nqs" type="integer" value="5" label="Window size used by MinimumNQSCovariate" help="window_size_nqs"/> + <param name="homopolymer_nback" type="integer" value="7" label="number of previous bases to look at in HomopolymerCovariate" help="-nback,--homopolymer_nback &lt;homopolymer_nback&gt;" /> + </when> + </conditional> + </inputs> + <outputs> + <data format="gatk_report" name="output_recal" label="${tool.name} on ${on_string} (Covariate File)" /> + <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" /> + </outputs> + <tests> + <test> + <param name="reference_source_selector" value="history" /> + <param name="ref_file" value="phiX.fasta" ftype="fasta" /> + <param name="input_bam" value="gatk/gatk_indel_realigner/gatk_indel_realigner_out_1.bam" ftype="bam" /> + <param name="rod_bind_type_selector" value="dbsnp" /> + <param name="input_rod" value="gatk/fake_phiX_variant_locations.bed" ftype="bed" /> + <param name="standard_covs" value="True" /> + <param name="covariates" value="ReadGroupCovariate,HomopolymerCovariate,MinimumNQSCovariate,PositionCovariate" /> + <param name="gatk_param_type_selector" value="basic" /> + <param name="analysis_param_type_selector" value="basic" /> + <output name="output_recal" file="gatk/gatk_count_covariates/gatk_count_covariates_out_1.csv" /> + <output name="output_log" file="gatk/gatk_count_covariates/gatk_count_covariates_out_1.log.contains" compare="contains" /> + </test> + </tests> + <help> +.. class:: warningmark + +"This calculation is critically dependent on being able to skip over known variant sites. Please provide a dbSNP ROD or a VCF file containing known sites of genetic variation." +However, if you do not provide this file, the '--run_without_dbsnp_potentially_ruining_quality' flag will be automatically used, and the command will be allowed to run. + +**What it does** + +This walker is designed to work as the first pass in a two-pass processing step. It does a by-locus traversal operating only at sites that are not in dbSNP. We assume that all reference mismatches we see are therefore errors and indicative of poor base quality. This walker generates tables based on various user-specified covariates (such as read group, reported quality score, cycle, and dinucleotide) Since there is a large amount of data one can then calculate an empirical probability of error given the particular covariates seen at this site, where p(error) = num mismatches / num observations The output file is a CSV list of (the several covariate values, num observations, num mismatches, empirical quality score) The first non-comment line of the output file gives the name of the covariates that were used for this calculation. Note: ReadGroupCovariate and QualityScoreCovariate are required covariates and will be added for the user regardless of whether or not they were specified Note: This walker is designed to be used in conjunction with TableRecalibrationWalker. + +For more information on base quality score recalibration using the GATK, see this `tool specific page <http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_bqsr_BaseRecalibrator.html>`_. + +To learn about best practices for variant detection using GATK, see this `overview <http://www.broadinstitute.org/gatk/guide/topic?name=best-practices>`_. + +If you encounter errors, please view the `GATK FAQ <http://www.broadinstitute.org/gatk/guide/topic?name=faqs>`_. + +------ + +**Inputs** + +GenomeAnalysisTK: BaseRecalibrator accepts an aligned BAM input file. + + +**Outputs** + +The output is in CSV format. + + +Go `here <http://www.broadinstitute.org/gatk/guide/topic?name=intro>`_ for details on GATK file formats. + +------- + +**Settings**:: + + + default_read_group If a read has no read group then default to the provided String. + default_platform If a read has no platform then default to the provided String. Valid options are illumina, 454, and solid. + force_read_group If provided, the read group ID of EVERY read will be forced to be the provided String. This is useful to collapse all data into a single read group. + force_platform If provided, the platform of EVERY read will be forced to be the provided String. Valid options are illumina, 454, and solid. + window_size_nqs The window size used by MinimumNQSCovariate for its calculation + homopolymer_nback The number of previous bases to look at in HomopolymerCovariate + exception_if_no_tile If provided, TileCovariate will throw an exception when no tile can be found. The default behavior is to use tile = -1 + solid_recal_mode How should we recalibrate solid bases in whichthe reference was inserted? Options = DO_NOTHING, SET_Q_ZERO, SET_Q_ZERO_BASE_N, or REMOVE_REF_BIAS (DO_NOTHING|SET_Q_ZERO|SET_Q_ZERO_BASE_N|REMOVE_REF_BIAS) + solid_nocall_strategy Defines the behavior of the recalibrator when it encounters no calls in the color space. Options = THROW_EXCEPTION, LEAVE_READ_UNRECALIBRATED, or PURGE_READ (THROW_EXCEPTION|LEAVE_READ_UNRECALIBRATED|PURGE_READ) + recal_file Filename for the input covariates table recalibration .csv file + out The output CSV file + standard_covs Use the standard set of covariates in addition to the ones listed using the -cov argument + run_without_dbsnp_potentially_ruining_quality If specified, allows the recalibrator to be used without a dbsnp rod. Very unsafe and for expert users only. + +@CITATION_SECTION@ + </help> + <expand macro="citations" /> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/depth_of_coverage.xml Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,731 @@ +<tool id="gatk2_depth_of_coverage" name="Depth of Coverage" version="@VERSION@.1"> + <description>on BAM files</description> + <macros> + <import>gatk2_macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="version_command" /> + <command interpreter="python">gatk2_wrapper.py + ##--max_jvm_heap_fraction "1" + --stdout "${output_log}" + @BAM_INPUTS@ + -p ' + @JAR_PATH@ + -T "DepthOfCoverage" + \$GATK2_SITE_OPTIONS + + @THREADS@ + + #if $reference_source.reference_source_selector != "history": + -R "${reference_source.ref_file.fields.path}" + #end if + #if str( $input_calculate_coverage_over_genes ) != "None": + --calculateCoverageOverGenes "${input_calculate_coverage_over_genes}" + #end if + #if str( $partition_type ) != "None": + #for $pt in str( $partition_type ).split( ',' ): + --partitionType "${pt}" + #end for + #end if + --out "${output_per_locus_coverage}" + + #for $ct_group in $summary_coverage_threshold_group: + --summaryCoverageThreshold "${ct_group.summary_coverage_threshold}" + #end for + --outputFormat "${output_format}" + ' + + #include source=$standard_gatk_options# + ##start analysis specific options + #if $analysis_param_type.analysis_param_type_selector == "advanced": + -p ' + ${analysis_param_type.ignore_deletion_sites} + ${analysis_param_type.include_deletions} + --maxBaseQuality "${analysis_param_type.max_base_quality}" + --maxMappingQuality "${analysis_param_type.max_mapping_quality}" + --minBaseQuality "${analysis_param_type.min_base_quality}" + --minMappingQuality "${analysis_param_type.min_mapping_quality}" + --nBins "${analysis_param_type.n_bins}" + ${analysis_param_type.omit_depth_output_at_each_base} + ${analysis_param_type.omit_interval_statistics} + ${analysis_param_type.omit_locus_table} + ${analysis_param_type.omit_per_sample_stats} + ${analysis_param_type.print_base_counts} + ${analysis_param_type.print_bin_endpoints_and_exit} + --start "${analysis_param_type.start}" + --stop "${analysis_param_type.stop}" + ' + #end if + ##Move additional files to final location + #if str( $partition_type ) != "None": + #set $partition_types = str( $partition_type ).split( ',' ) + #else: + #set $partition_types = [ 'sample' ] + #end if + #if 'sample' in $partition_types and ( str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.print_bin_endpoints_and_exit ) == "" ): + #if str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_per_sample_stats ) == "": + && mv ${output_per_locus_coverage}.sample_summary ${output_summary_sample} + && mv ${output_per_locus_coverage}.sample_statistics ${output_statistics_sample} + #end if + #if $gatk_param_type.gatk_param_type_selector == "advanced" and len( $gatk_param_type.input_interval_repeat ) and ( str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_interval_statistics ) == "" ): + && mv ${output_per_locus_coverage}.sample_interval_summary ${output_interval_summary_sample} + && mv ${output_per_locus_coverage}.sample_interval_statistics ${output_interval_statistics_sample} + #end if + #if str( $input_calculate_coverage_over_genes ) != "None": + && mv ${output_per_locus_coverage}.sample_gene_summary ${output_gene_summary_sample} + && mv ${output_per_locus_coverage}.sample_gene_statistics ${output_gene_statistics_sample} + #end if + #if str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_depth_output_at_each_base ) == "": + && mv ${output_per_locus_coverage}.sample_cumulative_coverage_counts ${output_cumulative_coverage_counts_sample} + && mv ${output_per_locus_coverage}.sample_cumulative_coverage_proportions ${output_cumulative_coverage_proportions_sample} + #end if + #end if + + #if 'readgroup' in $partition_types and ( str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.print_bin_endpoints_and_exit ) == "" ): + #if str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_per_sample_stats ) == "": + && mv ${output_per_locus_coverage}.read_group_summary ${output_summary_readgroup} + && mv ${output_per_locus_coverage}.read_group_statistics ${output_statistics_readgroup} + #end if + #if $gatk_param_type.gatk_param_type_selector == "advanced" and len( $gatk_param_type.input_interval_repeat ) and ( str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_interval_statistics ) == "" ): + && mv ${output_per_locus_coverage}.read_group_interval_summary ${output_interval_summary_readgroup} + && mv ${output_per_locus_coverage}.read_group_interval_statistics ${output_interval_statistics_readgroup} + #end if + #if str( $input_calculate_coverage_over_genes ) != "None": + && mv ${output_per_locus_coverage}.read_group_gene_summary ${output_gene_summary_readgroup} + && mv ${output_per_locus_coverage}.read_group_gene_statistics ${output_gene_statistics_readgroup} + #end if + #if str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_depth_output_at_each_base ) == "": + && mv ${output_per_locus_coverage}.read_group_cumulative_coverage_counts ${output_cumulative_coverage_counts_readgroup} + && mv ${output_per_locus_coverage}.read_group_cumulative_coverage_proportions ${output_cumulative_coverage_proportions_readgroup} + #end if + #end if + + #if 'library' in $partition_types and ( str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.print_bin_endpoints_and_exit ) == "" ): + #if str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_per_sample_stats ) == "": + && mv ${output_per_locus_coverage}.library_summary ${output_summary_library} + && mv ${output_per_locus_coverage}.library_statistics ${output_statistics_library} + #end if + #if $gatk_param_type.gatk_param_type_selector == "advanced" and len( $gatk_param_type.input_interval_repeat ) and ( str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_interval_statistics ) == "" ): + && mv ${output_per_locus_coverage}.library_interval_summary ${output_interval_summary_library} + && mv ${output_per_locus_coverage}.library_interval_statistics ${output_interval_statistics_library} + #end if + #if str( $input_calculate_coverage_over_genes ) != "None": + && mv ${output_per_locus_coverage}.library_gene_summary ${output_gene_summary_library} + && mv ${output_per_locus_coverage}.library_gene_statistics ${output_gene_statistics_library} + #end if + #if str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_depth_output_at_each_base ) == "": + && mv ${output_per_locus_coverage}.library_cumulative_coverage_counts ${output_cumulative_coverage_counts_library} + && mv ${output_per_locus_coverage}.library_cumulative_coverage_proportions ${output_cumulative_coverage_proportions_library} + #end if + #end if + + </command> + <inputs> + <conditional name="reference_source"> + <expand macro="reference_source_selector_param" /> + <when value="cached"> + <expand macro="input_bams_cached" /> + <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &lt;reference_sequence&gt;"> + <options from_data_table="gatk2_picard_indexes"> + <!-- <filter type="data_meta" key="dbkey" ref="input_bam" column="dbkey"/> does not yet work in a repeat...--> + </options> + <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> + </param> + </when> + <when value="history"> <!-- FIX ME!!!! --> + + <expand macro="input_bams_history" /> + <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &lt;reference_sequence&gt;" /> + </when> + </conditional> + + <param name="input_calculate_coverage_over_genes" type="data" format="data" label="RefSeq Rod" optional="True" help="-geneList,--calculateCoverageOverGenes &lt;calculateCoverageOverGenes&gt;" /> + + <param name="partition_type" type="select" label="Partition type for depth of coverage" multiple="True" display="checkboxes" help="-pt,--partitionType &lt;partitionType&gt;"> + <option value="sample" selected="True">sample</option> + <option value="readgroup">readgroup</option> + <option value="library">library</option> + </param> + + <repeat name="summary_coverage_threshold_group" title="Summary coverage threshold" help="-ct,--summaryCoverageThreshold &lt;summaryCoverageThreshold&gt;"> + <param name="summary_coverage_threshold" type="integer" value="15" label="for summary file outputs, report the % of bases covered to >= this number" /> + </repeat> + + <param name="output_format" type="select" label="Output format" help="--outputFormat &lt;outputFormat&gt;" > + <option value="csv">csv</option> + <option value="table">table</option> + <option value="rtable" selected="True">rtable</option> + </param> + + <expand macro="gatk_param_type_conditional" /> + + <expand macro="analysis_type_conditional"> + <param name="ignore_deletion_sites" type="boolean" truevalue="--ignoreDeletionSites" falsevalue="" checked="False" label="Ignore sites consisting only of deletions" help="--ignoreDeletionSites" /> + <param name="include_deletions" type="boolean" truevalue="--includeDeletions" falsevalue="" checked="False" label="Include information on deletions" help="-dels,--includeDeletions" /> + <param name="max_base_quality" type="integer" value="127" label="Maximum quality of bases to count towards depth" help="--maxBaseQuality &lt;maxBaseQuality&gt;" /> + <param name="min_base_quality" type="integer" value="-1" label="Minimum quality of bases to count towards depth" help="-mbq,--minBaseQuality &lt;minBaseQuality&gt;" /> + <param name="max_mapping_quality" type="integer" value="2147483647" label="Maximum mapping quality of reads to count towards depth." help="--maxMappingQuality &lt;maxMappingQuality&gt;" /> + <param name="min_mapping_quality" type="integer" value="127" label="Minimum mapping quality of reads to count towards depth" help="-mmq,--minMappingQuality &lt;minMappingQuality&gt;" /> + <param name="n_bins" type="integer" value="499" label="Number of bins to use for granular binning" help="--nBins &lt;nBins&gt;" /> + <param name="omit_depth_output_at_each_base" type="boolean" truevalue="--omitDepthOutputAtEachBase" falsevalue="" checked="False" label="Omit the output of the depth of coverage at each base" help="-omitBaseOutput,--omitDepthOutputAtEachBase" /> + <param name="omit_interval_statistics" type="boolean" truevalue="--omitIntervalStatistics" falsevalue="" checked="False" label="Omit the per-interval statistics section" help="-omitIntervals,--omitIntervalStatistics" /> + <param name="omit_locus_table" type="boolean" truevalue="--omitLocusTable" falsevalue="" checked="False" label="Do not calculate the per-sample per-depth counts of loci" help="-omitLocusTable,--omitLocusTable" /> + <param name="omit_per_sample_stats" type="boolean" truevalue="--omitPerSampleStats" falsevalue="" checked="False" label="Omit the summary files per-sample." help="-omitSampleSummary,--omitPerSampleStats" /> + <param name="print_base_counts" type="boolean" truevalue="--printBaseCounts" falsevalue="" checked="False" label="Add base counts to per-locus output" help="-baseCounts,--printBaseCounts" /> + <param name="print_bin_endpoints_and_exit" type="boolean" truevalue="--printBinEndpointsAndExit" falsevalue="" checked="False" label="Print the bin values and exits immediately" help="--printBinEndpointsAndExit" /> + <param name="start" type="integer" value="1" label="Starting (left endpoint) for granular binning" help="--start &lt;start&gt;" /> + <param name="stop" type="integer" value="500" label="Ending (right endpoint) for granular binning" help="--stop &lt;stop&gt;" /> + </expand> + </inputs> + <outputs> + <data format="tabular" name="output_per_locus_coverage" label="${tool.name} on ${on_string} (per locus coverage)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_summary_sample" label="${tool.name} on ${on_string} (output summary sample)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_per_sample_stats'] == False</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'sample' in partition_type or not partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_statistics_sample" label="${tool.name} on ${on_string} (output statistics sample)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_per_sample_stats'] == False</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'sample' in partition_type or not partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_interval_summary_sample" label="${tool.name} on ${on_string} (output interval summary sample)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'sample' in partition_type or not partition_type</filter> + <filter>gatk_param_type['gatk_param_type_selector'] == "advanced" and len( gatk_param_type['input_interval_repeat'] )</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_interval_statistics'] == False</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_interval_statistics_sample" label="${tool.name} on ${on_string} (output interval statistics sample)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'sample' in partition_type or not partition_type</filter> + <filter>gatk_param_type['gatk_param_type_selector'] == "advanced" and len( gatk_param_type['input_interval_repeat'] )</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_interval_statistics'] == False</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_gene_summary_sample" label="${tool.name} on ${on_string} (output gene summary sample)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>input_calculate_coverage_over_genes is not None and 'sample' in partition_type or not partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_gene_statistics_sample" label="${tool.name} on ${on_string} (output gene statistics sample)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>input_calculate_coverage_over_genes is not None and 'sample' in partition_type or not partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_cumulative_coverage_counts_sample" label="${tool.name} on ${on_string} (output cumulative coverage counts sample)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_depth_output_at_each_base'] == False</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'sample' in partition_type or not partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_cumulative_coverage_proportions_sample" label="${tool.name} on ${on_string} (output cumulative coverage proportions sample)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_depth_output_at_each_base'] == False</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'sample' in partition_type or not partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + + <data format="tabular" name="output_summary_readgroup" label="${tool.name} on ${on_string} (output summary readgroup)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_per_sample_stats'] == False</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'readgroup' in partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_statistics_readgroup" label="${tool.name} on ${on_string} (output statistics readgroup)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_per_sample_stats'] == False</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'readgroup' in partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_interval_summary_readgroup" label="${tool.name} on ${on_string} (output interval summary readgroup)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'readgroup' in partition_type</filter> + <filter>gatk_param_type['gatk_param_type_selector'] == "advanced" and len( gatk_param_type['input_interval_repeat'] )</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_interval_statistics'] == False</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_interval_statistics_readgroup" label="${tool.name} on ${on_string} (output interval statistics readgroup)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'readgroup' in partition_type</filter> + <filter>gatk_param_type['gatk_param_type_selector'] == "advanced" and len( gatk_param_type['input_interval_repeat'] )</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_interval_statistics'] == False</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_gene_summary_readgroup" label="${tool.name} on ${on_string} (output gene summary readgroup)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>input_calculate_coverage_over_genes is not None and 'readgroup' in partition_type or not partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_gene_statistics_readgroup" label="${tool.name} on ${on_string} (output gene statistics readgroup)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>input_calculate_coverage_over_genes is not None and 'readgroup' in partition_type or not partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_cumulative_coverage_counts_readgroup" label="${tool.name} on ${on_string} (output cumulative coverage counts readgroup)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_depth_output_at_each_base'] == False</filter> + <filter>'readgroup' in partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_cumulative_coverage_proportions_readgroup" label="${tool.name} on ${on_string} (output cumulative coverage proportions readgroup)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_depth_output_at_each_base'] == False</filter> + <filter>'readgroup' in partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + + <data format="tabular" name="output_summary_library" label="${tool.name} on ${on_string} (output summary library)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_per_sample_stats'] == False</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'library' in partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_statistics_library" label="${tool.name} on ${on_string} (output statistics library)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_per_sample_stats'] == False</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'library' in partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_interval_summary_library" label="${tool.name} on ${on_string} (output interval summary library)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'library' in partition_type</filter> + <filter>gatk_param_type['gatk_param_type_selector'] == "advanced" and len( gatk_param_type['input_interval_repeat'] )</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_interval_statistics'] == False</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_interval_statistics_library" label="${tool.name} on ${on_string} (output interval statistics library)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'library' in partition_type</filter> + <filter>gatk_param_type['gatk_param_type_selector'] == "advanced" and len( gatk_param_type['input_interval_repeat'] )</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_interval_statistics'] == False</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_gene_summary_library" label="${tool.name} on ${on_string} (output gene summary library)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>input_calculate_coverage_over_genes is not None and 'library' in partition_type or not partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_gene_statistics_library" label="${tool.name} on ${on_string} (output gene statistics library)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>input_calculate_coverage_over_genes is not None and 'library' in partition_type or not partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_cumulative_coverage_counts_library" label="${tool.name} on ${on_string} (output cumulative coverage counts library)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_depth_output_at_each_base'] == False</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'library' in partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_cumulative_coverage_proportions_library" label="${tool.name} on ${on_string} (output cumulative coverage proportions library)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_depth_output_at_each_base'] == False</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'library' in partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + + <data format="tabular" name="output_log" label="${tool.name} on ${on_string} (log)" /> + </outputs> + <trackster_conf/> + <tests> + <test> + <param name="reference_source_selector" value="history" /> + <param name="ref_file" value="phiX.fasta" ftype="fasta" /> + <param name="input_bam" value="gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.bam" ftype="bam" /> + <param name="input_calculate_coverage_over_genes" /> + <param name="partition_type" value="sample" /> + <param name="summary_coverage_threshold_group" value="0" /> + <param name="output_format" value="rtable" /> + <param name="gatk_param_type_selector" value="basic" /> + <param name="analysis_param_type_selector" value="basic" /> + <output name="output_per_locus_coverage" file="gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_per_locus_coverage.tabular" /> + <output name="output_summary_sample" file="gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_summary_sample.tabular" /> + <output name="output_statistics_sample" file="gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_statistics_sample.tabular" /> + <output name="output_cumulative_coverage_counts_sample" file="gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_cumulative_coverage_counts_sample.tabular" /> + <output name="output_cumulative_coverage_proportions_sample" file="gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_output_cumulative_coverage_proportions_sample.tabular" /> + <output name="output_log" file="gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1.log.contains" compare="contains" /> + </test> + </tests> + <help> +**What it does** + +DepthOfCoverage processes a set of bam files to determine coverage at different levels of partitioning and aggregation. Coverage can be analyzed per locus, per interval, per gene, or in total; can be partitioned by sample, by read group, by technology, by center, or by library; and can be summarized by mean, median, quartiles, and/or percentage of bases covered to or beyond a threshold. Additionally, reads and bases can be filtered by mapping or base quality score. + +For more information on the GATK Depth of Coverage, see this `tool specific page <http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_coverage_DepthOfCoverage.html>`_. + +To learn about best practices for variant detection using GATK, see this `overview <http://www.broadinstitute.org/gatk/guide/topic?name=best-practices>`_. + +If you encounter errors, please view the `GATK FAQ <http://www.broadinstitute.org/gatk/guide/topic?name=faqs>`_. + +------ + +**Inputs** + +GenomeAnalysisTK: DepthOfCoverage accepts aligned BAM input files. + + +**Outputs** + +The output is in various table formats. + + +Go `here <http://www.broadinstitute.org/gatk/guide/topic?name=intro>`_ for details on GATK file formats. + +------- + +**Settings**:: + + calculateCoverageOverGenes File NA Calculate the coverage statistics over this list of genes. Currently accepts RefSeq. + ignoreDeletionSites boolean false Ignore sites consisting only of deletions + includeDeletions boolean false Include information on deletions + maxBaseQuality byte 127 Maximum quality of bases to count towards depth. Defaults to 127 (Byte.MAX_VALUE). + maxMappingQuality int 2147483647 Maximum mapping quality of reads to count towards depth. Defaults to 2^31-1 (Integer.MAX_VALUE). + minBaseQuality byte -1 Minimum quality of bases to count towards depth. Defaults to -1. + minMappingQuality int -1 Minimum mapping quality of reads to count towards depth. Defaults to -1. + nBins int 499 Number of bins to use for granular binning + omitDepthOutputAtEachBase boolean false Will omit the output of the depth of coverage at each base, which should result in speedup + omitIntervalStatistics boolean false Will omit the per-interval statistics section, which should result in speedup + omitLocusTable boolean false Will not calculate the per-sample per-depth counts of loci, which should result in speedup + omitPerSampleStats boolean false Omits the summary files per-sample. These statistics are still calculated, so this argument will not improve runtime. + outputFormat String rtable the format of the output file (e.g. csv, table, rtable); defaults to r-readable table + partitionType Set[Partition] [sample] Partition type for depth of coverage. Defaults to sample. Can be any combination of sample, readgroup, library. + printBaseCounts boolean false Will add base counts to per-locus output. + printBinEndpointsAndExit boolean false Prints the bin values and exits immediately. Use to calibrate what bins you want before running on data. + start int 1 Starting (left endpoint) for granular binning + stop int 500 Ending (right endpoint) for granular binning + summaryCoverageThreshold int[] [15] for summary file outputs, report the % of bases coverd to >= this number. Defaults to 15; can take multiple arguments. + +@CITATION_SECTION@ + </help> + <expand macro="citations" /> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gatk2_annotations.txt.sample Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,26 @@ +#unique_id name gatk_value tools_valid_for +AlleleBalance AlleleBalance AlleleBalance UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller +AlleleBalanceBySample AlleleBalanceBySample AlleleBalanceBySample UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller +BaseCounts BaseCounts BaseCounts UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller +BaseQualityRankSumTest BaseQualityRankSumTest BaseQualityRankSumTest UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller +ChromosomeCounts ChromosomeCounts ChromosomeCounts UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller +Coverage Coverage Coverage UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller +DepthPerAlleleBySample DepthPerAlleleBySample DepthPerAlleleBySample UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller +FisherStrand FisherStrand FisherStrand UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller +GCContent GCContent GCContent UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller +HaplotypeScore HaplotypeScore HaplotypeScore UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller +HardyWeinberg HardyWeinberg HardyWeinberg UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller +HomopolymerRun HomopolymerRun HomopolymerRun UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller +InbreedingCoeff InbreedingCoeff InbreedingCoeff UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller +LowMQ LowMQ LowMQ UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller +MVLikelihoodRatio MVLikelihoodRatio MVLikelihoodRatio VariantAnnotator,VariantRecalibrator,HaplotypeCaller +MappingQualityRankSumTest MappingQualityRankSumTest MappingQualityRankSumTest UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller +MappingQualityZero MappingQualityZero MappingQualityZero UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller +MappingQualityZeroBySample MappingQualityZeroBySample MappingQualityZeroBySample UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller +NBaseCount NBaseCount NBaseCount UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller +QualByDepth QualByDepth QualByDepth UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller +RMSMappingQuality RMSMappingQuality RMSMappingQuality UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller +ReadPosRankSumTest ReadPosRankSumTest ReadPosRankSumTest UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller +SampleList SampleList SampleList UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller +SnpEff SnpEff SnpEff VariantAnnotator,VariantRecalibrator,HaplotypeCaller +SpanningDeletions SpanningDeletions SpanningDeletions UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gatk2_macros.xml Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,379 @@ +<macros> + <xml name="requirements"> + <requirements> + <requirement type="package">gatk2</requirement> + <requirement type="package" version="0.1.19">samtools</requirement> + <requirement type="package" version="1.56.0">picard</requirement> + <requirement type="set_environment">GATK2_PATH</requirement> + <requirement type="set_environment">GATK2_SITE_OPTIONS</requirement> + <yield /> + </requirements> + </xml> + <xml name="version_command"> + <version_command>java -jar "$GATK2_PATH/GenomeAnalysisTK.jar" --help|grep '^The Genome'</version_command> + </xml> + <token name="@THREADS@"> + --num_threads \${GALAXY_SLOTS:-4} + </token> + <token name="@VERSION@">2.8</token> + <token name="@JAR_PATH@"> + java -jar "\$GATK2_PATH/GenomeAnalysisTK.jar" + </token> + <token name="@DBSNP_OPTIONS@"> + #if $dbsnp_rod_bind_type.dbsnp_rod_bind_type_selector == 'set_dbsnp' + -d "--dbsnp:${dbsnp_rod_bind_type.dbsnp_rod_name},%(file_type)s" "${dbsnp_rod_bind_type.dbsnp_input_rod}" "${dbsnp_rod_bind_type.dbsnp_input_rod.ext}" "input_dbsnp_${dbsnp_rod_bind_type.dbsnp_rod_name}" + #end if + </token> + <token name="@BAM_INPUTS@"> + #for $i, $input_bam in enumerate( $reference_source.input_bams ): + -d "-I" "${input_bam}" "${input_bam.ext}" "gatk_input_${i}" + #if str( $input_bam.metadata.bam_index ) != "None": + -d "" "${input_bam.metadata.bam_index}" "bam_index" "gatk_input_${i}" ##hardcode galaxy ext type as bam_index + #end if + #end for + </token> + <xml name="input_variants" token_help="-input,--input &lt;input&gt;"> + <param name="input_variants" type="data" format="vcf" label="Variant file to annotate" multiple="True" min="1" help="@HELP@"/> + </xml> + <xml name="input_bams_history"> + <param name="input_bams" type="data" format="bam" label="BAM file" multiple="True" min="1" help="-I,--input_file &lt;input_file&gt;"/> + </xml> + <xml name="input_bams_cached"> + <param name="input_bams" type="data" format="bam" label="BAM file" multiple="True" min="1" help="-I,--input_file &lt;input_file&gt;"> + <validator type="unspecified_build" /> + <validator type="dataset_metadata_in_data_table" table_name="gatk2_picard_indexes" metadata_name="dbkey" metadata_column="dbkey" message="Sequences are not currently available for the specified build." /> <!-- fixme!!! this needs to be a select --> + </param> + </xml> + <template name="standard_gatk_options"> + ##start standard gatk options + #if $gatk_param_type.gatk_param_type_selector == "advanced": + #for $pedigree in $gatk_param_type.pedigree_files: + -p '--pedigree "${pedigree}"' + #end for + #for $pedigree_string in $gatk_param_type.pedigree_string_repeat: + -p '--pedigreeString "${pedigree_string.pedigree_string}"' + #end for + -p '--pedigreeValidationType "${gatk_param_type.pedigree_validation_type}"' + #set default_read_filters = ['MalformedRead'] + #for $read_filter in $gatk_param_type.read_filter: + -p ' + #if $read_filter.read_filter_type.read_filter_type_selector not in $default_read_filters: + --read_filter "${read_filter.read_filter_type.read_filter_type_selector}" + #end if + #for $name, $param in $read_filter.read_filter_type.iteritems(): + #if $name not in [ "__current_case__", "read_filter_type_selector" ]: + #if hasattr( $param.input, 'truevalue' ): + ${param} + #else: + --${name} "${param}" + #end if + #end if + #end for + ' + #end for + #for $interval_count, $input_interval in enumerate( $gatk_param_type.input_intervals ): + -d "--intervals" "${input_interval}" "${input_interval.ext}" "input_intervals_${interval_count}" + #end for + + #for $interval_count, $input_interval in enumerate( $gatk_param_type.input_exclude_intervals ): + -d "--excludeIntervals" "${input_interval}" "${input_interval.ext}" "input_exlude_intervals_${interval_count}" + #end for + + -p '--interval_set_rule "${gatk_param_type.interval_set_rule}"' + -p '--interval_padding "${gatk_param_type.interval_padding}"' + -p '--downsampling_type "${gatk_param_type.downsampling_type.downsampling_type_selector}"' + #if str( $gatk_param_type.downsampling_type.downsampling_type_selector ) != "NONE": + -p '--${gatk_param_type.downsampling_type.downsample_to_type.downsample_to_type_selector} "${gatk_param_type.downsampling_type.downsample_to_type.downsample_to_value}"' + #end if + -p ' + --baq "${gatk_param_type.baq}" + --baqGapOpenPenalty "${gatk_param_type.baq_gap_open_penalty}" + ${gatk_param_type.use_original_qualities} + --defaultBaseQualities "${gatk_param_type.default_base_qualities}" + --validation_strictness "${gatk_param_type.validation_strictness}" + --interval_merging "${gatk_param_type.interval_merging}" + ${gatk_param_type.disable_experimental_low_memory_sharding} + ${gatk_param_type.fix_misencoded_quality_scores} + ${gatk_param_type.non_deterministic_random_seed} + ' + #for $rg_black_list_count, $rg_black_list in enumerate( $gatk_param_type.read_group_black_list_repeat ): + #if $rg_black_list.read_group_black_list_type.read_group_black_list_type_selector == "file": + -d "--read_group_black_list" "${rg_black_list.read_group_black_list_type.read_group_black_list}" "txt" "input_read_group_black_list_${rg_black_list_count}" + #else + -p '--read_group_black_list "${rg_black_list.read_group_black_list_type.read_group_black_list}"' + #end if + #end for + #end if + + #if str( $reference_source.reference_source_selector ) == "history": + -d "-R" "${reference_source.ref_file}" "${reference_source.ref_file.ext}" "gatk_input" + #end if + ##end standard gatk options + </template> + <xml name="gatk_param_type_conditional"> + <conditional name="gatk_param_type"> + <param name="gatk_param_type_selector" type="select" label="Basic or Advanced GATK options"> + <option value="basic" selected="True">Basic</option> + <option value="advanced">Advanced</option> + </param> + <when value="basic"> + <!-- Do nothing here --> + </when> + <when value="advanced"> + <param name="pedigree_files" type="data" format="txt" label="Pedigree files for samples" multiple="True" help="-ped,--pedigree &lt;pedigree&gt;"/> + <repeat name="pedigree_string_repeat" title="Pedigree string" help="-pedString,--pedigreeString &lt;pedigreeString&gt;"> + <param name="pedigree_string" type="text" value="" label="Pedigree string for samples"/> + </repeat> + <param name="pedigree_validation_type" type="select" label="How strict should we be in validating the pedigree information" help="-pedValidationType,--pedigreeValidationType &lt;pedigreeValidationType&gt;"> + <option value="STRICT" selected="True">STRICT</option> + <option value="SILENT">SILENT</option> + </param> + <repeat name="read_filter" title="Read Filter" help="-rf,--read_filter &lt;read_filter&gt;"> + <conditional name="read_filter_type"> + <param name="read_filter_type_selector" type="select" label="Read Filter Type"> + <option value="BadCigar">BadCigar</option> + <option value="BadMate">BadMate</option> + <option value="DuplicateRead">DuplicateRead</option> + <option value="FailsVendorQualityCheck">FailsVendorQualityCheck</option> + <option value="MalformedRead">MalformedRead</option> + <option value="MappingQuality">MappingQuality</option> + <option value="MappingQualityUnavailable">MappingQualityUnavailable</option> + <option value="MappingQualityZero">MappingQualityZero</option> + <option value="MateSameStrand">MateSameStrand</option> + <option value="MaxInsertSize">MaxInsertSize</option> + <option value="MaxReadLength" selected="True">MaxReadLength</option> + <option value="MissingReadGroup">MissingReadGroup</option> + <option value="NoOriginalQualityScores">NoOriginalQualityScores</option> + <option value="NotPrimaryAlignment">NotPrimaryAlignment</option> + <option value="Platform454">Platform454</option> + <option value="Platform">Platform</option> + <option value="PlatformUnit">PlatformUnit</option> + <option value="ReadGroupBlackList">ReadGroupBlackList</option> + <option value="ReadName">ReadName</option> + <option value="ReadStrand">ReadStrand</option> + <option value="ReassignMappingQuality">ReassignMappingQuality</option> + <option value="Sample">Sample</option> + <option value="SingleReadGroup">SingleReadGroup</option> + <option value="UnmappedRead">UnmappedRead</option> + </param> + <when value="BadCigar"> + <!-- no extra options --> + </when> + <when value="BadMate"> + <!-- no extra options --> + </when> + <when value="DuplicateRead"> + <!-- no extra options --> + </when> + <when value="FailsVendorQualityCheck"> + <!-- no extra options --> + </when> + <when value="MalformedRead"> + <param name="filter_mismatching_base_and_quals" type="boolean" truevalue="--filter_mismatching_base_and_quals" falsevalue="" checked="false" label="filter out the reads with mismatching number of bases and base qualities" help="filter out the mismatch reads instead of quitting with an error"/> + </when> + <when value="MappingQuality"> + <param name="min_mapping_quality_score" type="integer" value="10" label="Minimum read mapping quality required to consider a read for calling"/> + </when> + <when value="MappingQualityUnavailable"> + <!-- no extra options --> + </when> + <when value="MappingQualityZero"> + <!-- no extra options --> + </when> + <when value="MateSameStrand"> + <!-- no extra options --> + </when> + <when value="MaxInsertSize"> + <param name="maxInsertSize" type="integer" value="1000000" label="Discard reads with insert size greater than the specified value"/> + </when> + <when value="MaxReadLength"> + <param name="maxReadLength" type="integer" value="76" label="Max Read Length"/> + </when> + <when value="MissingReadGroup"> + <!-- no extra options --> + </when> + <when value="NoOriginalQualityScores"> + <!-- no extra options --> + </when> + <when value="NotPrimaryAlignment"> + <!-- no extra options --> + </when> + <when value="Platform454"> + <!-- no extra options --> + </when> + <when value="Platform"> + <param name="PLFilterName" type="text" value="" label="Discard reads with RG:PL attribute containing this string"/> + </when> + <when value="PlatformUnit"> + <!-- no extra options --> + </when> + <when value="ReadGroupBlackList"> + <!-- no extra options --> + </when> + <when value="ReadName"> + <param name="readName" type="text" value="" label="Filter out all reads except those with this read name"/> + </when> + <when value="ReadStrand"> + <param name="filterPositive" type="boolean" truevalue="--filterPositive" falsevalue="" label="Discard reads on the forward strand"/> + </when> + <when value="ReassignMappingQuality"> + <param name="default_mapping_quality" type="integer" value="60" label="Default read mapping quality to assign to all reads"/> + </when> + <when value="Sample"> + <param name="sample_to_keep" type="text" value="" label="The name of the sample(s) to keep, filtering out all others"/> + </when> + <when value="SingleReadGroup"> + <param name="read_group_to_keep" type="integer" value="76" label="The name of the read group to keep, filtering out all others"/> + </when> + <when value="UnmappedRead"> + <!-- no extra options --> + </when> + </conditional> + </repeat> + <param name="input_intervals" multiple="True" type="data" format="bed,gatk_interval,picard_interval_list,vcf" label="Operate on Genomic intervals" help="-L,--intervals &lt;intervals&gt;" /> + <param name="input_exclude_intervals" multiple="True" type="data" format="bed,gatk_interval,picard_interval_list,vcf" label="Exclude Genomic intervals" help="-XL,--excludeIntervals &lt;excludeIntervals&gt;" /> + + <param name="interval_set_rule" type="select" label="Interval set rule" help="-isr,--interval_set_rule &lt;interval_set_rule&gt;"> + <option value="UNION" selected="True">UNION</option> + <option value="INTERSECTION">INTERSECTION</option> + </param> + <param name="interval_padding" type="integer" value="0" min="0" label="Amount of padding (in bp) to add to each interval" + help="This is typically used to add padding around exons when analyzing exomes. (--interval_padding / -ip)"/> + + <conditional name="downsampling_type"> + <param name="downsampling_type_selector" type="select" label="Type of reads downsampling to employ at a given locus" help="-dt,--downsampling_type &lt;downsampling_type&gt;"> + <option value="NONE" selected="True">NONE</option> + <option value="ALL_READS">ALL_READS</option> + <option value="BY_SAMPLE">BY_SAMPLE</option> + </param> + <when value="NONE"> + <!-- no more options here --> + </when> + <when value="ALL_READS"> + <conditional name="downsample_to_type"> + <param name="downsample_to_type_selector" type="select" label="Downsample method"> + <option value="downsample_to_fraction" selected="True">Downsample by Fraction</option> + <option value="downsample_to_coverage">Downsample by Coverage</option> + </param> + <when value="downsample_to_fraction"> + <param name="downsample_to_value" type="float" label="Fraction [0.0-1.0] of reads to downsample to" value="1" min="0" max="1" help="-dfrac,--downsample_to_fraction &lt;downsample_to_fraction&gt;"/> + </when> + <when value="downsample_to_coverage"> + <param name="downsample_to_value" type="integer" label="Coverage to downsample to at any given locus" value="0" help="-dcov,--downsample_to_coverage &lt;downsample_to_coverage&gt;"/> + </when> + </conditional> + </when> + <when value="BY_SAMPLE"> + <conditional name="downsample_to_type"> + <param name="downsample_to_type_selector" type="select" label="Downsample method"> + <option value="downsample_to_fraction" selected="True">Downsample by Fraction</option> + <option value="downsample_to_coverage">Downsample by Coverage</option> + </param> + <when value="downsample_to_fraction"> + <param name="downsample_to_value" type="float" label="Fraction [0.0-1.0] of reads to downsample to" value="1" min="0" max="1" help="-dfrac,--downsample_to_fraction &lt;downsample_to_fraction&gt;"/> + </when> + <when value="downsample_to_coverage"> + <param name="downsample_to_value" type="integer" label="Coverage to downsample to at any given locus" value="0" help="-dcov,--downsample_to_coverage &lt;downsample_to_coverage&gt;"/> + </when> + </conditional> + </when> + </conditional> + <param name="baq" type="select" label="Type of BAQ calculation to apply in the engine" help="-baq,--baq &lt;baq&gt;"> + <option value="OFF" selected="True">OFF</option> + <option value="CALCULATE_AS_NECESSARY">CALCULATE_AS_NECESSARY</option> + <option value="RECALCULATE">RECALCULATE</option> + </param> + <param name="baq_gap_open_penalty" type="float" label="BAQ gap open penalty (Phred Scaled)" value="40" help="Default value is 40. 30 is perhaps better for whole genome call sets. -baqGOP,--baqGapOpenPenalty &lt;baqGapOpenPenalty&gt;" /> + <param name="use_original_qualities" type="boolean" truevalue="--useOriginalQualities" falsevalue="" label="Use the original base quality scores from the OQ tag" help="-OQ,--useOriginalQualities" /> + <param name="default_base_qualities" type="integer" label="Value to be used for all base quality scores, when some are missing" value="-1" help="-DBQ,--defaultBaseQualities &lt;defaultBaseQualities&gt;"/> + <param name="validation_strictness" type="select" label="How strict should we be with validation" help="-S,--validation_strictness &lt;validation_strictness&gt;"> + <option value="STRICT" selected="True">STRICT</option> + <option value="LENIENT">LENIENT</option> + <option value="SILENT">SILENT</option> + <!-- <option value="DEFAULT_STRINGENCY">DEFAULT_STRINGENCY</option> listed in docs, but not valid value...--> + </param> + <param name="interval_merging" type="select" label="Interval merging rule" help="-im,--interval_merging &lt;interval_merging&gt;"> + <option value="ALL" selected="True">ALL</option> + <option value="OVERLAPPING_ONLY">OVERLAPPING_ONLY</option> + </param> + + <repeat name="read_group_black_list_repeat" title="Read group black list" help="-rgbl,--read_group_black_list &lt;read_group_black_list&gt;"> + <conditional name="read_group_black_list_type"> + <param name="read_group_black_list_type_selector" type="select" label="Type of reads read group black list"> + <option value="file" selected="True">Filters in file</option> + <option value="text">Specify filters as a string</option> + </param> + <when value="file"> + <param name="read_group_black_list" type="data" format="txt" label="Read group black list file" /> + </when> + <when value="text"> + <param name="read_group_black_list" type="text" value="tag:string" label="Read group black list tag:string" /> + </when> + </conditional> + </repeat> + + <param name="disable_experimental_low_memory_sharding" type="boolean" truevalue="--disable_experimental_low_memory_sharding" falsevalue="" label="Disable experimental low-memory sharding functionality." checked="False" help="--disable_experimental_low_memory_sharding"/> + <param name="non_deterministic_random_seed" type="boolean" truevalue="--nonDeterministicRandomSeed" falsevalue="" label="Makes the GATK behave non deterministically, that is, the random numbers generated will be different in every run" checked="False" help="-ndrs,--nonDeterministicRandomSeed"/> + <param name="fix_misencoded_quality_scores" type="boolean" truevalue="--fix_misencoded_quality_scores" falsevalue="" label="Fix mis-encoded base quality scores. Q0 == ASCII 33 according to the SAM specification, whereas Illumina encoding starts at Q64. The idea here is simple: we just iterate over all reads and subtract 31 from every quality score." checked="False" help="-fixMisencodedQuals / --fix_misencoded_quality_scores"/> + + </when> + </conditional> + </xml> + <xml name="analysis_type_conditional"> + <conditional name="analysis_param_type"> + <param name="analysis_param_type_selector" type="select" label="Basic or Advanced Analysis options"> + <option value="basic" selected="True">Basic</option> + <option value="advanced">Advanced</option> + </param> + <when value="basic"> + <!-- Do nothing here --> + </when> + <when value="advanced"> + <yield /> + </when> + </conditional> + </xml> + <xml name="reference_source_selector_param"> + <param name="reference_source_selector" type="select" label="Choose the source for the reference list"> + <option value="cached">Locally cached</option> + <option value="history">History</option> + </param> + </xml> + + <xml name="allow_n_cigar_reads"> + <param name="allow_n_cigar_reads" type="boolean" truevalue="-U ALLOW_N_CIGAR_READS" falsevalue="" + label="Allow N in CIGAR strings" help="This is required for RNA-seq data. (-U ALLOW_N_CIGAR_READS)" /> + </xml> + + <xml name="dbsnp_param"> + <conditional name="dbsnp_rod_bind_type"> + <param name="dbsnp_rod_bind_type_selector" type="select" label="Provide a dbSNP Reference-Ordered Data (ROD) file" help="-D,--dbsnp &lt;dbsnp&gt;"> + <option value="set_dbsnp" selected="True">Set dbSNP</option> + <option value="exclude_dbsnp">Don't set dbSNP</option> + </param> + <when value="exclude_dbsnp" /> + <when value="set_dbsnp"> + <param name="dbsnp_input_rod" type="data" format="vcf" label="dbSNP ROD file" /> + <param name="dbsnp_rod_name" type="text" value="dbsnp" label="dbsnp ROD name"> + <validator type="regex" message="Value must be a not empty string composed by alphanumeric characters and underscores">^\w+$</validator> + </param> + </when> + </conditional> + </xml> + <token name="@CITATION_SECTION@">------ + +**Citation** + +For the underlying tool, please cite `DePristo MA, Banks E, Poplin R, Garimella KV, Maguire JR, Hartl C, Philippakis AA, del Angel G, Rivas MA, Hanna M, McKenna A, Fennell TJ, Kernytsky AM, Sivachenko AY, Cibulskis K, Gabriel SB, Altshuler D, Daly MJ. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat Genet. 2011 May;43(5):491-8. <http://www.ncbi.nlm.nih.gov/pubmed/21478889>`_ + +If you use this tool in Galaxy, please cite Blankenberg D, et al. *In preparation.* + + </token> + <xml name="citations"> + <citations> + <citation type="doi">10.1038/ng.806</citation> + <citation type="doi">10.1101/gr.107524.110</citation> + <citation type="doi">10.1002/0471250953.bi1110s43</citation> + </citations> + </xml> +</macros>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gatk2_picard_index.loc.sample Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,26 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of Picard dict and associated files. You will need +#to create these data files and then create a picard_index.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The picard_index.loc +#file has this format (longer white space is the TAB character): +# +#<unique_build_id> <dbkey> <display_name> <fasta_file_path> +# +#So, for example, if you had hg18 indexed and stored in +#/depot/data2/galaxy/srma/hg18/, +#then the srma_index.loc entry would look like this: +# +#hg18 hg18 hg18 Pretty /depot/data2/galaxy/picard/hg18/hg18.fa +# +#and your /depot/data2/galaxy/srma/hg18/ directory +#would contain the following three files: +#hg18.fa +#hg18.dict +#hg18.fa.fai +# +#The dictionary file for each reference (ex. hg18.dict) must be +#created via Picard (http://picard.sourceforge.net). Note that +#the dict file does not have the .fa extension although the +#path list in the loc file does include it. +#
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gatk2_wrapper.py Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,143 @@ +#!/usr/bin/env python +# David Hoover, based on gatk by Dan Blankenberg +""" +A wrapper script for running the GenomeAnalysisTK.jar commands. +""" + +import optparse +import os +import shutil +import subprocess +import sys +import tempfile +from binascii import unhexlify + +GALAXY_EXT_TO_GATK_EXT = { 'gatk_interval': 'intervals', 'bam_index': 'bam.bai', 'gatk_dbsnp': 'dbSNP', 'picard_interval_list': 'interval_list' } # items not listed here will use the galaxy extension as-is +GALAXY_EXT_TO_GATK_FILE_TYPE = GALAXY_EXT_TO_GATK_EXT # for now, these are the same, but could be different if needed +DEFAULT_GATK_PREFIX = "gatk_file" +CHUNK_SIZE = 2**20 # 1mb + + +def cleanup_before_exit( tmp_dir ): + if tmp_dir and os.path.exists( tmp_dir ): + shutil.rmtree( tmp_dir ) + + +def gatk_filename_from_galaxy( galaxy_filename, galaxy_ext, target_dir=None, prefix=None ): + suffix = GALAXY_EXT_TO_GATK_EXT.get( galaxy_ext, galaxy_ext ) + if prefix is None: + prefix = DEFAULT_GATK_PREFIX + if target_dir is None: + target_dir = os.getcwd() + gatk_filename = os.path.join( target_dir, "%s.%s" % ( prefix, suffix ) ) + os.symlink( galaxy_filename, gatk_filename ) + return gatk_filename + + +def gatk_filetype_argument_substitution( argument, galaxy_ext ): + return argument % dict( file_type=GALAXY_EXT_TO_GATK_FILE_TYPE.get( galaxy_ext, galaxy_ext ) ) + + +def open_file_from_option( filename, mode='rb' ): + if filename: + return open( filename, mode=mode ) + return None + + +def html_report_from_directory( html_out, dir ): + html_out.write( '<html>\n<head>\n<title>Galaxy - GATK Output</title>\n</head>\n<body>\n<p/>\n<ul>\n' ) + for fname in sorted( os.listdir( dir ) ): + html_out.write( '<li><a href="%s">%s</a></li>\n' % ( fname, fname ) ) + html_out.write( '</ul>\n</body>\n</html>\n' ) + + +def index_bam_files( bam_filenames ): + for bam_filename in bam_filenames: + bam_index_filename = "%s.bai" % bam_filename + if not os.path.exists( bam_index_filename ): + # need to index this bam file + stderr_name = tempfile.NamedTemporaryFile( prefix="bam_index_stderr" ).name + command = 'samtools index %s %s' % ( bam_filename, bam_index_filename ) + try: + subprocess.check_call( args=command, shell=True, stderr=open( stderr_name, 'wb' ) ) + except: + for line in open( stderr_name ): + print >> sys.stderr, line + raise Exception( "Error indexing BAM file" ) + finally: + os.unlink( stderr_name ) + + +def __main__(): + # Parse Command Line + parser = optparse.OptionParser() + parser.add_option( '-p', '--pass_through', dest='pass_through_options', action='append', type="string", help='These options are passed through directly to GATK, without any modification.' ) + parser.add_option( '-o', '--pass_through_options', dest='pass_through_options_encoded', action='append', type="string", help='These options are passed through directly to GATK, with decoding from binascii.unhexlify.' ) + parser.add_option( '-d', '--dataset', dest='datasets', action='append', type="string", nargs=4, help='"-argument" "original_filename" "galaxy_filetype" "name_prefix"' ) + parser.add_option( '', '--max_jvm_heap', dest='max_jvm_heap', action='store', type="string", default=None, help='If specified, the maximum java virtual machine heap size will be set to the provide value.' ) + parser.add_option( '', '--max_jvm_heap_fraction', dest='max_jvm_heap_fraction', action='store', type="int", default=None, help='If specified, the maximum java virtual machine heap size will be set to the provide value as a fraction of total physical memory.' ) + parser.add_option( '', '--stdout', dest='stdout', action='store', type="string", default=None, help='If specified, the output of stdout will be written to this file.' ) + parser.add_option( '', '--stderr', dest='stderr', action='store', type="string", default=None, help='If specified, the output of stderr will be written to this file.' ) + parser.add_option( '', '--html_report_from_directory', dest='html_report_from_directory', action='append', type="string", nargs=2, help='"Target HTML File" "Directory"') + parser.add_option( '-e', '--phone_home', dest='phone_home', action='store', type="string", default='STANDARD', help='What kind of GATK run report should we generate(NO_ET|STANDARD|STDOUT)' ) + parser.add_option( '-K', '--gatk_key', dest='gatk_key', action='store', type="string", default=None, help='What kind of GATK run report should we generate(NO_ET|STANDARD|STDOUT)' ) + (options, args) = parser.parse_args() + + if options.pass_through_options: + cmd = ' '.join( options.pass_through_options ) + else: + cmd = '' + if options.pass_through_options_encoded: + cmd = '%s %s' % ( cmd, ' '.join( map( unhexlify, options.pass_through_options_encoded ) ) ) + if options.max_jvm_heap is not None: + cmd = cmd.replace( 'java ', 'java -Xmx%s ' % ( options.max_jvm_heap ), 1 ) + elif options.max_jvm_heap_fraction is not None: + cmd = cmd.replace( 'java ', 'java -XX:DefaultMaxRAMFraction=%s -XX:+UseParallelGC ' % ( options.max_jvm_heap_fraction ), 1 ) + bam_filenames = [] + tmp_dir = tempfile.mkdtemp( prefix='tmp-gatk-' ) + try: + if options.datasets: + for ( dataset_arg, filename, galaxy_ext, prefix ) in options.datasets: + gatk_filename = gatk_filename_from_galaxy( filename, galaxy_ext, target_dir=tmp_dir, prefix=prefix ) + if dataset_arg: + cmd = '%s %s "%s"' % ( cmd, gatk_filetype_argument_substitution( dataset_arg, galaxy_ext ), gatk_filename ) + if galaxy_ext == "bam": + bam_filenames.append( gatk_filename ) + if galaxy_ext == 'fasta': + subprocess.check_call( 'samtools faidx "%s"' % gatk_filename, shell=True ) + subprocess.check_call( 'java -jar %s R=%s O=%s QUIET=true' % ( os.path.join(os.environ['JAVA_JAR_PATH'], 'CreateSequenceDictionary.jar'), gatk_filename, os.path.splitext(gatk_filename)[0] + '.dict' ), shell=True ) + index_bam_files( bam_filenames ) + # set up stdout and stderr output options + stdout = open_file_from_option( options.stdout, mode='wb' ) + stderr = open_file_from_option( options.stderr, mode='wb' ) + # if no stderr file is specified, we'll use our own + if stderr is None: + stderr = tempfile.NamedTemporaryFile( prefix="gatk-stderr-", dir=tmp_dir ) + + proc = subprocess.Popen( args=cmd, stdout=stdout, stderr=stderr, shell=True, cwd=tmp_dir ) + return_code = proc.wait() + + if return_code: + stderr_target = sys.stderr + else: + stderr_target = sys.stdout + stderr.flush() + stderr.seek(0) + while True: + chunk = stderr.read( CHUNK_SIZE ) + if chunk: + stderr_target.write( chunk ) + else: + break + stderr.close() + finally: + cleanup_before_exit( tmp_dir ) + + # generate html reports + if options.html_report_from_directory: + for ( html_filename, html_dir ) in options.html_report_from_directory: + html_report_from_directory( open( html_filename, 'wb' ), html_dir ) + + +if __name__ == "__main__": + __main__()
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/haplotype_caller.xml Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,313 @@ +<tool id="gatk2_haplotype_caller" name="Haplotype Caller" version="@VERSION@.2"> + <description>Call SNPs and indels simultaneously via local de-novo assembly of haplotypes in an active region</description> + <macros> + <import>gatk2_macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="version_command" /> + <command interpreter="python"> + gatk2_wrapper.py + --stdout "${output_log}" + @BAM_INPUTS@ + -p ' + @JAR_PATH@ + -T "HaplotypeCaller" + -o "${output_vcf}" + + \$GATK2_SITE_OPTIONS + + --num_cpu_threads_per_data_thread \${GALAXY_SLOTS:-4} + + #if $reference_source.reference_source_selector != "history": + -R "${reference_source.ref_file.fields.path}" + #end if + #if str($input_recal) != 'None': + --BQSR "${input_recal}" + #end if + ' + @DBSNP_OPTIONS@ + $allow_n_cigar_reads + #include source=$standard_gatk_options# + + ##start analysis specific options + #if $analysis_param_type.analysis_param_type_selector == "advanced": + -p ' + #if $analysis_param_type.heterozygosity.__str__.strip() != '': + --heterozygosity $analysis_param_type.heterozygosity + #end if + --genotyping_mode "${analysis_param_type.genotyping_mode_type.genotyping_mode}" + #if str( $analysis_param_type.genotyping_mode_type.genotyping_mode ) == 'GENOTYPE_GIVEN_ALLELES': + --alleles "${analysis_param_type.genotyping_mode_type.input_alleles_rod}" + #end if + #if not $analysis_param_type.emitRefConfidence is None: + --emitRefConfidence $analysis_param_type.emitRefConfidence + #end if + + ## files + #if str($analysis_param_type.activeRegionIn) != 'None': + --activeRegionIn "$analysis_param_type.activeRegionIn" + #end if + #if str($analysis_param_type.comp) != 'None': + --comp "$analysis_param_type.comp" + #end if + ## + #if str( $analysis_param_type.annotation ) != "None": + #for $annotation in str( $analysis_param_type.annotation.fields.gatk_value ).split( ','): + --annotation "${annotation}" + #end for + #end if + #for $additional_annotation in $analysis_param_type.additional_annotations: + --annotation "${additional_annotation.additional_annotation_name}" + #end for + #if str( $analysis_param_type.group ) != "None": + #for $group in str( $analysis_param_type.group ).split( ','): + --group "${group}" + #end for + #end if + #if str( $analysis_param_type.exclude_annotations ) != "None": + #for $annotation in str( $analysis_param_type.exclude_annotations.fields.gatk_value ).split( ','): + --excludeAnnotation "${annotation}" + #end for + #end if + + ## value setings + #if $analysis_param_type.contamination_fraction_to_filter.__str__.strip() != '': + --contamination_fraction_to_filter $analysis_param_type.contamination_fraction_to_filter + #end if + #if $analysis_param_type.minPruning.__str__.strip() != '': + --minPruning $analysis_param_type.minPruning + #end if + #if $analysis_param_type.standard_min_confidence_threshold_for_calling.__str__.strip() != '': + --standard_min_confidence_threshold_for_calling $analysis_param_type.standard_min_confidence_threshold_for_calling + #end if + #if $analysis_param_type.standard_min_confidence_threshold_for_emitting.__str__.strip() != '': + --standard_min_confidence_threshold_for_emitting $analysis_param_type.standard_min_confidence_threshold_for_emitting + #end if + #if $analysis_param_type.gcpHMM.__str__.strip() != '': + --gcpHMM $analysis_param_type.gcpHMM + #end if + #if $analysis_param_type.max_alternate_alleles.__str__.strip() != '': + --max_alternate_alleles $analysis_param_type.max_alternate_alleles + #end if + ## mode selections + + #if $analysis_param_type.pair_hmm_implementation.__str__ != "None" and len($analysis_param_type.pair_hmm_implementation.__str__) > 0: + --pair_hmm_implementation $analysis_param_type.pair_hmm_implementation + #end if + ## optional outputs + #if $analysis_param_type.activeRegionOut: + --activeRegionOut $active_region_out + #end if + #if $analysis_param_type.graphOutput: + --graphOutput $graph_out + #end if + ## flags + $analysis_param_type.useAllelesTrigger + $analysis_param_type.fullHaplotype + $analysis_param_type.genotypeFullActiveRegion + $analysis_param_type.debug + ' + #end if + </command> + <inputs> + <param name="input_recal" type="data" format="gatk_report" optional="true" label="Covariates table recalibration file" help="The input covariates table file which enables on-the-fly base quality score recalibration. Enables on-the-fly recalibrate of base qualities. The covariates tables are produced by the BaseQualityScoreRecalibrator tool. Please be aware that one should only run recalibration with the covariates file created on the same input bam(s) (-BQSR,--BQSR &lt;recal_file&gt;)" /> + <conditional name="reference_source"> + <expand macro="reference_source_selector_param" /> + <when value="cached"> + <expand macro="input_bams_cached" /> + <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &lt;reference_sequence&gt;" > + <options from_data_table="gatk2_picard_indexes"> + <!-- <filter type="data_meta" key="dbkey" ref="input_bam" column="dbkey"/> does not yet work in a repeat...--> + </options> + <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> + </param> + </when> + <when value="history"> + <expand macro="input_bams_history" /> + <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &lt;reference_sequence&gt;" /> + </when> + </conditional> + <expand macro="dbsnp_param" /> + + <expand macro="allow_n_cigar_reads" /> + <expand macro="gatk_param_type_conditional" /> + + <conditional name="analysis_param_type"> + <param name="analysis_param_type_selector" type="select" label="Basic or Advanced Analysis options"> + <option value="basic" selected="True">Basic</option> + <option value="advanced">Advanced</option> + </param> + <when value="basic"> + <!-- Do nothing here --> + </when> + <when value="advanced"> + + <param name="activeRegionIn" type="data" format="bed,gatk_interval,picard_interval_list,vcf" optional="true" label="activeRegionIn" help="--activeRegionIn / -AR Use this interval list file as the active regions to process"/> + <param name="activeRegionOut" type="boolean" checked="False" truevalue="" falsevalue="" label="activeRegionOut" help="--activeRegionOut / -ARO Output the active region to an interval list file"/> + + <param name="annotation" type="select" multiple="True" display="checkboxes" label="Annotation Types" help="-A,--annotation &lt;annotation&gt;"> + <!-- load the available annotations from an external configuration file, since additional ones can be added to local installs --> + <options from_data_table="gatk2_annotations"> + <filter type="multiple_splitter" column="tools_valid_for" separator=","/> + <filter type="static_value" value="HaplotypeCaller" column="tools_valid_for"/> + </options> + </param> + <repeat name="additional_annotations" title="Additional annotation" help="-A,--annotation &lt;annotation&gt;"> + <param name="additional_annotation_name" type="text" value="" label="Annotation name" /> + </repeat> +<!-- + <conditional name="snpEff_rod_bind_type"> + <param name="snpEff_rod_bind_type_selector" type="select" label="Provide a snpEff reference-ordered data file"> + <option value="set_snpEff">Set snpEff</option> + <option value="exclude_snpEff" selected="True">Don't set snpEff</option> + </param> + <when value="exclude_snpEff"> + </when> + <when value="set_snpEff"> + <param name="snpEff_input_rod" type="data" format="vcf" label="ROD file" /> + <param name="snpEff_rod_name" type="hidden" value="snpEff" label="ROD Name"/> + </when> + </conditional> +--> + <param name="group" type="select" multiple="True" display="checkboxes" label="Annotation Interfaces/Groups" help="-G,--group &lt;group&gt;"> + <option value="RodRequiringAnnotation">RodRequiringAnnotation</option> + <option value="Standard">Standard</option> + <option value="Experimental">Experimental</option> + <option value="WorkInProgress">WorkInProgress</option> + <option value="RankSumTest">RankSumTest</option> + <!-- <option value="none">none</option> --> + </param> + <!-- <param name="family_string" type="text" value="" label="Family String"/> --> + <param name="exclude_annotations" type="select" multiple="True" display="checkboxes" label="Annotations to exclude" help="-XA,--excludeAnnotation &lt;excludeAnnotation&gt;" > + <!-- load the available annotations from an external configuration file, since additional ones can be added to local installs --> + <options from_data_table="gatk2_annotations"> + <filter type="multiple_splitter" column="tools_valid_for" separator=","/> + <filter type="static_value" value="HaplotypeCaller" column="tools_valid_for"/> + </options> + </param> + + <param name="comp" type="data" format="vcf" optional="true" label="comp" help="--comp / -comp comparison VCF file"/> + <param name="contamination_fraction_to_filter" type="float" value="0.05" optional="true" label="contamination_fraction_to_filter" help="--contamination_fraction_to_filter / -contamination Fraction of contamination in sequencing data (for all samples) to aggressively remove"> + <validator type="in_range" message="value between 0.00 and 1.00" min="0" max="1"/> + </param> + <param name="debug" type="boolean" checked="False" truevalue="-debug" falsevalue="" label="debug" help="--debug / -debug If specified, print out very verbose debug information about each triggering active region"/> + + <conditional name="genotyping_mode_type"> + <param name="genotyping_mode" type="select" label="How to determine the alternate allele to use for genotyping" help="-gt_mode,--genotyping_mode &lt;genotyping_mode&gt;"> + <option value="DISCOVERY" selected="True">DISCOVERY</option> + <option value="GENOTYPE_GIVEN_ALLELES">GENOTYPE_GIVEN_ALLELES</option> + </param> + <when value="DISCOVERY"> + <!-- Do nothing here --> + </when> + <when value="GENOTYPE_GIVEN_ALLELES"> + <param name="input_alleles_rod" type="data" format="vcf" label="Alleles ROD file" help="-alleles,--alleles &lt;alleles&gt;" /> + </when> + </conditional> + <param name="graphOutput" type="boolean" checked="False" truevalue="" falsevalue="" label="graphOutput" help="--graphOutput / -graph File to which debug assembly graph information should be written"/> + <param name="heterozygosity" type="float" value="0.0010" optional="true" label="heterozygosity" help="--heterozygosity / -hets Heterozygosity value used to compute prior likelihoods for any locus"/> + <param name="minPruning" type="integer" value="1" optional="true" label="minPruning" help="--minPruning / -minPruning The minimum allowed pruning factor in assembly graph. Paths with >= X supporting kmers are pruned from the graph"> + <validator type="in_range" message="value between 0 and 127" min="0" max="127"/> + </param> + <!-- http://www.broadinstitute.org/gatk/guide/article?id=2940 --> + <param name="emitRefConfidence" type="select" optional="true" label="Output confidence estimates" help="Emitting a per-bp or summarized confidence estimate for a site being strictly homozygous-reference (--emitRefConfidence)"> + <option value="NONE" selected="True">don't emit anything</option> + <option value="BP_RESOLUTION">BP_RESOLUTION (emit detailed information for each BP)</option> + <option value="GVCF">GVCF (emit a block summarized version of the BP_RESOLUTION data)</option> + </param> + <param name="pair_hmm_implementation" type="select" optional="true" label="pair_hmm_implementation" help="--pair_hmm_implementation / -pairHMM The PairHMM implementation to use for genotype likelihood calculations"> + <option value="EXACT">EXACT</option> + <option value="ORIGINAL">ORIGINAL</option> + <option value="CACHING">CACHING</option> + <option value="LOGLESS_CACHING" selected="True">LOGLESS_CACHING</option> + </param> + <param name="standard_min_confidence_threshold_for_calling" type="float" value="30.0" optional="true" label="standard_min_confidence_threshold_for_calling" help="--standard_min_confidence_threshold_for_calling / -stand_call_conf The minimum phred-scaled confidence threshold at which variants should be called"/> + <param name="standard_min_confidence_threshold_for_emitting" type="float" value="30.0" optional="true" label="standard_min_confidence_threshold_for_emitting" help="--standard_min_confidence_threshold_for_emitting / -stand_emit_conf The minimum phred-scaled confidence threshold at which variants should be emitted (and filtered with LowQual if less than the calling threshold)"/> + <param name="useAllelesTrigger" type="boolean" checked="False" truevalue="-allelesTrigger" falsevalue="" label="useAllelesTrigger" help="--useAllelesTrigger / -allelesTrigger If specified, use additional trigger on variants found in an external alleles file"/> + <param name="fullHaplotype" type="boolean" checked="False" truevalue="-fullHaplotype" falsevalue="" label="fullHaplotype" help="--fullHaplotype / -fullHaplotype If specified, output the full haplotype sequence instead of converting to individual variants w.r.t. the reference"/> + <param name="gcpHMM" type="integer" value="10" optional="true" label="gcpHMM" help="--gcpHMM / -gcpHMM Flat gap continuation penalty for use in the Pair HMM"/> + <param name="genotypeFullActiveRegion" type="boolean" checked="False" truevalue="-genotypeFullActiveRegion" falsevalue="" label="genotypeFullActiveRegion" help="--genotypeFullActiveRegion / -genotypeFullActiveRegion If specified, alternate alleles are considered to be the full active region for the purposes of genotyping"/> + <param name="max_alternate_alleles" type="integer" value="6" optional="true" label="max_alternate_alleles" help="--max_alternate_alleles / -maxAltAlleles Maximum number of alternate alleles to genotype"/> + </when> + </conditional> + </inputs> + <outputs> + <data format="vcf" name="output_vcf" label="${tool.name} on ${on_string} (VCF)" /> + <data format="vcf" name="graph_out" label="${tool.name} on ${on_string} graph" > + <filter>analysis_param_type['analysis_param_type_selector'] == "advanced" and analysis_param_type['graphOutput'] == True</filter> + </data> + <data format="vcf" name="active_region_out" label="${tool.name} on ${on_string} activeRegion" > + <filter>analysis_param_type['analysis_param_type_selector'] == "advanced" and analysis_param_type['activeRegionOut'] == True</filter> + </data> + <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" /> + </outputs> + <tests> + <test> + <param name="input_recal" value="gatk/gatk_count_covariates/gatk_count_covariates_out_1.csv" ftype="csv" /> + <param name="reference_source_selector" value="history" /> + <param name="ref_file" value="phiX.fasta" ftype="fasta" /> + <param name="input_bam" value="gatk/gatk_indel_realigner/gatk_indel_realigner_out_1.bam" ftype="bam" /> + <param name="gatk_param_type_selector" value="basic" /> + <param name="analysis_param_type_selector" value="basic" /> + <output name="output_bam" file="gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.bam" ftype="bam" lines_diff="4" /> + <output name="output_log" file="gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.log.contains" compare="contains" /> + </test> + </tests> + <help> +**What it does** + +**HaplotypeCaller** +calls SNPs and indels simultaneously via local de-novo assembly of haplotypes in an active region. +Haplotypes are evaluated using an affine gap penalty Pair HMM. + +For more information on using read based compression in the GATK, see this `tool specific page <http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_haplotypecaller_HaplotypeCaller.html>`_. + +To learn about best practices for variant detection using GATK, see this `overview <http://www.broadinstitute.org/gatk/guide/topic?name=best-practices>`_. + +If you encounter errors, please view the `GATK FAQ <http://www.broadinstitute.org/gatk/guide/topic?name=faqs>`_. + +------ + +**Inputs** + +GenomeAnalysisTK: PrintReads accepts aligned BAM files. + + +**Outputs** + +The output is a VCF file with raw, unrecalibrated SNP and indel calls. + + +Go `here <http://www.broadinstitute.org/gatk/guide/topic?name=intro>`_ for details on GATK file formats. + +------- + +**Settings**:: + + activeRegionIn Use this interval list file as the active regions to process + activeRegionOut Output the active region to this interval list file + alleles The set of alleles at which to genotype when --genotyping_mode is GENOTYPE_GIVEN_ALLELES + annotation One or more specific annotations to apply to variant calls + comp comparison VCF file + contamination Fraction of contamination in sequencing data (for all samples) to aggressively remove + dbsnp dbSNP file + debug If specified, print out very verbose debug information about each triggering active region + excludeAnnotation One or more specific annotations to exclude + genotyping_mode Specifies how to determine the alternate alleles to use for genotyping + graphOutput File to which debug assembly graph information should be written + group One or more classes/groups of annotations to apply to variant calls + heterozygosity Heterozygosity value used to compute prior likelihoods for any locus + minPruning The minimum allowed pruning factor in assembly graph. Paths with less than or equal supporting kmers are pruned from the graph + pair_hmm_implementation The PairHMM implementation to use for genotype likelihood calculations + stand_call_conf The minimum phred-scaled confidence threshold at which variants should be called + stand_emit_conf The minimum phred-scaled confidence threshold at which variants should be emitted (and filtered with LowQual if less than the calling threshold) + useAllelesTrigger If specified, use additional trigger on variants found in an external alleles file + fullHaplotype If specified, output the full haplotype sequence instead of converting to individual variants w.r.t. the reference + gcpHMM Flat gap continuation penalty for use in the Pair HMM + genotypeFullActiveRegion If specified, alternate alleles are considered to be the full active region for the purposes of genotyping + max_alternate_alleles Maximum number of alternate alleles to genotype + +@CITATION_SECTION@ + </help> + <expand macro="citations" /> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/indel_realigner.xml Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,213 @@ +<tool id="gatk2_indel_realigner" name="Indel Realigner" version="@VERSION@.1"> + <description>- perform local realignment</description> + <macros> + <import>gatk2_macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="version_command" /> + <command interpreter="python"> + gatk2_wrapper.py + --stdout "${output_log}" + -d "-I" "${reference_source.input_bam}" "${reference_source.input_bam.ext}" "gatk_input" + #if str( $reference_source.input_bam.metadata.bam_index ) != "None": + -d "" "${reference_source.input_bam.metadata.bam_index}" "bam_index" "gatk_input" ##hardcode galaxy ext type as bam_index + #end if + -p ' + @JAR_PATH@ + -T "IndelRealigner" + -o "${output_bam}" + + \$GATK2_SITE_OPTIONS + + ## according to http://www.broadinstitute.org/gatk/guide/article?id=1975 + --num_cpu_threads_per_data_thread 1 + + #if $reference_source.reference_source_selector != "history": + -R "${reference_source.ref_file.fields.path}" + #end if + -LOD "${lod_threshold}" + ${knowns_only} + ' + + #set $rod_binding_names = dict() + #for $rod_binding in $rod_bind: + #if str( $rod_binding.rod_bind_type.rod_bind_type_selector ) == 'custom': + #set $rod_bind_name = $rod_binding.rod_bind_type.custom_rod_name + #else + #set $rod_bind_name = $rod_binding.rod_bind_type.rod_bind_type_selector + #end if + #set $rod_binding_names[$rod_bind_name] = $rod_binding_names.get( $rod_bind_name, -1 ) + 1 + -d "-known:${rod_bind_name},%(file_type)s" "${rod_binding.rod_bind_type.input_rod}" "${rod_binding.rod_bind_type.input_rod.ext}" "input_${rod_bind_name}_${rod_binding_names[$rod_bind_name]}" + #end for + + $allow_n_cigar_reads + #include source=$standard_gatk_options# + ##start analysis specific options + -d "-targetIntervals" "${target_intervals}" "${target_intervals.ext}" "gatk_target_intervals" + -p ' + --disable_bam_indexing + ' + #if $analysis_param_type.analysis_param_type_selector == "advanced": + -p ' + --entropyThreshold "${analysis_param_type.entropy_threshold}" + ${analysis_param_type.simplify_bam} + --consensusDeterminationModel "${analysis_param_type.consensus_determination_model}" + --maxIsizeForMovement "${analysis_param_type.max_insert_size_for_movement}" + --maxPositionalMoveAllowed "${analysis_param_type.max_positional_move_allowed}" + --maxConsensuses "${analysis_param_type.max_consensuses}" + --maxReadsForConsensuses "${analysis_param_type.max_reads_for_consensuses}" + --maxReadsForRealignment "${analysis_param_type.max_reads_for_realignment}" + ${analysis_param_type.no_original_alignment_tags} + ' + #end if + </command> + <inputs> + + <conditional name="reference_source"> + <expand macro="reference_source_selector_param" /> + <when value="cached"> + <param name="input_bam" type="data" format="bam" label="BAM file" help="-I,--input_file &lt;input_file&gt;"> + <validator type="unspecified_build" /> + <validator type="dataset_metadata_in_data_table" table_name="gatk2_picard_indexes" metadata_name="dbkey" metadata_column="dbkey" message="Sequences are not currently available for the specified build." /> <!-- fixme!!! this needs to be a select --> + </param> + <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &lt;reference_sequence&gt;" > + <options from_data_table="gatk2_picard_indexes"> + <filter type="data_meta" key="dbkey" ref="input_bam" column="dbkey"/> + </options> + <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> + </param> + </when> + <when value="history"> + <param name="input_bam" type="data" format="bam" label="BAM file" help="-I,--input_file &lt;input_file&gt;" /> + <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &lt;reference_sequence&gt;"> + <options> + <filter type="data_meta" key="dbkey" ref="input_bam" /> + </options> + </param> + </when> + </conditional> + <param name="target_intervals" type="data" format="gatk_interval,bed,picard_interval_list" label="Restrict realignment to provided intervals" help="-targetIntervals,--targetIntervals &lt;targetIntervals&gt;" /> + <repeat name="rod_bind" title="Known Variants" help="Using data sets of known variants (-known,--knownAlleles &lt;knownAlleles&gt;)"> + <conditional name="rod_bind_type"> + <param name="rod_bind_type_selector" type="select" label="Variant Type"> + <option value="dbsnp" selected="True">dbSNP</option> + <option value="snps">SNPs</option> + <option value="indels">INDELs</option> + <option value="custom">Custom</option> + </param> + <when value="dbsnp"> + <param name="input_rod" type="data" format="vcf" label="Variant file (VCF format)" /> + </when> + <when value="snps"> + <param name="input_rod" type="data" format="vcf" label="Variant file (VCF format)" /> + </when> + <when value="indels"> + <param name="input_rod" type="data" format="vcf" label="Variant file (VCF format)" /> + </when> + <when value="custom"> + <param name="custom_rod_name" type="text" value="Unknown" label="Customer's variant file"/> + <param name="input_rod" type="data" format="vcf" label="Variant file (VCF format)" /> + </when> + </conditional> + </repeat> + <param name="lod_threshold" type="float" value="5.0" label="LOD threshold above which the realigner will proceed to realign" help="-LOD,--LODThresholdForCleaning &lt;LODThresholdForCleaning&gt;" /> + <param name="knowns_only" type="boolean" checked="False" truevalue="-knownsOnly" falsevalue="" label="Use only known indels provided as RODs" help="-knownsOnly"/> + + <expand macro="allow_n_cigar_reads" /> + <expand macro="gatk_param_type_conditional" /> + + <expand macro="analysis_type_conditional"> + + <param name="entropy_threshold" type="float" value="0.15" label="percentage of mismatching base quality scores at a position to be considered having high entropy" help="-entropy,--entropyThreshold &lt;entropyThreshold&gt;" /> + <param name="simplify_bam" type="boolean" checked="False" truevalue="-simplifyBAM" falsevalue="" label="Simplify BAM" help="-simplifyBAM,--simplifyBAM"/> + <param name="consensus_determination_model" type="select" label="Consensus Determination Model" help="-model,--consensusDeterminationModel &lt;consensusDeterminationModel&gt;"> + <option value="KNOWNS_ONLY">KNOWNS_ONLY</option> + <option value="USE_READS" selected="True">USE_READS</option> + <option value="USE_SW">USE_SW</option> + </param> + <param name="max_insert_size_for_movement" type="integer" value="3000" label="Maximum insert size of read pairs that we attempt to realign" help="-maxIsize,--maxIsizeForMovement &lt;maxIsizeForMovement&gt;" /> + <param name="max_positional_move_allowed" type="integer" value="200" label="Maximum positional move in basepairs that a read can be adjusted during realignment" help="-maxPosMove,--maxPositionalMoveAllowed &lt;maxPositionalMoveAllowed&gt;" /> + <param name="max_consensuses" type="integer" value="30" label="Max alternate consensuses to try" help="-maxConsensuses,--maxConsensuses &lt;maxConsensuses&gt;" /> + <param name="max_reads_for_consensuses" type="integer" value="120" label="Max reads (chosen randomly) used for finding the potential alternate consensuses" help="-greedy,--maxReadsForConsensuses &lt;maxReadsForConsensuses&gt;" /> + <param name="max_reads_for_realignment" type="integer" value="20000" label="Max reads allowed at an interval for realignment" help="-maxReads,--maxReadsForRealignment &lt;maxReadsForRealignment&gt;" /> + <param name="no_original_alignment_tags" type="boolean" checked="False" truevalue="--noOriginalAlignmentTags" falsevalue="" label="Don't output the original cigar or alignment start tags for each realigned read in the output bam" help="-noTags,--noOriginalAlignmentTags"/> + </expand> + </inputs> + <outputs> + <data format="bam" name="output_bam" label="${tool.name} on ${on_string} (BAM)" /> + <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" /> + </outputs> + <tests> + <test> + <param name="reference_source_selector" value="history" /> + <param name="ref_file" value="phiX.fasta" ftype="fasta" /> + <param name="target_intervals" value="gatk/gatk_realigner_target_creator/gatk_realigner_target_creator_out_1.gatk_interval" ftype="gatk_interval" /> + <param name="input_bam" value="gatk/fake_phiX_reads_1.bam" ftype="bam" /> + <param name="rod_bind_type_selector" value="snps" /> + <param name="input_rod" value="gatk/fake_phiX_variant_locations.vcf" ftype="vcf" /> + <param name="lod_threshold" value="5.0" /> + <param name="knowns_only" /> + <param name="gatk_param_type_selector" value="basic" /> + <param name="analysis_param_type_selector" value="advanced" /> + <param name="entropy_threshold" value="0.15" /> + <param name="simplify_bam" /> + <param name="consensus_determination_model" value="USE_SW" /> + <param name="max_insert_size_for_movement" value="3000" /> + <param name="max_positional_move_allowed" value="200" /> + <param name="max_consensuses" value="30" /> + <param name="max_reads_for_consensuses" value="120" /> + <param name="max_reads_for_realignment" value="20000" /> + <param name="no_original_alignment_tags" /> + <output name="output_bam" file="gatk/gatk_indel_realigner/gatk_indel_realigner_out_1.bam" ftype="bam" lines_diff="2" /> + <output name="output_log" file="gatk/gatk_indel_realigner/gatk_indel_realigner_out_1.log.contains" compare="contains" /> + </test> + </tests> + <help> +**What it does** + +Performs local realignment of reads based on misalignments due to the presence of indels. Unlike most mappers, this walker uses the full alignment context to determine whether an appropriate alternate reference (i.e. indel) exists and updates SAMRecords accordingly. + +For more information on local realignment around indels using the GATK, see this `tool specific page <http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_indels_IndelRealigner.html>`_. + +To learn about best practices for variant detection using GATK, see this `overview <http://www.broadinstitute.org/gatk/guide/topic?name=best-practices>`_. + +If you encounter errors, please view the `GATK FAQ <http://www.broadinstitute.org/gatk/guide/topic?name=faqs>`_. + +------ + +**Inputs** + +GenomeAnalysisTK: IndelRealigner accepts an aligned BAM and a list of intervals to realign as input files. + + +**Outputs** + +The output is in the BAM format. + + +Go `here <http://www.broadinstitute.org/gatk/guide/topic?name=intro>`_ for details on GATK file formats. + +------- + +**Settings**:: + + targetIntervals intervals file output from RealignerTargetCreator + LODThresholdForCleaning LOD threshold above which the cleaner will clean + entropyThreshold percentage of mismatches at a locus to be considered having high entropy + out Output bam + bam_compression Compression level to use for writing BAM files + disable_bam_indexing Turn off on-the-fly creation of indices for output BAM files. + simplifyBAM If provided, output BAM files will be simplified to include just key reads for downstream variation discovery analyses (removing duplicates, PF-, non-primary reads), as well stripping all extended tags from the kept reads except the read group identifier + useOnlyKnownIndels Don't run 'Smith-Waterman' to generate alternate consenses; use only known indels provided as RODs for constructing the alternate references. + maxReadsInMemory max reads allowed to be kept in memory at a time by the SAMFileWriter. Keep it low to minimize memory consumption (but the tool may skip realignment on regions with too much coverage. If it is too low, it may generate errors during realignment); keep it high to maximize realignment (but make sure to give Java enough memory). + maxIsizeForMovement maximum insert size of read pairs that we attempt to realign + maxPositionalMoveAllowed maximum positional move in basepairs that a read can be adjusted during realignment + maxConsensuses max alternate consensuses to try (necessary to improve performance in deep coverage) + maxReadsForConsensuses max reads used for finding the alternate consensuses (necessary to improve performance in deep coverage) + maxReadsForRealignment max reads allowed at an interval for realignment; if this value is exceeded, realignment is not attempted and the reads are passed to the output file(s) as-is + noOriginalAlignmentTags Don't output the original cigar or alignment start tags for each realigned read in the output bam. + +@CITATION_SECTION@ + </help> + <expand macro="citations" /> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/print_reads.xml Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,245 @@ +<tool id="gatk2_print_reads" name="Print Reads" version="@VERSION@.0"> + <description>on BAM files</description> + <macros> + <import>gatk2_macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="version_command" /> + <command interpreter="python"> + gatk2_wrapper.py + --stdout "${output_log}" + -d "-I" "${reference_source.input_bam}" "${reference_source.input_bam.ext}" "gatk_input" + #if str( $reference_source.input_bam.metadata.bam_index ) != "None": + -d "" "${reference_source.input_bam.metadata.bam_index}" "bam_index" "gatk_input" ##hardcode galaxy ext type as bam_index + #end if + -p ' + @JAR_PATH@ + -T "PrintReads" + -o "${output_bam}" + \$GATK2_SITE_OPTIONS + + ## according to http://www.broadinstitute.org/gatk/guide/article?id=1975 + --num_cpu_threads_per_data_thread \${GALAXY_SLOTS:-6} + + #if $reference_source.reference_source_selector != "history": + -R "${reference_source.ref_file.fields.path}" + #end if + #if str($input_recal) != 'None': + --BQSR "${input_recal}" + #end if + --disable_bam_indexing + ' + + #include source=$standard_gatk_options# + + ##start analysis specific options + #if $analysis_param_type.analysis_param_type_selector == "advanced": + -p ' + #if $analysis_param_type.default_read_group_type.default_read_group_type_selector == "set": + --default_read_group "${analysis_param_type.default_read_group_type.default_read_group}" + #end if + #if str( $analysis_param_type.default_platform ) != "default": + --default_platform "${analysis_param_type.default_platform}" + #end if + #if str( $analysis_param_type.force_read_group_type.force_read_group_type_selector ) == "set": + --force_read_group "${analysis_param_type.force_read_group_type.force_read_group}" + #end if + #if str( $analysis_param_type.force_platform ) != "default": + --force_platform "${analysis_param_type.force_platform}" + #end if + ${analysis_param_type.exception_if_no_tile} + #if str( $analysis_param_type.solid_options_type.solid_options_type_selector ) == "set": + #if str( $analysis_param_type.solid_options_type.solid_recal_mode ) != "default": + --solid_recal_mode "${analysis_param_type.solid_options_type.solid_recal_mode}" + #end if + #if str( $analysis_param_type.solid_options_type.solid_nocall_strategy ) != "default": + --solid_nocall_strategy "${analysis_param_type.solid_options_type.solid_nocall_strategy}" + #end if + #end if + ${analysis_param_type.simplify_bam} + --preserve_qscores_less_than "${analysis_param_type.preserve_qscores_less_than}" + --smoothing "${analysis_param_type.smoothing}" + --max_quality_score "${analysis_param_type.max_quality_score}" + --window_size_nqs "${analysis_param_type.window_size_nqs}" + --homopolymer_nback "${analysis_param_type.homopolymer_nback}" + ${analysis_param_type.do_not_write_original_quals} + ' + #end if + </command> + <inputs> + <param name="input_recal" type="data" format="gatk_report" optional="true" label="Covariates table recalibration file" + help="The input covariates table file which enables on-the-fly base quality score recalibration (intended for use with BaseRecalibrator files) (-BQSR,--BQSR)" /> + <conditional name="reference_source"> + <expand macro="reference_source_selector_param" /> + <when value="cached"> + <param name="input_bam" type="data" format="bam" label="BAM file" help="-I,--input_file &lt;input_file&gt;"> + <validator type="unspecified_build" /> + <validator type="dataset_metadata_in_data_table" table_name="gatk2_picard_indexes" metadata_name="dbkey" metadata_column="dbkey" message="Sequences are not currently available for the specified build." /> <!-- fixme!!! this needs to be a select --> + </param> + <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &lt;reference_sequence&gt;" > + <options from_data_table="gatk2_picard_indexes"> + <filter type="data_meta" key="dbkey" ref="input_bam" column="dbkey"/> + </options> + <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> + </param> + </when> + <when value="history"> + <param name="input_bam" type="data" format="bam" label="BAM file" help="-I,--input_file &lt;input_file&gt;" /> + <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &lt;reference_sequence&gt;"> + <options> + <filter type="data_meta" key="dbkey" ref="input_bam" /> + </options> + </param> + </when> + </conditional> + + <expand macro="gatk_param_type_conditional" /> + + <conditional name="analysis_param_type"> + <param name="analysis_param_type_selector" type="select" label="Basic or Advanced Analysis options"> + <option value="basic" selected="True">Basic</option> + <option value="advanced">Advanced</option> + </param> + <when value="basic"> + <!-- Do nothing here --> + </when> + <when value="advanced"> + <conditional name="default_read_group_type"> + <param name="default_read_group_type_selector" type="select" label="Set default Read Group" help="--default_read_group"> + <option value="default" selected="True">Don't Set</option> + <option value="set">Set</option> + </param> + <when value="default"> + <!-- do nothing here --> + </when> + <when value="set"> + <param name="default_read_group" type="text" value="Unknown" label="If a read has no read group then default to the provided String"/> + </when> + </conditional> + <param name="default_platform" type="select" label="Set default Platform" help="--default_platform"> + <option value="default" selected="True">Don't Set</option> + <option value="illumina">illumina</option> + <option value="454">454</option> + <option value="solid">solid</option> + </param> + <conditional name="force_read_group_type"> + <param name="force_read_group_type_selector" type="select" label="Force Read Group" help="--force_read_group"> + <option value="default" selected="True">Don't Force</option> + <option value="set">Force</option> + </param> + <when value="default"> + <!-- do nothing here --> + </when> + <when value="set"> + <param name="force_read_group" type="text" value="Unknown" label="If provided, the read group ID of EVERY read will be forced to be the provided String."/> + </when> + </conditional> + <param name="force_platform" type="select" label="Force Platform" help="--force_platform"> + <option value="default" selected="True">Don't Force</option> + <option value="illumina">illumina</option> + <option value="454">454</option> + <option value="solid">solid</option> + </param> + <param name="exception_if_no_tile" type="boolean" checked="False" truevalue="--exception_if_no_tile" falsevalue="" label="Throw an exception when no tile can be found" help="--exception_if_no_tile"/> + <conditional name="solid_options_type"> + <param name="solid_options_type_selector" type="select" label="Set SOLiD specific options"> + <option value="default" selected="True">Don't Set</option> + <option value="set">Set</option> + </param> + <when value="default"> + <!-- do nothing here --> + </when> + <when value="set"> + <param name="solid_recal_mode" type="select" label="How should we recalibrate solid bases in which the reference was inserted" help="-sMode,--solid_recal_mode &lt;solid_recal_mode&gt;"> + <option value="default" selected="True">Don't set</option> + <option value="DO_NOTHING">DO_NOTHING</option> + <option value="SET_Q_ZERO">SET_Q_ZERO</option> + <option value="SET_Q_ZERO_BASE_N">SET_Q_ZERO_BASE_N</option> + <option value="REMOVE_REF_BIAS">REMOVE_REF_BIAS</option> + </param> + <param name="solid_nocall_strategy" type="select" label="Behavior of the recalibrator when it encounters no calls" help="-solid_nocall_strategy,--solid_nocall_strategy &lt;solid_nocall_strategy&gt;"> + <option value="default" selected="True">Don't set</option> + <option value="THROW_EXCEPTION">THROW_EXCEPTION</option> + <option value="LEAVE_READ_UNRECALIBRATED">LEAVE_READ_UNRECALIBRATED</option> + <option value="PURGE_READ">PURGE_READ</option> + </param> + </when> + </conditional> + <param name="simplify_bam" type="boolean" checked="False" truevalue="-simplifyBAM" falsevalue="" label="Simplify BAM" help="-simplifyBAM,--simplifyBAM"/> + <param name="window_size_nqs" type="integer" value="5" label="Window size used by MinimumNQSCovariate" help="--window_size_nqs"/> + <param name="homopolymer_nback" type="integer" value="7" label="Number of previous bases to look at in HomopolymerCovariate" help="-nback,--homopolymer_nback &lt;homopolymer_nback&gt;" /> + <param name="preserve_qscores_less_than" type="integer" value="5" label="Bases with quality scores less than this threshold won't be recalibrated" help="-pQ,--preserve_qscores_less_than &lt;preserve_qscores_less_than&gt;"/> + <param name="smoothing" type="integer" value="1" label="smoothing" help="-sm,--smoothing &lt;smoothing&gt;"/> + <param name="max_quality_score" type="integer" value="50" label="Max quality score" help="-maxQ,--max_quality_score &lt;max_quality_score&gt;"/> + <param name="do_not_write_original_quals" type="boolean" checked="False" truevalue="--doNotWriteOriginalQuals" falsevalue="" label="Do Not Write Original Quality tag" help="-noOQs,--doNotWriteOriginalQuals"/> + </when> + </conditional> + </inputs> + <outputs> + <data format="bam" name="output_bam" label="${tool.name} on ${on_string} (BAM)" /> + <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" /> + </outputs> + <tests> + <test> + <param name="input_recal" value="gatk/gatk_count_covariates/gatk_count_covariates_out_1.csv" ftype="csv" /> + <param name="reference_source_selector" value="history" /> + <param name="ref_file" value="phiX.fasta" ftype="fasta" /> + <param name="input_bam" value="gatk/gatk_indel_realigner/gatk_indel_realigner_out_1.bam" ftype="bam" /> + <param name="gatk_param_type_selector" value="basic" /> + <param name="analysis_param_type_selector" value="basic" /> + <output name="output_bam" file="gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.bam" ftype="bam" lines_diff="4" /> + <output name="output_log" file="gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.log.contains" compare="contains" /> + </test> + </tests> + <help> +**What it does** + +This walker is designed to work as the second pass in a two-pass processing step, doing a by-read traversal. For each base in each read this walker calculates various user-specified covariates (such as read group, reported quality score, cycle, and dinuc) Using these values as a key in a large hashmap the walker calculates an empirical base quality score and overwrites the quality score currently in the read. This walker then outputs a new bam file with these updated (recalibrated) reads. Note: This walker expects as input the recalibration table file generated previously by CovariateCounterWalker. Note: This walker is designed to be used in conjunction with CovariateCounterWalker. + +For more information on base quality score recalibration using the GATK, see this `tool specific page <http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_readutils_PrintReads.html>`_. + +To learn about best practices for variant detection using GATK, see this `overview <http://www.broadinstitute.org/gatk/guide/topic?name=best-practices>`_. + +If you encounter errors, please view the `GATK FAQ <http://www.broadinstitute.org/gatk/guide/topic?name=faqs>`_. + +------ + +**Inputs** + +GenomeAnalysisTK: PrintReads accepts an aligned BAM and a recalibration (gatk_report) input files. + + +**Outputs** + +The output is in BAM format. + + +Go `here <http://www.broadinstitute.org/gatk/guide/topic?name=intro>`_ for details on GATK file formats. + +------- + +**Settings**:: + + default_read_group If a read has no read group then default to the provided String. + default_platform If a read has no platform then default to the provided String. Valid options are illumina, 454, and solid. + force_read_group If provided, the read group ID of EVERY read will be forced to be the provided String. This is useful to collapse all data into a single read group. + force_platform If provided, the platform of EVERY read will be forced to be the provided String. Valid options are illumina, 454, and solid. + window_size_nqs The window size used by MinimumNQSCovariate for its calculation + homopolymer_nback The number of previous bases to look at in HomopolymerCovariate + exception_if_no_tile If provided, TileCovariate will throw an exception when no tile can be found. The default behavior is to use tile = -1 + solid_recal_mode How should we recalibrate solid bases in whichthe reference was inserted? Options = DO_NOTHING, SET_Q_ZERO, SET_Q_ZERO_BASE_N, or REMOVE_REF_BIAS (DO_NOTHING|SET_Q_ZERO|SET_Q_ZERO_BASE_N|REMOVE_REF_BIAS) + solid_nocall_strategy Defines the behavior of the recalibrator when it encounters no calls in the color space. Options = THROW_EXCEPTION, LEAVE_READ_UNRECALIBRATED, or PURGE_READ (THROW_EXCEPTION|LEAVE_READ_UNRECALIBRATED|PURGE_READ) + recal_file Filename for the input covariates table recalibration .gatk_report file + out The output BAM file + bam_compression Compression level to use for writing BAM files + disable_bam_indexing Turn off on-the-fly creation of indices for output BAM files. + simplifyBAM If provided, output BAM files will be simplified to include just key reads for downstream variation discovery analyses (removing duplicates, PF-, non-primary reads), as well stripping all extended tags from the kept reads except the read group identifier + preserve_qscores_less_than Bases with quality scores less than this threshold won't be recalibrated, default=5. In general it's unsafe to change qualities scores below < 5, since base callers use these values to indicate random or bad bases + smoothing Number of imaginary counts to add to each bin bin order to smooth out bins with few data points, default=1 + max_quality_score The integer value at which to cap the quality scores, default=50 + doNotWriteOriginalQuals If true, we will not write the original quality (OQ) tag for each read + +@CITATION_SECTION@ + </help> + <expand macro="citations" /> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/readme.rst Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,98 @@ +Galaxy wrapper for GATK2 +======================== + +This wrapper is copyright 2013 by Björn Grüning, Jim Johnson & the Galaxy Team. + +The Genome Analysis Toolkit or GATK is a software package developed at the +Broad Institute to analyse next-generation resequencing data. The toolkit offers +a wide variety of tools, with a primary focus on variant discovery and +genotyping as well as strong emphasis on data quality assurance. Its robust +architecture, powerful processing engine and high-performance computing features +make it capable of taking on projects of any size. + +http://www.broadinstitute.org/gatk +http://www.broadinstitute.org/gatk/about/citing-gatk + +GATK is Free for academics, and fee for commercial use. Please study the GATK licensing website: +http://www.broadinstitute.org/gatk/about/#licensing + + +Installation +============ + +The recommended installation is by means of the toolshed_. + +.. _toolshed: http://toolshed.g2.bx.psu.edu/view/iuc/gatk2 + +Galaxy should be able to install samtools dependencies automatically +for you. GATK2, and its new licence model, does not allow us to distribute the GATK binaries. +As a consequence you need to install GATK2 by your own, please see the GATK website for more information: + +http://www.broadinstitute.org/gatk/download + +Once you have installed GATK2, you need to edit the env.sh files that are installed together with the wrappers. +You must edit the GATK2_PATH environment variable in the file: + +<tool_dependency_dir>/environment_settings/GATK2_PATH/iuc/gatk2/<hash_string>/env.sh + +to point to the folder where you have installed GATK2. + +Optionally, you may also want to edit the GATK2_SITE_OPTIONS environment variable in the file: + +<tool_dependency_dir>/environment_settings/GATK2_SITE_OPTIONS/iuc/gatk2/<hash_string>/env.sh + +to deactivate the 'call home feature' of GATK with something like: + +GATK2_SITE_OPTIONS='-et NO_ET -K /data/gatk2_key_file' + +GATK2_SITE_OPTIONS can be also used to insert other specific options into every GATK2 wrapper +at runtime, without changing the actual wrapper. + +Read more about the "Phone Home" problem at: +http://www.broadinstitute.org/gatk/guide/article?id=1250 + +Optionally, you may also want to add some commands to be executed before GATK (e.g. to load modules) to the file: +:: + <tool_dependency_dir>/gatk2/default/env.sh + +Note that due to the manual nature of the GATK2 installation you will be getting the +following warnings in the Galaxy log (unless you specified the env.sh in the previous paragraph): +:: + Failed to resolve dependency on 'gatk2', ignoring. + +This is because the +:: + <requirement type="package">gatk2</requirement> +is specified but never resolved in the tool_dependencies.xml. It is safe to ignore. + +Finally, you should fill in additional information about your genomes and +annotations in the gatk2_picard_index.loc and gatk2_annotations.txt. +You can find them in the tool-data/ Galaxy directory. + +History +======= + +* v0.1 - Initial public release +* v2.8.0 - Bugfix release, increase version number to reflect the underlying GATK version + + +Licence (MIT) +============= + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in +all copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN +THE SOFTWARE.
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/realigner_target_creator.xml Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,174 @@ +<tool id="gatk2_realigner_target_creator" name="Realigner Target Creator" version="@VERSION@.1"> + <description>for use in local realignment</description> + <macros> + <import>gatk2_macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="version_command" /> + <command interpreter="python"> + gatk2_wrapper.py + --stdout "${output_log}" + -d "-I" "${reference_source.input_bam}" "${reference_source.input_bam.ext}" "gatk_input" + #if str( $reference_source.input_bam.metadata.bam_index ) != "None": + -d "" "${reference_source.input_bam.metadata.bam_index}" "bam_index" "gatk_input" ##hardcode galaxy ext type as bam_index + #end if + -p ' + @JAR_PATH@ + -T "RealignerTargetCreator" + -o "${output_interval}" + + \$GATK2_SITE_OPTIONS + + ## according to http://www.broadinstitute.org/gatk/guide/article?id=1975 + --num_cpu_threads_per_data_thread 1 + + @THREADS@ + + #if $reference_source.reference_source_selector != "history": + -R "${reference_source.ref_file.fields.path}" + #end if + ' + #set $rod_binding_names = dict() + #for $rod_binding in $rod_bind: + #if str( $rod_binding.rod_bind_type.rod_bind_type_selector ) == 'custom': + #set $rod_bind_name = $rod_binding.rod_bind_type.custom_rod_name + #else + #set $rod_bind_name = $rod_binding.rod_bind_type.rod_bind_type_selector + #end if + #set $rod_binding_names[$rod_bind_name] = $rod_binding_names.get( $rod_bind_name, -1 ) + 1 + -d "-known:${rod_bind_name},%(file_type)s" "${rod_binding.rod_bind_type.input_rod}" "${rod_binding.rod_bind_type.input_rod.ext}" "input_${rod_bind_name}_${rod_binding_names[$rod_bind_name]}" + #end for + + $allow_n_cigar_reads + #include source=$standard_gatk_options# + ##start analysis specific options + #if $analysis_param_type.analysis_param_type_selector == "advanced": + -p ' + --minReadsAtLocus "${analysis_param_type.minReadsAtLocus}" + --windowSize "${analysis_param_type.windowSize}" + --mismatchFraction "${analysis_param_type.mismatchFraction}" + --maxIntervalSize "${analysis_param_type.maxIntervalSize}" + ' + #end if + </command> + <inputs> + <conditional name="reference_source"> + <expand macro="reference_source_selector_param" /> + <when value="cached"> + <param name="input_bam" type="data" format="bam" label="BAM file" help="-I,--input_file &lt;input_file&gt;"> + <validator type="unspecified_build" /> + <validator type="dataset_metadata_in_data_table" table_name="gatk2_picard_indexes" metadata_name="dbkey" metadata_column="dbkey" message="Sequences are not currently available for the specified build." /> <!-- fixme!!! this needs to be a select --> + </param> + <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &lt;reference_sequence&gt;" > + <options from_data_table="gatk2_picard_indexes"> + <filter type="data_meta" key="dbkey" ref="input_bam" column="dbkey"/> + </options> + <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> + </param> + </when> + <when value="history"> + <param name="input_bam" type="data" format="bam" label="BAM file" help="-I,--input_file &lt;input_file&gt;" /> + <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &lt;reference_sequence&gt;"> + <options> + <filter type="data_meta" key="dbkey" ref="input_bam" /> + </options> + </param> + </when> + </conditional> + + <repeat name="rod_bind" title="Known Variants" help="Using data sets of known variants (-known,--known &lt;known&gt;)"> + <conditional name="rod_bind_type"> + <param name="rod_bind_type_selector" type="select" label="Variant Type"> + <option value="dbsnp" selected="True">dbSNP</option> + <option value="snps">SNPs</option> + <option value="indels">INDELs</option> + <option value="custom">Custom</option> + </param> + <when value="dbsnp"> + <param name="input_rod" type="data" format="vcf" label="Variant file (VCF format)" /> + </when> + <when value="snps"> + <param name="input_rod" type="data" format="vcf" label="Variant file (VCF format)" /> + </when> + <when value="indels"> + <param name="input_rod" type="data" format="vcf" label="Variant file (VCF format)" /> + </when> + <when value="custom"> + <param name="custom_rod_name" type="text" value="Unknown" label="Customer's variant file" /> + <param name="input_rod" type="data" format="vcf" label="Variant file (VCF format)" /> + </when> + </conditional> + </repeat> + + <expand macro="allow_n_cigar_reads" /> + <expand macro="gatk_param_type_conditional" /> + + <expand macro="analysis_type_conditional"> + <param name="windowSize" type="integer" value="10" label="Window size for calculating entropy or SNP clusters (windowSize)" + help="-window,--windowSize &lt;windowSize&gt;" /> + <param name="mismatchFraction" type="float" value="0.15" label="Fraction of base qualities needing to mismatch for a position to have high entropy (mismatchFraction)" + help="to disable set to <= 0 or > 1 (-mismatch,--mismatchFraction &lt;mismatchFraction&gt;)"/> + <param name="minReadsAtLocus" type="integer" value="4" label="Minimum reads at a locus to enable using the entropy calculation (minReadsAtLocus)" + help="-minReads,--minReadsAtLocus &lt;minReadsAtLocus&gt;" /> + <param name="maxIntervalSize" type="integer" value="500" label="Maximum interval size" help="-maxInterval,--maxIntervalSize &lt;maxIntervalSize&gt;" /> + </expand> + </inputs> + <outputs> + <data format="gatk_interval" name="output_interval" label="${tool.name} on ${on_string} (GATK intervals)" /> + <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" /> + </outputs> + <tests> + <test> + <param name="reference_source_selector" value="history" /> + <param name="ref_file" value="phiX.fasta" ftype="fasta" /> + <param name="input_bam" value="gatk/fake_phiX_reads_1.bam" ftype="bam" /> + <param name="rod_bind_type_selector" value="dbsnp" /> + <param name="input_rod" value="gatk/fake_phiX_variant_locations.vcf" ftype="vcf" /> + <param name="gatk_param_type_selector" value="basic" /> + <param name="analysis_param_type_selector" value="advanced" /> + <param name="windowSize" value="10" /> + <param name="mismatchFraction" value="0.15" /> + <param name="minReadsAtLocus" value="4" /> + <param name="maxIntervalSize" value="500" /> + <output name="output_interval" file="gatk/gatk_realigner_target_creator/gatk_realigner_target_creator_out_1.gatk_interval" /> + <output name="output_log" file="gatk/gatk_realigner_target_creator/gatk_realigner_target_creator_out_1.log.contains" compare="contains"/> + </test> + </tests> + <help> +**What it does** + +Emits intervals for the Local Indel Realigner to target for cleaning. Ignores 454 reads, MQ0 reads, and reads with consecutive indel operators in the CIGAR string. + +For more information on local realignment around indels using the GATK, see this `tool specific page <http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_indels_RealignerTargetCreator.html>`_. + +To learn about best practices for variant detection using GATK, see this `overview <http://www.broadinstitute.org/gatk/guide/topic?name=best-practices>`_. + +If you encounter errors, please view the `GATK FAQ <http://www.broadinstitute.org/gatk/guide/topic?name=faqs>`_. + +------ + +**Inputs** + +GenomeAnalysisTK: RealignerTargetCreator accepts an aligned BAM input file. + + +**Outputs** + +The output is in GATK Interval format. + + +Go `here <http://www.broadinstitute.org/gatk/guide/topic?name=intro>`_ for details on GATK file formats. + +------- + +**Settings**:: + + windowSize window size for calculating entropy or SNP clusters + mismatchFraction fraction of base qualities needing to mismatch for a position to have high entropy; to disable set to <= 0 or > 1 + minReadsAtLocus minimum reads at a locus to enable using the entropy calculation + maxIntervalSize maximum interval size + +@CITATION_SECTION@ + </help> + <expand macro="citations" /> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/reduce_reads.xml Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,228 @@ +<tool id="gatk2_reduce_reads" name="Reduce Reads" version="@VERSION@.0"> + <description>in BAM files</description> + <macros> + <import>gatk2_macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="version_command" /> + <command interpreter="python"> + gatk2_wrapper.py + --stdout "${output_log}" + -d "-I" "${reference_source.input_bam}" "${reference_source.input_bam.ext}" "gatk_input" + #if str( $reference_source.input_bam.metadata.bam_index ) != "None": + -d "" "${reference_source.input_bam.metadata.bam_index}" "bam_index" "gatk_input" ##hardcode galaxy ext type as bam_index + #end if + -p ' + @JAR_PATH@ + -T "ReduceReads" + -o "${output_bam}" + + \$GATK2_SITE_OPTIONS + + ## according to http://www.broadinstitute.org/gatk/guide/article?id=1975 + --num_cpu_threads_per_data_thread 1 + + #if $reference_source.reference_source_selector != "history": + -R "${reference_source.ref_file.fields.path}" + #end if + #if str($input_recal) != 'None': + --BQSR "${input_recal}" + #end if + --disable_bam_indexing + ' + #include source=$standard_gatk_options# + + ##start analysis specific options + #if $analysis_param_type.analysis_param_type_selector == "advanced": + -p ' + #if $analysis_param_type.context_size.__str__.strip() != '': + --context_size $analysis_param_type.context_size + #end if + #if $analysis_param_type.downsample_coverage.__str__.strip() != '': + --downsample_coverage $analysis_param_type.downsample_coverage + #end if + #if $analysis_param_type.minimum_del_proportion_to_trigger_variant.__str__.strip() != '': + --minimum_del_proportion_to_trigger_variant $analysis_param_type.minimum_del_proportion_to_trigger_variant + #end if + #if $analysis_param_type.minimum_mapping_quality.__str__.strip() != '': + --minimum_mapping_quality $analysis_param_type.minimum_mapping_quality + #end if + #if $analysis_param_type.minimum_tail_qualities.__str__.strip() != '': + --minimum_tail_qualities $analysis_param_type.minimum_tail_qualities + #end if + #if $analysis_param_type.minimum_base_quality_to_consider.__str__.strip() != '': + --minimum_base_quality_to_consider $analysis_param_type.minimum_base_quality_to_consider + #end if + #if $analysis_param_type.minimum_alt_proportion_to_trigger_variant.__str__.strip() != '': + --minimum_alt_proportion_to_trigger_variant $analysis_param_type.minimum_alt_proportion_to_trigger_variant + #end if + $analysis_param_type.allow_polyploid_reduction + $analysis_param_type.dont_compress_read_names + $analysis_param_type.dont_hardclip_low_qual_tails + $analysis_param_type.dont_simplify_reads + $analysis_param_type.dont_use_softclipped_bases + $analysis_param_type.hard_clip_to_interval + $analysis_param_type.dont_hardclip_adaptor_sequences + ' + #end if + </command> + <inputs> + <param name="input_recal" type="data" format="csv" optional="true" label="Covariates table recalibration file" help="The input covariates table file which enables on-the-fly base quality score recalibration. Enables on-the-fly recalibrate of base qualities. The covariates tables are produced by the BaseQualityScoreRecalibrator tool. Please be aware that one should only run recalibration with the covariates file created on the same input bam(s) (-BQSR,--BQSR &lt;recal_file&gt;)" /> + <conditional name="reference_source"> + <expand macro="reference_source_selector_param" /> + <when value="cached"> + <param name="input_bam" type="data" format="bam" label="BAM file" help="-I,--input_file &lt;input_file&gt;"> + <validator type="unspecified_build" /> + <validator type="dataset_metadata_in_data_table" table_name="gatk2_picard_indexes" metadata_name="dbkey" metadata_column="dbkey" message="Sequences are not currently available for the specified build." /> <!-- fixme!!! this needs to be a select --> + </param> + <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &lt;reference_sequence&gt;" > + <options from_data_table="gatk2_picard_indexes"> + <filter type="data_meta" key="dbkey" ref="input_bam" column="dbkey"/> + </options> + <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> + </param> + </when> + <when value="history"> + <param name="input_bam" type="data" format="bam" label="BAM file" help="-I,--input_file &lt;input_file&gt;" /> + <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &lt;reference_sequence&gt;"> + <options> + <filter type="data_meta" key="dbkey" ref="input_bam" /> + </options> + </param> + </when> + </conditional> + + <expand macro="gatk_param_type_conditional" /> + + <conditional name="analysis_param_type"> + <param name="analysis_param_type_selector" type="select" label="Basic or Advanced Analysis options"> + <option value="basic" selected="True">Basic</option> + <option value="advanced">Advanced</option> + </param> + <when value="basic"> + <!-- Do nothing here --> + </when> + <when value="advanced"> + <param name="allow_polyploid_reduction" type="boolean" checked="False" truevalue="-polyploid" falsevalue="" label="Allow polyploid-based reduction" help="--allow_polyploid_reduction / -polyploid Allow the experimental polyploid-based reduction capabilities"/> + <param name="context_size" type="integer" value="10" optional="true" label="context_size" help="The number of bases to keep around mismatches (potential variation)"> + </param> + <param name="dont_compress_read_names" type="boolean" checked="False" truevalue="-nocmp_names" falsevalue="" label="Do not compress read names." help="--dont_compress_read_names / -nocmp_names By default, ReduceReads will compress read names to numbers and guarantee uniqueness and reads with similar name will still have similar compressed names. Note: If you scatter/gather there is no guarantee that read name uniqueness will be maintained -- in this case we recommend not compressing."/> + <param name="dont_hardclip_low_qual_tails" type="boolean" checked="False" truevalue="-noclip_tail" falsevalue="" label="Do not hard clip the low quality tails of the reads" help="--dont_hardclip_low_qual_tails / -noclip_tail This option overrides the argument of minimum tail quality"/> + + <param name="dont_simplify_reads" type="boolean" checked="False" truevalue="-nosimplify" falsevalue="" label="Do not simplify read" help="--dont_simplify_reads / -nosimplify Do not simplify read (strip away all extra information of the read -- anything other than bases, quals and read group)."/> + <param name="dont_use_softclipped_bases" type="boolean" checked="False" truevalue="-no_soft" falsevalue="" label="Do not use high quality soft-clipped bases" help="--dont_use_softclipped_bases / -no_soft Do not use high quality soft-clipped bases. By default, ReduceReads will hard clip away any low quality soft clipped base left by the aligner and use the high quality soft clipped bases in it's traversal algorithm to identify variant regions. The minimum quality for soft clipped bases is the same as the minimum base quality to consider (minqual)"/> + <param name="downsample_coverage" type="integer" value="250" optional="true" label="Downsample the coverage of a variable region" help="Downsamples the coverage of a variable region approximately (guarantees the minimum to be equal to this). A value of 0 turns downsampling off."> + </param> + <param name="hard_clip_to_interval" type="boolean" checked="False" truevalue="-clip_int" falsevalue="" label="Hard clip all incoming reads" help="--hard_clip_to_interval / -clip_int Optionally hard clip all incoming reads to the desired intervals. The hard clips will happen exactly at the interval border."/> + <param name="minimum_del_proportion_to_trigger_variant" type="float" value="0.05" optional="true" label="Minimum proportion of indels in a site to trigger a variant region" help="--minimum_del_proportion_to_trigger_variant / -mindel Minimum proportion of indels in a site to trigger a variant region. Anything below this will be considered consensus. "> + </param> + <param name="minimum_mapping_quality" type="integer" value="20" optional="true" label="Minimum mapping quality for consensus read" help="--minimum_mapping_quality / -minmap The minimum mapping quality to be considered for the consensus synthetic read. Reads that have mapping quality below this threshold will not be counted towards consensus, but are still counted towards variable regions."> + </param> + <param name="minimum_tail_qualities" type="integer" value="2" optional="true" label="Minimum tail quality" help="--minimum_tail_qualities / -mintail Reads have notoriously low quality bases on the tails (left and right). Consecutive bases with quality lower than this threshold will be hard clipped off before entering the reduce reads algorithm."> + <validator type="in_range" message="value between 0 and 127" min="0" max="127"/> + </param> + <param name="minimum_base_quality_to_consider" type="integer" value="20" optional="true" label="Minimum mapping quality for consensus read" help="--minimum_mapping_quality / -minmap The minimum mapping quality to be considered for the consensus synthetic read. Reads that have mapping quality below this threshold will not be counted towards consensus, but are still counted towards variable regions."> + <validator type="in_range" message="value between 0 and 127" min="0" max="127"/> + </param> + <param name="minimum_alt_proportion_to_trigger_variant" type="float" value="0.05" optional="true" label="Minimum proportion of mismatches in a site to trigger a variant region" help="--minimum_alt_proportion_to_trigger_variant / -minvar Minimum proportion of mismatches in a site to trigger a variant region. Anything below this will be considered consensus."> + <validator type="in_range" message="value between 0.00 and 1.00" min="0.0" max="1.0"/> + </param> + <param name="dont_hardclip_adaptor_sequences" type="boolean" checked="False" truevalue="-noclip_ad" falsevalue="" label="Do not hard clip adaptor sequences" help="--dont_hardclip_adaptor_sequences / -noclip_ad Do not hard clip adaptor sequences. Note: You don't have to turn this on for reads that are not mate paired. The program will behave correctly in those cases."/> + </when> + </conditional> + </inputs> + <outputs> + <data format="bam" name="output_bam" label="${tool.name} on ${on_string} (BAM)" /> + <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" /> + </outputs> + <tests> + <test> + <param name="input_recal" value="gatk/gatk_count_covariates/gatk_count_covariates_out_1.csv" ftype="csv" /> + <param name="reference_source_selector" value="history" /> + <param name="ref_file" value="phiX.fasta" ftype="fasta" /> + <param name="input_bam" value="gatk/gatk_indel_realigner/gatk_indel_realigner_out_1.bam" ftype="bam" /> + <param name="gatk_param_type_selector" value="basic" /> + <param name="analysis_param_type_selector" value="basic" /> + <output name="output_bam" file="gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.bam" ftype="bam" lines_diff="4" /> + <output name="output_log" file="gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.log.contains" compare="contains" /> + </test> + </tests> + <help> +**What it does** + +ReduceReads +Reduces the BAM file using read based compression that keeps only essential information for variant calling + +This walker will generated reduced versions of the BAM files that still follow the BAM spec and contain all the information necessary for the GSA variant calling pipeline. Some options allow you to tune in how much compression you want to achieve. The default values have been shown to reduce a typical whole exome BAM file 100x. The higher the coverage, the bigger the savings in file size and performance of the downstream tools. + +.. For more information on using read based compression in the GATK, see this `tool specific page <http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_compression_reducereads_ReduceReads.html>`_. + +To learn about best practices for variant detection using GATK, see this `overview <http://www.broadinstitute.org/gatk/guide/topic?name=best-practices>`_. + +If you encounter errors, please view the `GATK FAQ <http://www.broadinstitute.org/gatk/guide/topic?name=faqs>`_. + +------ + +**Inputs** + +GenomeAnalysisTK: PrintReads accepts an aligned BAM and a recalibration CSV input files. + + +**Outputs** + +The output is in BAM format. + + +Go `here <http://www.broadinstitute.org/gatk/guide/topic?name=intro>`_ for details on GATK file formats. + +------- + +**Settings**:: + + + --allow_polyploid_reduction / -polyploid ( boolean with default value false ) + Allow the experimental polyploid-based reduction capabilities of this tool + + --context_size / -cs ( int with default value 10 ) + The number of bases to keep around mismatches (potential variation) + + --dont_compress_read_names / -nocmp_names ( boolean with default value false ) + Do not compress read names. By default, ReduceReads will compress read names to numbers and guarantee uniqueness and reads with similar name will still have similar compressed names. Note: If you scatter/gather there is no guarantee that read name uniqueness will be maintained -- in this case we recommend not compressing. + + --dont_hardclip_low_qual_tails / -noclip_tail ( boolean with default value false ) + Do not hard clip the low quality tails of the reads. This option overrides the argument of minimum tail quality. + + --dont_simplify_reads / -nosimplify ( boolean with default value false ) + Do not simplify read (strip away all extra information of the read -- anything other than bases, quals and read group). + + --dont_use_softclipped_bases / -no_soft ( boolean with default value false ) + Do not use high quality soft-clipped bases. By default, ReduceReads will hard clip away any low quality soft clipped base left by the aligner and use the high quality soft clipped bases in it's traversal algorithm to identify variant regions. The minimum quality for soft clipped bases is the same as the minimum base quality to consider (minqual) + + --downsample_coverage / -ds ( int with default value 250 ) + Downsamples the coverage of a variable region approximately (guarantees the minimum to be equal to this). A value of 0 turns downsampling off. + + --hard_clip_to_interval / -clip_int ( boolean with default value false ) + Optionally hard clip all incoming reads to the desired intervals. The hard clips will happen exactly at the interval border. + + -mindel / --minimum_del_proportion_to_trigger_variant ( double with default value 0.05 ) + Minimum proportion of indels in a site to trigger a variant region. Anything below this will be considered consensus. + + --minimum_mapping_quality / -minmap ( int with default value 20 ) + The minimum mapping quality to be considered for the consensus synthetic read. Reads that have mapping quality below this threshold will not be counted towards consensus, but are still counted towards variable regions. + + --minimum_tail_qualities / -mintail ( byte with default value 2 ) + Reads have notoriously low quality bases on the tails (left and right). Consecutive bases with quality lower than this threshold will be hard clipped off before entering the reduce reads algorithm. + + -minqual / --minimum_base_quality_to_consider ( byte with default value 20 ) + The minimum base quality to be considered for the consensus synthetic read. Reads that have base quality below this threshold will not be counted towards consensus, but are still counted towards variable regions. + + -minvar / --minimum_alt_proportion_to_trigger_variant ( double with default value 0.05 ) + Minimum proportion of mismatches in a site to trigger a variant region. Anything below this will be considered consensus. + + -noclip_ad / --dont_hardclip_adaptor_sequences ( boolean with default value false ) + Do not hard clip adaptor sequences. Note: You don't have to turn this on for reads that are not mate paired. The program will behave correctly in those cases. + +@CITATION_SECTION@ + </help> + <expand macro="citations" /> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/fake_phiX_variant_locations.bed Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,2 @@ +phiX174 1442 1443 +phiX174 1445 1446
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/fake_phiX_variant_locations.vcf Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,70 @@ +##fileformat=VCFv4.1 +##samtoolsVersion=0.1.18 (r982:295) +##INFO=<ID=DP,Number=1,Type=Integer,Description="Raw read depth"> +##INFO=<ID=DP4,Number=4,Type=Integer,Description="# high-quality ref-forward bases, ref-reverse, alt-forward and alt-reverse bases"> +##INFO=<ID=MQ,Number=1,Type=Integer,Description="Root-mean-square mapping quality of covering reads"> +##INFO=<ID=FQ,Number=1,Type=Float,Description="Phred probability of all samples being the same"> +##INFO=<ID=AF1,Number=1,Type=Float,Description="Max-likelihood estimate of the first ALT allele frequency (assuming HWE)"> +##INFO=<ID=AC1,Number=1,Type=Float,Description="Max-likelihood estimate of the first ALT allele count (no HWE assumption)"> +##INFO=<ID=G3,Number=3,Type=Float,Description="ML estimate of genotype frequencies"> +##INFO=<ID=HWE,Number=1,Type=Float,Description="Chi^2 based HWE test P-value based on G3"> +##INFO=<ID=CLR,Number=1,Type=Integer,Description="Log ratio of genotype likelihoods with and without the constraint"> +##INFO=<ID=UGT,Number=1,Type=String,Description="The most probable unconstrained genotype configuration in the trio"> +##INFO=<ID=CGT,Number=1,Type=String,Description="The most probable constrained genotype configuration in the trio"> +##INFO=<ID=PV4,Number=4,Type=Float,Description="P-values for strand bias, baseQ bias, mapQ bias and tail distance bias"> +##INFO=<ID=INDEL,Number=0,Type=Flag,Description="Indicates that the variant is an INDEL."> +##INFO=<ID=PC2,Number=2,Type=Integer,Description="Phred probability of the nonRef allele frequency in group1 samples being larger (,smaller) than in group2."> +##INFO=<ID=PCHI2,Number=1,Type=Float,Description="Posterior weighted chi^2 P-value for testing the association between group1 and group2 samples."> +##INFO=<ID=QCHI2,Number=1,Type=Integer,Description="Phred scaled PCHI2."> +##INFO=<ID=PR,Number=1,Type=Integer,Description="# permutations yielding a smaller PCHI2."> +##INFO=<ID=VDB,Number=1,Type=Float,Description="Variant Distance Bias"> +##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype"> +##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality"> +##FORMAT=<ID=GL,Number=3,Type=Float,Description="Likelihoods for RR,RA,AA genotypes (R=ref,A=alt)"> +##FORMAT=<ID=DP,Number=1,Type=Integer,Description="# high-quality bases"> +##FORMAT=<ID=SP,Number=1,Type=Integer,Description="Phred-scaled strand bias P-value"> +##FORMAT=<ID=PL,Number=G,Type=Integer,Description="List of Phred-scaled genotype likelihoods"> +#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT A Fake phiX Sample +phiX174 1411 . A . 28.2 . DP=1;;AC1=2;FQ=-30 PL 0 +phiX174 1412 . G . 28.2 . DP=3;;AC1=2;FQ=-30 PL 0 +phiX174 1413 . C . 28.2 . DP=5;;AC1=2;FQ=-30 PL 0 +phiX174 1414 . G . 28.2 . DP=6;;AC1=2;FQ=-30 PL 0 +phiX174 1415 . C . 28.2 . DP=7;;AC1=2;FQ=-30 PL 0 +phiX174 1416 . C . 28.2 . DP=8;;AC1=2;FQ=-30 PL 0 +phiX174 1417 . G . 28.2 . DP=9;;AC1=2;FQ=-30 PL 0 +phiX174 1418 . T . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1419 . G . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1420 . G . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1421 . A . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1422 . T . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1423 . G . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1424 . C . 28.2 . DP=10;VDB=0.0005;;AC1=2;FQ=-30 PL 0 +phiX174 1425 . C . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1426 . T . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1427 . G . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1428 . A . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1429 . C . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1430 . C . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1431 . G . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1432 . T . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1433 . A . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1434 . C . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1435 . C . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1436 . G . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1437 . A . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1438 . G . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1439 . G . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1440 . C . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1441 . T . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1442 . A . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1443 . A . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1444 . C . 28.2 . DP=7;;AC1=2;FQ=-30 PL 0 +phiX174 1445 . C . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1446 . C . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1447 . T . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1448 . A . 28.2 . DP=8;;AC1=2;FQ=-30 PL 0 +phiX174 1449 . A . 28.2 . DP=6;;AC1=2;FQ=-30 PL 0 +phiX174 1450 . T . 28.2 . DP=4;;AC1=2;FQ=-30 PL 0 +phiX174 1451 . G . 28.2 . DP=3;;AC1=2;FQ=-30 PL 0 +phiX174 1452 . A . 28.2 . DP=2;;AC1=2;FQ=-30 PL 0 +phiX174 1453 . G . 28.2 . DP=1;;AC1=2;FQ=-30 PL 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_analyze_covariates/gatk_analyze_covariates_out_1.html Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,34 @@ +<html> +<head> +<title>Galaxy - GATK Output</title> +</head> +<body> +<p/> +<ul> +<li><a href="A Fake phiX Sample.CycleCovariate.dat">A Fake phiX Sample.CycleCovariate.dat</a></li> +<li><a href="A Fake phiX Sample.CycleCovariate.dat.Cycle_hist.pdf">A Fake phiX Sample.CycleCovariate.dat.Cycle_hist.pdf</a></li> +<li><a href="A Fake phiX Sample.CycleCovariate.dat.qual_diff_v_Cycle.pdf">A Fake phiX Sample.CycleCovariate.dat.qual_diff_v_Cycle.pdf</a></li> +<li><a href="A Fake phiX Sample.CycleCovariate.dat.reported_qual_v_Cycle.pdf">A Fake phiX Sample.CycleCovariate.dat.reported_qual_v_Cycle.pdf</a></li> +<li><a href="A Fake phiX Sample.DinucCovariate.dat">A Fake phiX Sample.DinucCovariate.dat</a></li> +<li><a href="A Fake phiX Sample.DinucCovariate.dat.Dinuc_hist.pdf">A Fake phiX Sample.DinucCovariate.dat.Dinuc_hist.pdf</a></li> +<li><a href="A Fake phiX Sample.DinucCovariate.dat.qual_diff_v_Dinuc.pdf">A Fake phiX Sample.DinucCovariate.dat.qual_diff_v_Dinuc.pdf</a></li> +<li><a href="A Fake phiX Sample.DinucCovariate.dat.reported_qual_v_Dinuc.pdf">A Fake phiX Sample.DinucCovariate.dat.reported_qual_v_Dinuc.pdf</a></li> +<li><a href="A Fake phiX Sample.HomopolymerCovariate.dat">A Fake phiX Sample.HomopolymerCovariate.dat</a></li> +<li><a href="A Fake phiX Sample.HomopolymerCovariate.dat.Homopolymer_hist.pdf">A Fake phiX Sample.HomopolymerCovariate.dat.Homopolymer_hist.pdf</a></li> +<li><a href="A Fake phiX Sample.HomopolymerCovariate.dat.qual_diff_v_Homopolymer.pdf">A Fake phiX Sample.HomopolymerCovariate.dat.qual_diff_v_Homopolymer.pdf</a></li> +<li><a href="A Fake phiX Sample.HomopolymerCovariate.dat.reported_qual_v_Homopolymer.pdf">A Fake phiX Sample.HomopolymerCovariate.dat.reported_qual_v_Homopolymer.pdf</a></li> +<li><a href="A Fake phiX Sample.MinimumNQSCovariate.dat">A Fake phiX Sample.MinimumNQSCovariate.dat</a></li> +<li><a href="A Fake phiX Sample.MinimumNQSCovariate.dat.MinimumNQS_hist.pdf">A Fake phiX Sample.MinimumNQSCovariate.dat.MinimumNQS_hist.pdf</a></li> +<li><a href="A Fake phiX Sample.MinimumNQSCovariate.dat.qual_diff_v_MinimumNQS.pdf">A Fake phiX Sample.MinimumNQSCovariate.dat.qual_diff_v_MinimumNQS.pdf</a></li> +<li><a href="A Fake phiX Sample.MinimumNQSCovariate.dat.reported_qual_v_MinimumNQS.pdf">A Fake phiX Sample.MinimumNQSCovariate.dat.reported_qual_v_MinimumNQS.pdf</a></li> +<li><a href="A Fake phiX Sample.PositionCovariate.dat">A Fake phiX Sample.PositionCovariate.dat</a></li> +<li><a href="A Fake phiX Sample.PositionCovariate.dat.Position_hist.pdf">A Fake phiX Sample.PositionCovariate.dat.Position_hist.pdf</a></li> +<li><a href="A Fake phiX Sample.PositionCovariate.dat.qual_diff_v_Position.pdf">A Fake phiX Sample.PositionCovariate.dat.qual_diff_v_Position.pdf</a></li> +<li><a href="A Fake phiX Sample.PositionCovariate.dat.reported_qual_v_Position.pdf">A Fake phiX Sample.PositionCovariate.dat.reported_qual_v_Position.pdf</a></li> +<li><a href="A Fake phiX Sample.QualityScoreCovariate.dat">A Fake phiX Sample.QualityScoreCovariate.dat</a></li> +<li><a href="A Fake phiX Sample.QualityScoreCovariate.dat.quality_emp_hist.pdf">A Fake phiX Sample.QualityScoreCovariate.dat.quality_emp_hist.pdf</a></li> +<li><a href="A Fake phiX Sample.QualityScoreCovariate.dat.quality_emp_v_stated.pdf">A Fake phiX Sample.QualityScoreCovariate.dat.quality_emp_v_stated.pdf</a></li> +<li><a href="A Fake phiX Sample.QualityScoreCovariate.dat.quality_rep_hist.pdf">A Fake phiX Sample.QualityScoreCovariate.dat.quality_rep_hist.pdf</a></li> +</ul> +</body> +</html>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_analyze_covariates/gatk_analyze_covariates_out_1.log.contains Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,9 @@ +Program Name: org.broadinstitute.sting.analyzecovariates.AnalyzeCovariates +Reading in input csv file... +...Done! +Writing out intermediate tables for R... +Writing out data tables for read group: A Fake phiX Sample with 340 observations and aggregate residual error = -9.136 +...Done! +Calling analysis R scripts and writing out figures... +Analyzing read group: A Fake phiX Sample +...Done!
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_count_covariates/gatk_count_covariates_out_1.csv Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,246 @@ +# Counted Sites 41 +# Counted Bases 340 +# Skipped Sites 2 +# Fraction Skipped 1 / 21 bp +ReadGroup,QualityScore,Cycle,Dinuc,Homopolymer,MinimumNQS,Position,nObservations,nMismatches,Qempirical +A Fake phiX Sample,26,1,NN,0,26,0,9,0,40 +A Fake phiX Sample,26,1,NN,1,26,0,1,0,40 +A Fake phiX Sample,26,2,AG,0,26,1,1,0,40 +A Fake phiX Sample,26,2,CC,0,26,1,1,0,40 +A Fake phiX Sample,26,2,CG,0,26,1,3,0,40 +A Fake phiX Sample,26,2,GC,0,26,1,2,0,40 +A Fake phiX Sample,26,2,GC,1,26,1,1,0,40 +A Fake phiX Sample,26,2,GT,0,26,1,1,0,40 +A Fake phiX Sample,26,2,TG,1,26,1,1,0,40 +A Fake phiX Sample,26,3,CC,0,26,2,1,0,40 +A Fake phiX Sample,26,3,CG,0,26,2,3,0,40 +A Fake phiX Sample,26,3,GC,0,26,2,1,0,40 +A Fake phiX Sample,26,3,GC,1,26,2,2,0,40 +A Fake phiX Sample,26,3,GG,0,26,2,1,0,40 +A Fake phiX Sample,26,3,GT,0,26,2,1,0,40 +A Fake phiX Sample,26,3,TG,1,26,2,1,0,40 +A Fake phiX Sample,26,4,CC,0,26,3,2,0,40 +A Fake phiX Sample,26,4,CG,0,26,3,2,0,40 +A Fake phiX Sample,26,4,GA,0,26,3,1,0,40 +A Fake phiX Sample,26,4,GC,1,26,3,2,0,40 +A Fake phiX Sample,26,4,GG,0,26,3,1,0,40 +A Fake phiX Sample,26,4,GT,0,26,3,1,0,40 +A Fake phiX Sample,26,4,TG,1,26,3,1,0,40 +A Fake phiX Sample,26,5,AT,0,26,4,1,0,40 +A Fake phiX Sample,26,5,CC,0,26,4,2,0,40 +A Fake phiX Sample,26,5,CG,0,26,4,2,0,40 +A Fake phiX Sample,26,5,GA,0,26,4,1,0,40 +A Fake phiX Sample,26,5,GC,1,26,4,1,0,40 +A Fake phiX Sample,26,5,GG,0,26,4,1,0,40 +A Fake phiX Sample,26,5,GT,0,26,4,1,0,40 +A Fake phiX Sample,26,5,TG,1,26,4,1,0,40 +A Fake phiX Sample,26,6,AT,0,26,5,1,0,40 +A Fake phiX Sample,26,6,CC,0,26,5,1,0,40 +A Fake phiX Sample,26,6,CG,0,26,5,2,0,40 +A Fake phiX Sample,26,6,GA,0,26,5,1,0,40 +A Fake phiX Sample,26,6,GG,0,26,5,1,0,40 +A Fake phiX Sample,26,6,GT,0,26,5,2,0,40 +A Fake phiX Sample,26,6,TG,0,26,5,1,0,40 +A Fake phiX Sample,26,6,TG,1,26,5,1,0,40 +A Fake phiX Sample,26,7,AT,0,26,6,1,0,40 +A Fake phiX Sample,26,7,CG,0,26,6,1,0,40 +A Fake phiX Sample,26,7,GA,0,26,6,2,1,3 +A Fake phiX Sample,26,7,GG,0,26,6,1,0,40 +A Fake phiX Sample,26,7,GT,0,26,6,2,0,40 +A Fake phiX Sample,26,7,TG,0,26,6,1,0,40 +A Fake phiX Sample,26,7,TG,1,26,6,2,0,40 +A Fake phiX Sample,26,8,AC,0,26,7,1,0,40 +A Fake phiX Sample,26,8,AT,0,26,7,1,0,40 +A Fake phiX Sample,26,8,GA,0,26,7,2,1,3 +A Fake phiX Sample,26,8,GG,0,26,7,2,0,40 +A Fake phiX Sample,26,8,GT,0,26,7,1,0,40 +A Fake phiX Sample,26,8,TG,0,26,7,1,0,40 +A Fake phiX Sample,26,8,TG,1,26,7,2,0,40 +A Fake phiX Sample,26,9,AC,0,26,8,1,0,40 +A Fake phiX Sample,26,9,AT,0,26,8,1,0,40 +A Fake phiX Sample,26,9,CT,0,26,8,1,0,40 +A Fake phiX Sample,26,9,GA,0,26,8,3,1,5 +A Fake phiX Sample,26,9,GG,0,26,8,2,0,40 +A Fake phiX Sample,26,9,TG,0,26,8,1,0,40 +A Fake phiX Sample,26,9,TG,1,26,8,1,0,40 +A Fake phiX Sample,26,10,AC,0,26,9,1,0,40 +A Fake phiX Sample,26,10,AT,0,26,9,2,0,40 +A Fake phiX Sample,26,10,CT,0,26,9,1,0,40 +A Fake phiX Sample,26,10,GA,0,26,9,3,1,5 +A Fake phiX Sample,26,10,GG,0,26,9,1,0,40 +A Fake phiX Sample,26,10,TG,0,26,9,2,0,40 +A Fake phiX Sample,26,11,AC,0,26,10,1,0,40 +A Fake phiX Sample,26,11,AT,0,26,10,2,0,40 +A Fake phiX Sample,26,11,CT,0,26,10,1,0,40 +A Fake phiX Sample,26,11,GA,0,26,10,3,1,5 +A Fake phiX Sample,26,11,TG,0,26,10,3,0,40 +A Fake phiX Sample,26,12,AC,0,26,11,1,0,40 +A Fake phiX Sample,26,12,AC,1,26,11,1,0,40 +A Fake phiX Sample,26,12,AT,0,26,11,1,0,40 +A Fake phiX Sample,26,12,CT,0,26,11,1,0,40 +A Fake phiX Sample,26,12,GA,0,26,11,2,1,3 +A Fake phiX Sample,26,12,GC,1,26,11,1,0,40 +A Fake phiX Sample,26,12,TG,0,26,11,3,0,40 +A Fake phiX Sample,26,13,AC,0,26,12,1,0,40 +A Fake phiX Sample,26,13,AC,1,26,12,1,0,40 +A Fake phiX Sample,26,13,CC,0,26,12,2,0,40 +A Fake phiX Sample,26,13,CT,0,26,12,1,0,40 +A Fake phiX Sample,26,13,GA,0,26,12,2,1,3 +A Fake phiX Sample,26,13,GC,1,26,12,1,0,40 +A Fake phiX Sample,26,13,TG,0,26,12,2,0,40 +A Fake phiX Sample,26,14,AC,0,26,13,1,0,40 +A Fake phiX Sample,26,14,AC,1,26,13,1,0,40 +A Fake phiX Sample,26,14,CC,0,26,13,2,0,40 +A Fake phiX Sample,26,14,CG,0,26,13,1,0,40 +A Fake phiX Sample,26,14,CT,0,26,13,2,0,40 +A Fake phiX Sample,26,14,GA,0,26,13,1,0,40 +A Fake phiX Sample,26,14,GC,1,26,13,1,0,40 +A Fake phiX Sample,26,14,TG,0,26,13,1,0,40 +A Fake phiX Sample,26,15,AC,1,26,14,1,0,40 +A Fake phiX Sample,26,15,CC,0,26,14,2,0,40 +A Fake phiX Sample,26,15,CG,0,26,14,1,0,40 +A Fake phiX Sample,26,15,CT,0,26,14,2,0,40 +A Fake phiX Sample,26,15,GA,0,26,14,1,0,40 +A Fake phiX Sample,26,15,GT,0,26,14,1,0,40 +A Fake phiX Sample,26,15,TG,0,26,14,2,0,40 +A Fake phiX Sample,26,16,AC,1,26,15,1,0,40 +A Fake phiX Sample,26,16,CC,0,26,15,1,0,40 +A Fake phiX Sample,26,16,CG,0,26,15,1,0,40 +A Fake phiX Sample,26,16,CT,0,26,15,1,0,40 +A Fake phiX Sample,26,16,GA,0,26,15,2,0,40 +A Fake phiX Sample,26,16,GT,0,26,15,1,0,40 +A Fake phiX Sample,26,16,TA,0,26,15,1,0,40 +A Fake phiX Sample,26,16,TG,0,26,15,2,0,40 +A Fake phiX Sample,26,17,AC,1,26,16,3,0,40 +A Fake phiX Sample,26,17,CC,0,26,16,1,0,40 +A Fake phiX Sample,26,17,CG,0,26,16,1,0,40 +A Fake phiX Sample,26,17,GA,0,26,16,2,0,40 +A Fake phiX Sample,26,17,GT,0,26,16,1,0,40 +A Fake phiX Sample,26,17,TA,0,26,16,1,0,40 +A Fake phiX Sample,26,17,TG,0,26,16,1,0,40 +A Fake phiX Sample,26,18,AC,1,26,17,3,0,40 +A Fake phiX Sample,26,18,CC,0,26,17,3,0,40 +A Fake phiX Sample,26,18,CG,0,26,17,1,0,40 +A Fake phiX Sample,26,18,GA,0,26,17,1,0,40 +A Fake phiX Sample,26,18,GT,0,26,17,1,0,40 +A Fake phiX Sample,26,18,TA,0,26,17,1,0,40 +A Fake phiX Sample,26,19,AC,1,26,18,2,0,40 +A Fake phiX Sample,26,19,CC,0,26,18,3,0,40 +A Fake phiX Sample,26,19,CG,0,26,18,3,0,40 +A Fake phiX Sample,26,19,GT,0,26,18,1,0,40 +A Fake phiX Sample,26,19,TA,0,26,18,1,0,40 +A Fake phiX Sample,26,20,AC,1,26,19,1,0,40 +A Fake phiX Sample,26,20,CC,0,26,19,2,0,40 +A Fake phiX Sample,26,20,CG,0,26,19,3,0,40 +A Fake phiX Sample,26,20,GA,0,26,19,1,0,40 +A Fake phiX Sample,26,20,GT,0,26,19,2,0,40 +A Fake phiX Sample,26,20,TA,0,26,19,1,0,40 +A Fake phiX Sample,26,21,AC,1,26,20,1,0,40 +A Fake phiX Sample,26,21,AG,1,26,20,1,0,40 +A Fake phiX Sample,26,21,CC,0,26,20,1,0,40 +A Fake phiX Sample,26,21,CG,0,26,20,2,0,40 +A Fake phiX Sample,26,21,GA,0,26,20,1,0,40 +A Fake phiX Sample,26,21,GT,0,26,20,2,0,40 +A Fake phiX Sample,26,21,TA,0,26,20,2,0,40 +A Fake phiX Sample,26,22,AC,1,26,21,2,0,40 +A Fake phiX Sample,26,22,AG,1,26,21,1,0,40 +A Fake phiX Sample,26,22,CC,0,26,21,1,0,40 +A Fake phiX Sample,26,22,CG,0,26,21,1,0,40 +A Fake phiX Sample,26,22,GA,0,26,21,1,0,40 +A Fake phiX Sample,26,22,GG,0,26,21,1,0,40 +A Fake phiX Sample,26,22,GT,0,26,21,1,0,40 +A Fake phiX Sample,26,22,TA,0,26,21,2,0,40 +A Fake phiX Sample,26,23,AC,1,26,22,2,0,40 +A Fake phiX Sample,26,23,AG,1,26,22,1,0,40 +A Fake phiX Sample,26,23,CC,0,26,22,2,0,40 +A Fake phiX Sample,26,23,CG,0,26,22,1,0,40 +A Fake phiX Sample,26,23,GA,0,26,22,1,0,40 +A Fake phiX Sample,26,23,GC,0,26,22,1,0,40 +A Fake phiX Sample,26,23,GG,0,26,22,1,0,40 +A Fake phiX Sample,26,23,TA,0,26,22,1,0,40 +A Fake phiX Sample,26,24,AC,1,26,23,1,0,40 +A Fake phiX Sample,26,24,AG,1,26,23,1,0,40 +A Fake phiX Sample,26,24,CC,0,26,23,2,0,40 +A Fake phiX Sample,26,24,CG,0,26,23,2,0,40 +A Fake phiX Sample,26,24,CT,0,26,23,1,0,40 +A Fake phiX Sample,26,24,GA,0,26,23,1,0,40 +A Fake phiX Sample,26,24,GC,0,26,23,1,0,40 +A Fake phiX Sample,26,24,GG,0,26,23,1,0,40 +A Fake phiX Sample,26,25,AG,1,26,24,1,0,40 +A Fake phiX Sample,26,25,CC,0,26,24,1,0,40 +A Fake phiX Sample,26,25,CG,0,26,24,2,0,40 +A Fake phiX Sample,26,25,CT,0,26,24,1,0,40 +A Fake phiX Sample,26,25,GA,0,26,24,2,0,40 +A Fake phiX Sample,26,25,GC,0,26,24,1,0,40 +A Fake phiX Sample,26,25,GG,0,26,24,1,0,40 +A Fake phiX Sample,26,25,TA,1,26,24,1,0,40 +A Fake phiX Sample,26,26,AG,1,26,25,2,0,40 +A Fake phiX Sample,26,26,CG,0,26,25,1,0,40 +A Fake phiX Sample,26,26,CT,0,26,25,1,0,40 +A Fake phiX Sample,26,26,GA,0,26,25,2,0,40 +A Fake phiX Sample,26,26,GC,0,26,25,1,0,40 +A Fake phiX Sample,26,26,GG,0,26,25,1,0,40 +A Fake phiX Sample,26,26,TA,1,26,25,1,0,40 +A Fake phiX Sample,26,27,AC,2,26,26,1,0,40 +A Fake phiX Sample,26,27,AG,1,26,26,2,0,40 +A Fake phiX Sample,26,27,CT,0,26,26,1,0,40 +A Fake phiX Sample,26,27,GA,0,26,26,1,0,40 +A Fake phiX Sample,26,27,GC,0,26,26,1,0,40 +A Fake phiX Sample,26,27,GG,0,26,26,2,0,40 +A Fake phiX Sample,26,27,TA,1,26,26,1,0,40 +A Fake phiX Sample,26,28,AC,2,26,27,1,0,40 +A Fake phiX Sample,26,28,AG,1,26,27,1,0,40 +A Fake phiX Sample,26,28,CC,1,26,27,1,0,40 +A Fake phiX Sample,26,28,CT,0,26,27,1,0,40 +A Fake phiX Sample,26,28,GC,0,26,27,2,0,40 +A Fake phiX Sample,26,28,GG,0,26,27,2,0,40 +A Fake phiX Sample,26,28,TA,1,26,27,1,0,40 +A Fake phiX Sample,26,29,AC,2,26,28,1,0,40 +A Fake phiX Sample,26,29,CC,1,26,28,1,0,40 +A Fake phiX Sample,26,29,CT,0,26,28,2,0,40 +A Fake phiX Sample,26,29,GC,0,26,28,2,0,40 +A Fake phiX Sample,26,29,GG,0,26,28,1,0,40 +A Fake phiX Sample,26,29,TA,1,26,28,1,0,40 +A Fake phiX Sample,26,30,AC,2,26,29,1,0,40 +A Fake phiX Sample,26,30,CC,1,26,29,1,0,40 +A Fake phiX Sample,26,30,CT,0,26,29,3,0,40 +A Fake phiX Sample,26,30,GC,0,26,29,1,0,40 +A Fake phiX Sample,26,30,TA,1,26,29,2,0,40 +A Fake phiX Sample,26,31,AC,2,26,30,1,0,40 +A Fake phiX Sample,26,31,CC,1,26,30,1,0,40 +A Fake phiX Sample,26,31,CT,0,26,30,2,0,40 +A Fake phiX Sample,26,31,TA,1,26,30,3,0,40 +A Fake phiX Sample,26,32,AA,0,26,31,1,0,40 +A Fake phiX Sample,26,32,AC,1,26,31,1,0,40 +A Fake phiX Sample,26,32,AC,2,26,31,1,0,40 +A Fake phiX Sample,26,32,CC,1,26,31,1,0,40 +A Fake phiX Sample,26,32,CT,0,26,31,1,0,40 +A Fake phiX Sample,26,32,TA,1,26,31,2,0,40 +A Fake phiX Sample,26,33,AA,0,26,32,1,0,40 +A Fake phiX Sample,26,33,AC,1,26,32,1,0,40 +A Fake phiX Sample,26,33,AC,2,26,32,1,0,40 +A Fake phiX Sample,26,33,AT,0,26,32,1,0,40 +A Fake phiX Sample,26,33,CC,1,26,32,1,0,40 +A Fake phiX Sample,26,33,CT,0,26,32,1,0,40 +A Fake phiX Sample,26,33,TA,1,26,32,1,0,40 +A Fake phiX Sample,26,34,AA,0,26,33,1,0,40 +A Fake phiX Sample,26,34,AC,1,26,33,1,0,40 +A Fake phiX Sample,26,34,AT,0,26,33,1,0,40 +A Fake phiX Sample,26,34,CC,1,26,33,1,0,40 +A Fake phiX Sample,26,34,CT,0,26,33,2,0,40 +A Fake phiX Sample,26,34,TA,1,26,33,1,0,40 +A Fake phiX Sample,26,34,TG,0,26,33,1,0,40 +A Fake phiX Sample,26,35,AA,0,26,34,1,0,40 +A Fake phiX Sample,26,35,AT,0,26,34,1,0,40 +A Fake phiX Sample,26,35,CT,0,26,34,2,0,40 +A Fake phiX Sample,26,35,GA,0,26,34,1,0,40 +A Fake phiX Sample,26,35,TA,1,26,34,2,0,40 +A Fake phiX Sample,26,35,TG,0,26,34,1,0,40 +A Fake phiX Sample,26,36,AA,0,26,35,2,0,40 +A Fake phiX Sample,26,36,AG,0,26,35,1,0,40 +A Fake phiX Sample,26,36,AT,0,26,35,1,0,40 +A Fake phiX Sample,26,36,CT,0,26,35,2,0,40 +A Fake phiX Sample,26,36,GA,0,26,35,1,0,40 +A Fake phiX Sample,26,36,TA,0,26,35,2,0,40 +A Fake phiX Sample,26,36,TG,0,26,35,1,0,40 +EOF
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_count_covariates/gatk_count_covariates_out_1.log.contains Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,13 @@ +GenomeAnalysisEngine - Strictness is SILENT +CountCovariatesWalker - The covariates being used here: +CountCovariatesWalker - ReadGroupCovariate +CountCovariatesWalker - QualityScoreCovariate +CountCovariatesWalker - CycleCovariate +CountCovariatesWalker - DinucCovariate +CountCovariatesWalker - HomopolymerCovariate +CountCovariatesWalker - MinimumNQSCovariate +CountCovariatesWalker - PositionCovariate +TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING] +CountCovariatesWalker - Writing raw recalibration data... +CountCovariatesWalker - ...done! +TraversalEngine - Total runtime
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1.log.contains Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,6 @@ +TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING] +TraversalEngine - Location processed.sites runtime per.1M.sites completed total.runtime remaining +DepthOfCoverageWalker - Printing summary info +DepthOfCoverageWalker - Printing locus summary +TraversalEngine - Total runtime +TraversalEngine - 0 reads were filtered out during traversal out of 10 total (0.00%) \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_cumulative_coverage_counts_sample.tabular Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,2 @@ + gte_0 gte_1 gte_2 gte_3 gte_4 gte_5 gte_6 gte_7 gte_8 gte_9 gte_10 gte_11 gte_12 gte_13 gte_14 gte_15 gte_16 gte_17 gte_18 gte_19 gte_20 gte_21 gte_22 gte_23 gte_24 gte_25 gte_26 gte_27 gte_28 gte_29 gte_30 gte_31 gte_32 gte_33 gte_34 gte_35 gte_36 gte_37 gte_38 gte_39 gte_40 gte_41 gte_42 gte_43 gte_44 gte_45 gte_46 gte_47 gte_48 gte_49 gte_50 gte_51 gte_52 gte_53 gte_54 gte_55 gte_56 gte_57 gte_58 gte_59 gte_60 gte_61 gte_62 gte_63 gte_64 gte_65 gte_66 gte_67 gte_68 gte_69 gte_70 gte_71 gte_72 gte_73 gte_74 gte_75 gte_76 gte_77 gte_78 gte_79 gte_80 gte_81 gte_82 gte_83 gte_84 gte_85 gte_86 gte_87 gte_88 gte_89 gte_90 gte_91 gte_92 gte_93 gte_94 gte_95 gte_96 gte_97 gte_98 gte_99 gte_100 gte_101 gte_102 gte_103 gte_104 gte_105 gte_106 gte_107 gte_108 gte_109 gte_110 gte_111 gte_112 gte_113 gte_114 gte_115 gte_116 gte_117 gte_118 gte_119 gte_120 gte_121 gte_122 gte_123 gte_124 gte_125 gte_126 gte_127 gte_128 gte_129 gte_130 gte_131 gte_132 gte_133 gte_134 gte_135 gte_136 gte_137 gte_138 gte_139 gte_140 gte_141 gte_142 gte_143 gte_144 gte_145 gte_146 gte_147 gte_148 gte_149 gte_150 gte_151 gte_152 gte_153 gte_154 gte_155 gte_156 gte_157 gte_158 gte_159 gte_160 gte_161 gte_162 gte_163 gte_164 gte_165 gte_166 gte_167 gte_168 gte_169 gte_170 gte_171 gte_172 gte_173 gte_174 gte_175 gte_176 gte_177 gte_178 gte_179 gte_180 gte_181 gte_182 gte_183 gte_184 gte_185 gte_186 gte_187 gte_188 gte_189 gte_190 gte_191 gte_192 gte_193 gte_194 gte_195 gte_196 gte_197 gte_198 gte_199 gte_200 gte_201 gte_202 gte_203 gte_204 gte_205 gte_206 gte_207 gte_208 gte_209 gte_210 gte_211 gte_212 gte_213 gte_214 gte_215 gte_216 gte_217 gte_218 gte_219 gte_220 gte_221 gte_222 gte_223 gte_224 gte_225 gte_226 gte_227 gte_228 gte_229 gte_230 gte_231 gte_232 gte_233 gte_234 gte_235 gte_236 gte_237 gte_238 gte_239 gte_240 gte_241 gte_242 gte_243 gte_244 gte_245 gte_246 gte_247 gte_248 gte_249 gte_250 gte_251 gte_252 gte_253 gte_254 gte_255 gte_256 gte_257 gte_258 gte_259 gte_260 gte_261 gte_262 gte_263 gte_264 gte_265 gte_266 gte_267 gte_268 gte_269 gte_270 gte_271 gte_272 gte_273 gte_274 gte_275 gte_276 gte_277 gte_278 gte_279 gte_280 gte_281 gte_282 gte_283 gte_284 gte_285 gte_286 gte_287 gte_288 gte_289 gte_290 gte_291 gte_292 gte_293 gte_294 gte_295 gte_296 gte_297 gte_298 gte_299 gte_300 gte_301 gte_302 gte_303 gte_304 gte_305 gte_306 gte_307 gte_308 gte_309 gte_310 gte_311 gte_312 gte_313 gte_314 gte_315 gte_316 gte_317 gte_318 gte_319 gte_320 gte_321 gte_322 gte_323 gte_324 gte_325 gte_326 gte_327 gte_328 gte_329 gte_330 gte_331 gte_332 gte_333 gte_334 gte_335 gte_336 gte_337 gte_338 gte_339 gte_340 gte_341 gte_342 gte_343 gte_344 gte_345 gte_346 gte_347 gte_348 gte_349 gte_350 gte_351 gte_352 gte_353 gte_354 gte_355 gte_356 gte_357 gte_358 gte_359 gte_360 gte_361 gte_362 gte_363 gte_364 gte_365 gte_366 gte_367 gte_368 gte_369 gte_370 gte_371 gte_372 gte_373 gte_374 gte_375 gte_376 gte_377 gte_378 gte_379 gte_380 gte_381 gte_382 gte_383 gte_384 gte_385 gte_386 gte_387 gte_388 gte_389 gte_390 gte_391 gte_392 gte_393 gte_394 gte_395 gte_396 gte_397 gte_398 gte_399 gte_400 gte_401 gte_402 gte_403 gte_404 gte_405 gte_406 gte_407 gte_408 gte_409 gte_410 gte_411 gte_412 gte_413 gte_414 gte_415 gte_416 gte_417 gte_418 gte_419 gte_420 gte_421 gte_422 gte_423 gte_424 gte_425 gte_426 gte_427 gte_428 gte_429 gte_430 gte_431 gte_432 gte_433 gte_434 gte_435 gte_436 gte_437 gte_438 gte_439 gte_440 gte_441 gte_442 gte_443 gte_444 gte_445 gte_446 gte_447 gte_448 gte_449 gte_450 gte_451 gte_452 gte_453 gte_454 gte_455 gte_456 gte_457 gte_458 gte_459 gte_460 gte_461 gte_462 gte_463 gte_464 gte_465 gte_466 gte_467 gte_468 gte_469 gte_470 gte_471 gte_472 gte_473 gte_474 gte_475 gte_476 gte_477 gte_478 gte_479 gte_480 gte_481 gte_482 gte_483 gte_484 gte_485 gte_486 gte_487 gte_488 gte_489 gte_490 gte_491 gte_492 gte_493 gte_494 gte_495 gte_496 gte_497 gte_498 gte_499 gte_500 +NSamples_1 5386 43 41 40 38 37 36 34 32 30 29 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_output_cumulative_coverage_proportions_sample.tabular Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,2 @@ + gte_0 gte_1 gte_2 gte_3 gte_4 gte_5 gte_6 gte_7 gte_8 gte_9 gte_10 gte_11 gte_12 gte_13 gte_14 gte_15 gte_16 gte_17 gte_18 gte_19 gte_20 gte_21 gte_22 gte_23 gte_24 gte_25 gte_26 gte_27 gte_28 gte_29 gte_30 gte_31 gte_32 gte_33 gte_34 gte_35 gte_36 gte_37 gte_38 gte_39 gte_40 gte_41 gte_42 gte_43 gte_44 gte_45 gte_46 gte_47 gte_48 gte_49 gte_50 gte_51 gte_52 gte_53 gte_54 gte_55 gte_56 gte_57 gte_58 gte_59 gte_60 gte_61 gte_62 gte_63 gte_64 gte_65 gte_66 gte_67 gte_68 gte_69 gte_70 gte_71 gte_72 gte_73 gte_74 gte_75 gte_76 gte_77 gte_78 gte_79 gte_80 gte_81 gte_82 gte_83 gte_84 gte_85 gte_86 gte_87 gte_88 gte_89 gte_90 gte_91 gte_92 gte_93 gte_94 gte_95 gte_96 gte_97 gte_98 gte_99 gte_100 gte_101 gte_102 gte_103 gte_104 gte_105 gte_106 gte_107 gte_108 gte_109 gte_110 gte_111 gte_112 gte_113 gte_114 gte_115 gte_116 gte_117 gte_118 gte_119 gte_120 gte_121 gte_122 gte_123 gte_124 gte_125 gte_126 gte_127 gte_128 gte_129 gte_130 gte_131 gte_132 gte_133 gte_134 gte_135 gte_136 gte_137 gte_138 gte_139 gte_140 gte_141 gte_142 gte_143 gte_144 gte_145 gte_146 gte_147 gte_148 gte_149 gte_150 gte_151 gte_152 gte_153 gte_154 gte_155 gte_156 gte_157 gte_158 gte_159 gte_160 gte_161 gte_162 gte_163 gte_164 gte_165 gte_166 gte_167 gte_168 gte_169 gte_170 gte_171 gte_172 gte_173 gte_174 gte_175 gte_176 gte_177 gte_178 gte_179 gte_180 gte_181 gte_182 gte_183 gte_184 gte_185 gte_186 gte_187 gte_188 gte_189 gte_190 gte_191 gte_192 gte_193 gte_194 gte_195 gte_196 gte_197 gte_198 gte_199 gte_200 gte_201 gte_202 gte_203 gte_204 gte_205 gte_206 gte_207 gte_208 gte_209 gte_210 gte_211 gte_212 gte_213 gte_214 gte_215 gte_216 gte_217 gte_218 gte_219 gte_220 gte_221 gte_222 gte_223 gte_224 gte_225 gte_226 gte_227 gte_228 gte_229 gte_230 gte_231 gte_232 gte_233 gte_234 gte_235 gte_236 gte_237 gte_238 gte_239 gte_240 gte_241 gte_242 gte_243 gte_244 gte_245 gte_246 gte_247 gte_248 gte_249 gte_250 gte_251 gte_252 gte_253 gte_254 gte_255 gte_256 gte_257 gte_258 gte_259 gte_260 gte_261 gte_262 gte_263 gte_264 gte_265 gte_266 gte_267 gte_268 gte_269 gte_270 gte_271 gte_272 gte_273 gte_274 gte_275 gte_276 gte_277 gte_278 gte_279 gte_280 gte_281 gte_282 gte_283 gte_284 gte_285 gte_286 gte_287 gte_288 gte_289 gte_290 gte_291 gte_292 gte_293 gte_294 gte_295 gte_296 gte_297 gte_298 gte_299 gte_300 gte_301 gte_302 gte_303 gte_304 gte_305 gte_306 gte_307 gte_308 gte_309 gte_310 gte_311 gte_312 gte_313 gte_314 gte_315 gte_316 gte_317 gte_318 gte_319 gte_320 gte_321 gte_322 gte_323 gte_324 gte_325 gte_326 gte_327 gte_328 gte_329 gte_330 gte_331 gte_332 gte_333 gte_334 gte_335 gte_336 gte_337 gte_338 gte_339 gte_340 gte_341 gte_342 gte_343 gte_344 gte_345 gte_346 gte_347 gte_348 gte_349 gte_350 gte_351 gte_352 gte_353 gte_354 gte_355 gte_356 gte_357 gte_358 gte_359 gte_360 gte_361 gte_362 gte_363 gte_364 gte_365 gte_366 gte_367 gte_368 gte_369 gte_370 gte_371 gte_372 gte_373 gte_374 gte_375 gte_376 gte_377 gte_378 gte_379 gte_380 gte_381 gte_382 gte_383 gte_384 gte_385 gte_386 gte_387 gte_388 gte_389 gte_390 gte_391 gte_392 gte_393 gte_394 gte_395 gte_396 gte_397 gte_398 gte_399 gte_400 gte_401 gte_402 gte_403 gte_404 gte_405 gte_406 gte_407 gte_408 gte_409 gte_410 gte_411 gte_412 gte_413 gte_414 gte_415 gte_416 gte_417 gte_418 gte_419 gte_420 gte_421 gte_422 gte_423 gte_424 gte_425 gte_426 gte_427 gte_428 gte_429 gte_430 gte_431 gte_432 gte_433 gte_434 gte_435 gte_436 gte_437 gte_438 gte_439 gte_440 gte_441 gte_442 gte_443 gte_444 gte_445 gte_446 gte_447 gte_448 gte_449 gte_450 gte_451 gte_452 gte_453 gte_454 gte_455 gte_456 gte_457 gte_458 gte_459 gte_460 gte_461 gte_462 gte_463 gte_464 gte_465 gte_466 gte_467 gte_468 gte_469 gte_470 gte_471 gte_472 gte_473 gte_474 gte_475 gte_476 gte_477 gte_478 gte_479 gte_480 gte_481 gte_482 gte_483 gte_484 gte_485 gte_486 gte_487 gte_488 gte_489 gte_490 gte_491 gte_492 gte_493 gte_494 gte_495 gte_496 gte_497 gte_498 gte_499 gte_500 +A Fake phiX Sample 1.00 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_per_locus_coverage.tabular Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,5387 @@ +Locus Total_Depth Average_Depth_sample Depth_for_A Fake phiX Sample +phiX174:1 0 0.00 0 +phiX174:2 0 0.00 0 +phiX174:3 0 0.00 0 +phiX174:4 0 0.00 0 +phiX174:5 0 0.00 0 +phiX174:6 0 0.00 0 +phiX174:7 0 0.00 0 +phiX174:8 0 0.00 0 +phiX174:9 0 0.00 0 +phiX174:10 0 0.00 0 +phiX174:11 0 0.00 0 +phiX174:12 0 0.00 0 +phiX174:13 0 0.00 0 +phiX174:14 0 0.00 0 +phiX174:15 0 0.00 0 +phiX174:16 0 0.00 0 +phiX174:17 0 0.00 0 +phiX174:18 0 0.00 0 +phiX174:19 0 0.00 0 +phiX174:20 0 0.00 0 +phiX174:21 0 0.00 0 +phiX174:22 0 0.00 0 +phiX174:23 0 0.00 0 +phiX174:24 0 0.00 0 +phiX174:25 0 0.00 0 +phiX174:26 0 0.00 0 +phiX174:27 0 0.00 0 +phiX174:28 0 0.00 0 +phiX174:29 0 0.00 0 +phiX174:30 0 0.00 0 +phiX174:31 0 0.00 0 +phiX174:32 0 0.00 0 +phiX174:33 0 0.00 0 +phiX174:34 0 0.00 0 +phiX174:35 0 0.00 0 +phiX174:36 0 0.00 0 +phiX174:37 0 0.00 0 +phiX174:38 0 0.00 0 +phiX174:39 0 0.00 0 +phiX174:40 0 0.00 0 +phiX174:41 0 0.00 0 +phiX174:42 0 0.00 0 +phiX174:43 0 0.00 0 +phiX174:44 0 0.00 0 +phiX174:45 0 0.00 0 +phiX174:46 0 0.00 0 +phiX174:47 0 0.00 0 +phiX174:48 0 0.00 0 +phiX174:49 0 0.00 0 +phiX174:50 0 0.00 0 +phiX174:51 0 0.00 0 +phiX174:52 0 0.00 0 +phiX174:53 0 0.00 0 +phiX174:54 0 0.00 0 +phiX174:55 0 0.00 0 +phiX174:56 0 0.00 0 +phiX174:57 0 0.00 0 +phiX174:58 0 0.00 0 +phiX174:59 0 0.00 0 +phiX174:60 0 0.00 0 +phiX174:61 0 0.00 0 +phiX174:62 0 0.00 0 +phiX174:63 0 0.00 0 +phiX174:64 0 0.00 0 +phiX174:65 0 0.00 0 +phiX174:66 0 0.00 0 +phiX174:67 0 0.00 0 +phiX174:68 0 0.00 0 +phiX174:69 0 0.00 0 +phiX174:70 0 0.00 0 +phiX174:71 0 0.00 0 +phiX174:72 0 0.00 0 +phiX174:73 0 0.00 0 +phiX174:74 0 0.00 0 +phiX174:75 0 0.00 0 +phiX174:76 0 0.00 0 +phiX174:77 0 0.00 0 +phiX174:78 0 0.00 0 +phiX174:79 0 0.00 0 +phiX174:80 0 0.00 0 +phiX174:81 0 0.00 0 +phiX174:82 0 0.00 0 +phiX174:83 0 0.00 0 +phiX174:84 0 0.00 0 +phiX174:85 0 0.00 0 +phiX174:86 0 0.00 0 +phiX174:87 0 0.00 0 +phiX174:88 0 0.00 0 +phiX174:89 0 0.00 0 +phiX174:90 0 0.00 0 +phiX174:91 0 0.00 0 +phiX174:92 0 0.00 0 +phiX174:93 0 0.00 0 +phiX174:94 0 0.00 0 +phiX174:95 0 0.00 0 +phiX174:96 0 0.00 0 +phiX174:97 0 0.00 0 +phiX174:98 0 0.00 0 +phiX174:99 0 0.00 0 +phiX174:100 0 0.00 0 +phiX174:101 0 0.00 0 +phiX174:102 0 0.00 0 +phiX174:103 0 0.00 0 +phiX174:104 0 0.00 0 +phiX174:105 0 0.00 0 +phiX174:106 0 0.00 0 +phiX174:107 0 0.00 0 +phiX174:108 0 0.00 0 +phiX174:109 0 0.00 0 +phiX174:110 0 0.00 0 +phiX174:111 0 0.00 0 +phiX174:112 0 0.00 0 +phiX174:113 0 0.00 0 +phiX174:114 0 0.00 0 +phiX174:115 0 0.00 0 +phiX174:116 0 0.00 0 +phiX174:117 0 0.00 0 +phiX174:118 0 0.00 0 +phiX174:119 0 0.00 0 +phiX174:120 0 0.00 0 +phiX174:121 0 0.00 0 +phiX174:122 0 0.00 0 +phiX174:123 0 0.00 0 +phiX174:124 0 0.00 0 +phiX174:125 0 0.00 0 +phiX174:126 0 0.00 0 +phiX174:127 0 0.00 0 +phiX174:128 0 0.00 0 +phiX174:129 0 0.00 0 +phiX174:130 0 0.00 0 +phiX174:131 0 0.00 0 +phiX174:132 0 0.00 0 +phiX174:133 0 0.00 0 +phiX174:134 0 0.00 0 +phiX174:135 0 0.00 0 +phiX174:136 0 0.00 0 +phiX174:137 0 0.00 0 +phiX174:138 0 0.00 0 +phiX174:139 0 0.00 0 +phiX174:140 0 0.00 0 +phiX174:141 0 0.00 0 +phiX174:142 0 0.00 0 +phiX174:143 0 0.00 0 +phiX174:144 0 0.00 0 +phiX174:145 0 0.00 0 +phiX174:146 0 0.00 0 +phiX174:147 0 0.00 0 +phiX174:148 0 0.00 0 +phiX174:149 0 0.00 0 +phiX174:150 0 0.00 0 +phiX174:151 0 0.00 0 +phiX174:152 0 0.00 0 +phiX174:153 0 0.00 0 +phiX174:154 0 0.00 0 +phiX174:155 0 0.00 0 +phiX174:156 0 0.00 0 +phiX174:157 0 0.00 0 +phiX174:158 0 0.00 0 +phiX174:159 0 0.00 0 +phiX174:160 0 0.00 0 +phiX174:161 0 0.00 0 +phiX174:162 0 0.00 0 +phiX174:163 0 0.00 0 +phiX174:164 0 0.00 0 +phiX174:165 0 0.00 0 +phiX174:166 0 0.00 0 +phiX174:167 0 0.00 0 +phiX174:168 0 0.00 0 +phiX174:169 0 0.00 0 +phiX174:170 0 0.00 0 +phiX174:171 0 0.00 0 +phiX174:172 0 0.00 0 +phiX174:173 0 0.00 0 +phiX174:174 0 0.00 0 +phiX174:175 0 0.00 0 +phiX174:176 0 0.00 0 +phiX174:177 0 0.00 0 +phiX174:178 0 0.00 0 +phiX174:179 0 0.00 0 +phiX174:180 0 0.00 0 +phiX174:181 0 0.00 0 +phiX174:182 0 0.00 0 +phiX174:183 0 0.00 0 +phiX174:184 0 0.00 0 +phiX174:185 0 0.00 0 +phiX174:186 0 0.00 0 +phiX174:187 0 0.00 0 +phiX174:188 0 0.00 0 +phiX174:189 0 0.00 0 +phiX174:190 0 0.00 0 +phiX174:191 0 0.00 0 +phiX174:192 0 0.00 0 +phiX174:193 0 0.00 0 +phiX174:194 0 0.00 0 +phiX174:195 0 0.00 0 +phiX174:196 0 0.00 0 +phiX174:197 0 0.00 0 +phiX174:198 0 0.00 0 +phiX174:199 0 0.00 0 +phiX174:200 0 0.00 0 +phiX174:201 0 0.00 0 +phiX174:202 0 0.00 0 +phiX174:203 0 0.00 0 +phiX174:204 0 0.00 0 +phiX174:205 0 0.00 0 +phiX174:206 0 0.00 0 +phiX174:207 0 0.00 0 +phiX174:208 0 0.00 0 +phiX174:209 0 0.00 0 +phiX174:210 0 0.00 0 +phiX174:211 0 0.00 0 +phiX174:212 0 0.00 0 +phiX174:213 0 0.00 0 +phiX174:214 0 0.00 0 +phiX174:215 0 0.00 0 +phiX174:216 0 0.00 0 +phiX174:217 0 0.00 0 +phiX174:218 0 0.00 0 +phiX174:219 0 0.00 0 +phiX174:220 0 0.00 0 +phiX174:221 0 0.00 0 +phiX174:222 0 0.00 0 +phiX174:223 0 0.00 0 +phiX174:224 0 0.00 0 +phiX174:225 0 0.00 0 +phiX174:226 0 0.00 0 +phiX174:227 0 0.00 0 +phiX174:228 0 0.00 0 +phiX174:229 0 0.00 0 +phiX174:230 0 0.00 0 +phiX174:231 0 0.00 0 +phiX174:232 0 0.00 0 +phiX174:233 0 0.00 0 +phiX174:234 0 0.00 0 +phiX174:235 0 0.00 0 +phiX174:236 0 0.00 0 +phiX174:237 0 0.00 0 +phiX174:238 0 0.00 0 +phiX174:239 0 0.00 0 +phiX174:240 0 0.00 0 +phiX174:241 0 0.00 0 +phiX174:242 0 0.00 0 +phiX174:243 0 0.00 0 +phiX174:244 0 0.00 0 +phiX174:245 0 0.00 0 +phiX174:246 0 0.00 0 +phiX174:247 0 0.00 0 +phiX174:248 0 0.00 0 +phiX174:249 0 0.00 0 +phiX174:250 0 0.00 0 +phiX174:251 0 0.00 0 +phiX174:252 0 0.00 0 +phiX174:253 0 0.00 0 +phiX174:254 0 0.00 0 +phiX174:255 0 0.00 0 +phiX174:256 0 0.00 0 +phiX174:257 0 0.00 0 +phiX174:258 0 0.00 0 +phiX174:259 0 0.00 0 +phiX174:260 0 0.00 0 +phiX174:261 0 0.00 0 +phiX174:262 0 0.00 0 +phiX174:263 0 0.00 0 +phiX174:264 0 0.00 0 +phiX174:265 0 0.00 0 +phiX174:266 0 0.00 0 +phiX174:267 0 0.00 0 +phiX174:268 0 0.00 0 +phiX174:269 0 0.00 0 +phiX174:270 0 0.00 0 +phiX174:271 0 0.00 0 +phiX174:272 0 0.00 0 +phiX174:273 0 0.00 0 +phiX174:274 0 0.00 0 +phiX174:275 0 0.00 0 +phiX174:276 0 0.00 0 +phiX174:277 0 0.00 0 +phiX174:278 0 0.00 0 +phiX174:279 0 0.00 0 +phiX174:280 0 0.00 0 +phiX174:281 0 0.00 0 +phiX174:282 0 0.00 0 +phiX174:283 0 0.00 0 +phiX174:284 0 0.00 0 +phiX174:285 0 0.00 0 +phiX174:286 0 0.00 0 +phiX174:287 0 0.00 0 +phiX174:288 0 0.00 0 +phiX174:289 0 0.00 0 +phiX174:290 0 0.00 0 +phiX174:291 0 0.00 0 +phiX174:292 0 0.00 0 +phiX174:293 0 0.00 0 +phiX174:294 0 0.00 0 +phiX174:295 0 0.00 0 +phiX174:296 0 0.00 0 +phiX174:297 0 0.00 0 +phiX174:298 0 0.00 0 +phiX174:299 0 0.00 0 +phiX174:300 0 0.00 0 +phiX174:301 0 0.00 0 +phiX174:302 0 0.00 0 +phiX174:303 0 0.00 0 +phiX174:304 0 0.00 0 +phiX174:305 0 0.00 0 +phiX174:306 0 0.00 0 +phiX174:307 0 0.00 0 +phiX174:308 0 0.00 0 +phiX174:309 0 0.00 0 +phiX174:310 0 0.00 0 +phiX174:311 0 0.00 0 +phiX174:312 0 0.00 0 +phiX174:313 0 0.00 0 +phiX174:314 0 0.00 0 +phiX174:315 0 0.00 0 +phiX174:316 0 0.00 0 +phiX174:317 0 0.00 0 +phiX174:318 0 0.00 0 +phiX174:319 0 0.00 0 +phiX174:320 0 0.00 0 +phiX174:321 0 0.00 0 +phiX174:322 0 0.00 0 +phiX174:323 0 0.00 0 +phiX174:324 0 0.00 0 +phiX174:325 0 0.00 0 +phiX174:326 0 0.00 0 +phiX174:327 0 0.00 0 +phiX174:328 0 0.00 0 +phiX174:329 0 0.00 0 +phiX174:330 0 0.00 0 +phiX174:331 0 0.00 0 +phiX174:332 0 0.00 0 +phiX174:333 0 0.00 0 +phiX174:334 0 0.00 0 +phiX174:335 0 0.00 0 +phiX174:336 0 0.00 0 +phiX174:337 0 0.00 0 +phiX174:338 0 0.00 0 +phiX174:339 0 0.00 0 +phiX174:340 0 0.00 0 +phiX174:341 0 0.00 0 +phiX174:342 0 0.00 0 +phiX174:343 0 0.00 0 +phiX174:344 0 0.00 0 +phiX174:345 0 0.00 0 +phiX174:346 0 0.00 0 +phiX174:347 0 0.00 0 +phiX174:348 0 0.00 0 +phiX174:349 0 0.00 0 +phiX174:350 0 0.00 0 +phiX174:351 0 0.00 0 +phiX174:352 0 0.00 0 +phiX174:353 0 0.00 0 +phiX174:354 0 0.00 0 +phiX174:355 0 0.00 0 +phiX174:356 0 0.00 0 +phiX174:357 0 0.00 0 +phiX174:358 0 0.00 0 +phiX174:359 0 0.00 0 +phiX174:360 0 0.00 0 +phiX174:361 0 0.00 0 +phiX174:362 0 0.00 0 +phiX174:363 0 0.00 0 +phiX174:364 0 0.00 0 +phiX174:365 0 0.00 0 +phiX174:366 0 0.00 0 +phiX174:367 0 0.00 0 +phiX174:368 0 0.00 0 +phiX174:369 0 0.00 0 +phiX174:370 0 0.00 0 +phiX174:371 0 0.00 0 +phiX174:372 0 0.00 0 +phiX174:373 0 0.00 0 +phiX174:374 0 0.00 0 +phiX174:375 0 0.00 0 +phiX174:376 0 0.00 0 +phiX174:377 0 0.00 0 +phiX174:378 0 0.00 0 +phiX174:379 0 0.00 0 +phiX174:380 0 0.00 0 +phiX174:381 0 0.00 0 +phiX174:382 0 0.00 0 +phiX174:383 0 0.00 0 +phiX174:384 0 0.00 0 +phiX174:385 0 0.00 0 +phiX174:386 0 0.00 0 +phiX174:387 0 0.00 0 +phiX174:388 0 0.00 0 +phiX174:389 0 0.00 0 +phiX174:390 0 0.00 0 +phiX174:391 0 0.00 0 +phiX174:392 0 0.00 0 +phiX174:393 0 0.00 0 +phiX174:394 0 0.00 0 +phiX174:395 0 0.00 0 +phiX174:396 0 0.00 0 +phiX174:397 0 0.00 0 +phiX174:398 0 0.00 0 +phiX174:399 0 0.00 0 +phiX174:400 0 0.00 0 +phiX174:401 0 0.00 0 +phiX174:402 0 0.00 0 +phiX174:403 0 0.00 0 +phiX174:404 0 0.00 0 +phiX174:405 0 0.00 0 +phiX174:406 0 0.00 0 +phiX174:407 0 0.00 0 +phiX174:408 0 0.00 0 +phiX174:409 0 0.00 0 +phiX174:410 0 0.00 0 +phiX174:411 0 0.00 0 +phiX174:412 0 0.00 0 +phiX174:413 0 0.00 0 +phiX174:414 0 0.00 0 +phiX174:415 0 0.00 0 +phiX174:416 0 0.00 0 +phiX174:417 0 0.00 0 +phiX174:418 0 0.00 0 +phiX174:419 0 0.00 0 +phiX174:420 0 0.00 0 +phiX174:421 0 0.00 0 +phiX174:422 0 0.00 0 +phiX174:423 0 0.00 0 +phiX174:424 0 0.00 0 +phiX174:425 0 0.00 0 +phiX174:426 0 0.00 0 +phiX174:427 0 0.00 0 +phiX174:428 0 0.00 0 +phiX174:429 0 0.00 0 +phiX174:430 0 0.00 0 +phiX174:431 0 0.00 0 +phiX174:432 0 0.00 0 +phiX174:433 0 0.00 0 +phiX174:434 0 0.00 0 +phiX174:435 0 0.00 0 +phiX174:436 0 0.00 0 +phiX174:437 0 0.00 0 +phiX174:438 0 0.00 0 +phiX174:439 0 0.00 0 +phiX174:440 0 0.00 0 +phiX174:441 0 0.00 0 +phiX174:442 0 0.00 0 +phiX174:443 0 0.00 0 +phiX174:444 0 0.00 0 +phiX174:445 0 0.00 0 +phiX174:446 0 0.00 0 +phiX174:447 0 0.00 0 +phiX174:448 0 0.00 0 +phiX174:449 0 0.00 0 +phiX174:450 0 0.00 0 +phiX174:451 0 0.00 0 +phiX174:452 0 0.00 0 +phiX174:453 0 0.00 0 +phiX174:454 0 0.00 0 +phiX174:455 0 0.00 0 +phiX174:456 0 0.00 0 +phiX174:457 0 0.00 0 +phiX174:458 0 0.00 0 +phiX174:459 0 0.00 0 +phiX174:460 0 0.00 0 +phiX174:461 0 0.00 0 +phiX174:462 0 0.00 0 +phiX174:463 0 0.00 0 +phiX174:464 0 0.00 0 +phiX174:465 0 0.00 0 +phiX174:466 0 0.00 0 +phiX174:467 0 0.00 0 +phiX174:468 0 0.00 0 +phiX174:469 0 0.00 0 +phiX174:470 0 0.00 0 +phiX174:471 0 0.00 0 +phiX174:472 0 0.00 0 +phiX174:473 0 0.00 0 +phiX174:474 0 0.00 0 +phiX174:475 0 0.00 0 +phiX174:476 0 0.00 0 +phiX174:477 0 0.00 0 +phiX174:478 0 0.00 0 +phiX174:479 0 0.00 0 +phiX174:480 0 0.00 0 +phiX174:481 0 0.00 0 +phiX174:482 0 0.00 0 +phiX174:483 0 0.00 0 +phiX174:484 0 0.00 0 +phiX174:485 0 0.00 0 +phiX174:486 0 0.00 0 +phiX174:487 0 0.00 0 +phiX174:488 0 0.00 0 +phiX174:489 0 0.00 0 +phiX174:490 0 0.00 0 +phiX174:491 0 0.00 0 +phiX174:492 0 0.00 0 +phiX174:493 0 0.00 0 +phiX174:494 0 0.00 0 +phiX174:495 0 0.00 0 +phiX174:496 0 0.00 0 +phiX174:497 0 0.00 0 +phiX174:498 0 0.00 0 +phiX174:499 0 0.00 0 +phiX174:500 0 0.00 0 +phiX174:501 0 0.00 0 +phiX174:502 0 0.00 0 +phiX174:503 0 0.00 0 +phiX174:504 0 0.00 0 +phiX174:505 0 0.00 0 +phiX174:506 0 0.00 0 +phiX174:507 0 0.00 0 +phiX174:508 0 0.00 0 +phiX174:509 0 0.00 0 +phiX174:510 0 0.00 0 +phiX174:511 0 0.00 0 +phiX174:512 0 0.00 0 +phiX174:513 0 0.00 0 +phiX174:514 0 0.00 0 +phiX174:515 0 0.00 0 +phiX174:516 0 0.00 0 +phiX174:517 0 0.00 0 +phiX174:518 0 0.00 0 +phiX174:519 0 0.00 0 +phiX174:520 0 0.00 0 +phiX174:521 0 0.00 0 +phiX174:522 0 0.00 0 +phiX174:523 0 0.00 0 +phiX174:524 0 0.00 0 +phiX174:525 0 0.00 0 +phiX174:526 0 0.00 0 +phiX174:527 0 0.00 0 +phiX174:528 0 0.00 0 +phiX174:529 0 0.00 0 +phiX174:530 0 0.00 0 +phiX174:531 0 0.00 0 +phiX174:532 0 0.00 0 +phiX174:533 0 0.00 0 +phiX174:534 0 0.00 0 +phiX174:535 0 0.00 0 +phiX174:536 0 0.00 0 +phiX174:537 0 0.00 0 +phiX174:538 0 0.00 0 +phiX174:539 0 0.00 0 +phiX174:540 0 0.00 0 +phiX174:541 0 0.00 0 +phiX174:542 0 0.00 0 +phiX174:543 0 0.00 0 +phiX174:544 0 0.00 0 +phiX174:545 0 0.00 0 +phiX174:546 0 0.00 0 +phiX174:547 0 0.00 0 +phiX174:548 0 0.00 0 +phiX174:549 0 0.00 0 +phiX174:550 0 0.00 0 +phiX174:551 0 0.00 0 +phiX174:552 0 0.00 0 +phiX174:553 0 0.00 0 +phiX174:554 0 0.00 0 +phiX174:555 0 0.00 0 +phiX174:556 0 0.00 0 +phiX174:557 0 0.00 0 +phiX174:558 0 0.00 0 +phiX174:559 0 0.00 0 +phiX174:560 0 0.00 0 +phiX174:561 0 0.00 0 +phiX174:562 0 0.00 0 +phiX174:563 0 0.00 0 +phiX174:564 0 0.00 0 +phiX174:565 0 0.00 0 +phiX174:566 0 0.00 0 +phiX174:567 0 0.00 0 +phiX174:568 0 0.00 0 +phiX174:569 0 0.00 0 +phiX174:570 0 0.00 0 +phiX174:571 0 0.00 0 +phiX174:572 0 0.00 0 +phiX174:573 0 0.00 0 +phiX174:574 0 0.00 0 +phiX174:575 0 0.00 0 +phiX174:576 0 0.00 0 +phiX174:577 0 0.00 0 +phiX174:578 0 0.00 0 +phiX174:579 0 0.00 0 +phiX174:580 0 0.00 0 +phiX174:581 0 0.00 0 +phiX174:582 0 0.00 0 +phiX174:583 0 0.00 0 +phiX174:584 0 0.00 0 +phiX174:585 0 0.00 0 +phiX174:586 0 0.00 0 +phiX174:587 0 0.00 0 +phiX174:588 0 0.00 0 +phiX174:589 0 0.00 0 +phiX174:590 0 0.00 0 +phiX174:591 0 0.00 0 +phiX174:592 0 0.00 0 +phiX174:593 0 0.00 0 +phiX174:594 0 0.00 0 +phiX174:595 0 0.00 0 +phiX174:596 0 0.00 0 +phiX174:597 0 0.00 0 +phiX174:598 0 0.00 0 +phiX174:599 0 0.00 0 +phiX174:600 0 0.00 0 +phiX174:601 0 0.00 0 +phiX174:602 0 0.00 0 +phiX174:603 0 0.00 0 +phiX174:604 0 0.00 0 +phiX174:605 0 0.00 0 +phiX174:606 0 0.00 0 +phiX174:607 0 0.00 0 +phiX174:608 0 0.00 0 +phiX174:609 0 0.00 0 +phiX174:610 0 0.00 0 +phiX174:611 0 0.00 0 +phiX174:612 0 0.00 0 +phiX174:613 0 0.00 0 +phiX174:614 0 0.00 0 +phiX174:615 0 0.00 0 +phiX174:616 0 0.00 0 +phiX174:617 0 0.00 0 +phiX174:618 0 0.00 0 +phiX174:619 0 0.00 0 +phiX174:620 0 0.00 0 +phiX174:621 0 0.00 0 +phiX174:622 0 0.00 0 +phiX174:623 0 0.00 0 +phiX174:624 0 0.00 0 +phiX174:625 0 0.00 0 +phiX174:626 0 0.00 0 +phiX174:627 0 0.00 0 +phiX174:628 0 0.00 0 +phiX174:629 0 0.00 0 +phiX174:630 0 0.00 0 +phiX174:631 0 0.00 0 +phiX174:632 0 0.00 0 +phiX174:633 0 0.00 0 +phiX174:634 0 0.00 0 +phiX174:635 0 0.00 0 +phiX174:636 0 0.00 0 +phiX174:637 0 0.00 0 +phiX174:638 0 0.00 0 +phiX174:639 0 0.00 0 +phiX174:640 0 0.00 0 +phiX174:641 0 0.00 0 +phiX174:642 0 0.00 0 +phiX174:643 0 0.00 0 +phiX174:644 0 0.00 0 +phiX174:645 0 0.00 0 +phiX174:646 0 0.00 0 +phiX174:647 0 0.00 0 +phiX174:648 0 0.00 0 +phiX174:649 0 0.00 0 +phiX174:650 0 0.00 0 +phiX174:651 0 0.00 0 +phiX174:652 0 0.00 0 +phiX174:653 0 0.00 0 +phiX174:654 0 0.00 0 +phiX174:655 0 0.00 0 +phiX174:656 0 0.00 0 +phiX174:657 0 0.00 0 +phiX174:658 0 0.00 0 +phiX174:659 0 0.00 0 +phiX174:660 0 0.00 0 +phiX174:661 0 0.00 0 +phiX174:662 0 0.00 0 +phiX174:663 0 0.00 0 +phiX174:664 0 0.00 0 +phiX174:665 0 0.00 0 +phiX174:666 0 0.00 0 +phiX174:667 0 0.00 0 +phiX174:668 0 0.00 0 +phiX174:669 0 0.00 0 +phiX174:670 0 0.00 0 +phiX174:671 0 0.00 0 +phiX174:672 0 0.00 0 +phiX174:673 0 0.00 0 +phiX174:674 0 0.00 0 +phiX174:675 0 0.00 0 +phiX174:676 0 0.00 0 +phiX174:677 0 0.00 0 +phiX174:678 0 0.00 0 +phiX174:679 0 0.00 0 +phiX174:680 0 0.00 0 +phiX174:681 0 0.00 0 +phiX174:682 0 0.00 0 +phiX174:683 0 0.00 0 +phiX174:684 0 0.00 0 +phiX174:685 0 0.00 0 +phiX174:686 0 0.00 0 +phiX174:687 0 0.00 0 +phiX174:688 0 0.00 0 +phiX174:689 0 0.00 0 +phiX174:690 0 0.00 0 +phiX174:691 0 0.00 0 +phiX174:692 0 0.00 0 +phiX174:693 0 0.00 0 +phiX174:694 0 0.00 0 +phiX174:695 0 0.00 0 +phiX174:696 0 0.00 0 +phiX174:697 0 0.00 0 +phiX174:698 0 0.00 0 +phiX174:699 0 0.00 0 +phiX174:700 0 0.00 0 +phiX174:701 0 0.00 0 +phiX174:702 0 0.00 0 +phiX174:703 0 0.00 0 +phiX174:704 0 0.00 0 +phiX174:705 0 0.00 0 +phiX174:706 0 0.00 0 +phiX174:707 0 0.00 0 +phiX174:708 0 0.00 0 +phiX174:709 0 0.00 0 +phiX174:710 0 0.00 0 +phiX174:711 0 0.00 0 +phiX174:712 0 0.00 0 +phiX174:713 0 0.00 0 +phiX174:714 0 0.00 0 +phiX174:715 0 0.00 0 +phiX174:716 0 0.00 0 +phiX174:717 0 0.00 0 +phiX174:718 0 0.00 0 +phiX174:719 0 0.00 0 +phiX174:720 0 0.00 0 +phiX174:721 0 0.00 0 +phiX174:722 0 0.00 0 +phiX174:723 0 0.00 0 +phiX174:724 0 0.00 0 +phiX174:725 0 0.00 0 +phiX174:726 0 0.00 0 +phiX174:727 0 0.00 0 +phiX174:728 0 0.00 0 +phiX174:729 0 0.00 0 +phiX174:730 0 0.00 0 +phiX174:731 0 0.00 0 +phiX174:732 0 0.00 0 +phiX174:733 0 0.00 0 +phiX174:734 0 0.00 0 +phiX174:735 0 0.00 0 +phiX174:736 0 0.00 0 +phiX174:737 0 0.00 0 +phiX174:738 0 0.00 0 +phiX174:739 0 0.00 0 +phiX174:740 0 0.00 0 +phiX174:741 0 0.00 0 +phiX174:742 0 0.00 0 +phiX174:743 0 0.00 0 +phiX174:744 0 0.00 0 +phiX174:745 0 0.00 0 +phiX174:746 0 0.00 0 +phiX174:747 0 0.00 0 +phiX174:748 0 0.00 0 +phiX174:749 0 0.00 0 +phiX174:750 0 0.00 0 +phiX174:751 0 0.00 0 +phiX174:752 0 0.00 0 +phiX174:753 0 0.00 0 +phiX174:754 0 0.00 0 +phiX174:755 0 0.00 0 +phiX174:756 0 0.00 0 +phiX174:757 0 0.00 0 +phiX174:758 0 0.00 0 +phiX174:759 0 0.00 0 +phiX174:760 0 0.00 0 +phiX174:761 0 0.00 0 +phiX174:762 0 0.00 0 +phiX174:763 0 0.00 0 +phiX174:764 0 0.00 0 +phiX174:765 0 0.00 0 +phiX174:766 0 0.00 0 +phiX174:767 0 0.00 0 +phiX174:768 0 0.00 0 +phiX174:769 0 0.00 0 +phiX174:770 0 0.00 0 +phiX174:771 0 0.00 0 +phiX174:772 0 0.00 0 +phiX174:773 0 0.00 0 +phiX174:774 0 0.00 0 +phiX174:775 0 0.00 0 +phiX174:776 0 0.00 0 +phiX174:777 0 0.00 0 +phiX174:778 0 0.00 0 +phiX174:779 0 0.00 0 +phiX174:780 0 0.00 0 +phiX174:781 0 0.00 0 +phiX174:782 0 0.00 0 +phiX174:783 0 0.00 0 +phiX174:784 0 0.00 0 +phiX174:785 0 0.00 0 +phiX174:786 0 0.00 0 +phiX174:787 0 0.00 0 +phiX174:788 0 0.00 0 +phiX174:789 0 0.00 0 +phiX174:790 0 0.00 0 +phiX174:791 0 0.00 0 +phiX174:792 0 0.00 0 +phiX174:793 0 0.00 0 +phiX174:794 0 0.00 0 +phiX174:795 0 0.00 0 +phiX174:796 0 0.00 0 +phiX174:797 0 0.00 0 +phiX174:798 0 0.00 0 +phiX174:799 0 0.00 0 +phiX174:800 0 0.00 0 +phiX174:801 0 0.00 0 +phiX174:802 0 0.00 0 +phiX174:803 0 0.00 0 +phiX174:804 0 0.00 0 +phiX174:805 0 0.00 0 +phiX174:806 0 0.00 0 +phiX174:807 0 0.00 0 +phiX174:808 0 0.00 0 +phiX174:809 0 0.00 0 +phiX174:810 0 0.00 0 +phiX174:811 0 0.00 0 +phiX174:812 0 0.00 0 +phiX174:813 0 0.00 0 +phiX174:814 0 0.00 0 +phiX174:815 0 0.00 0 +phiX174:816 0 0.00 0 +phiX174:817 0 0.00 0 +phiX174:818 0 0.00 0 +phiX174:819 0 0.00 0 +phiX174:820 0 0.00 0 +phiX174:821 0 0.00 0 +phiX174:822 0 0.00 0 +phiX174:823 0 0.00 0 +phiX174:824 0 0.00 0 +phiX174:825 0 0.00 0 +phiX174:826 0 0.00 0 +phiX174:827 0 0.00 0 +phiX174:828 0 0.00 0 +phiX174:829 0 0.00 0 +phiX174:830 0 0.00 0 +phiX174:831 0 0.00 0 +phiX174:832 0 0.00 0 +phiX174:833 0 0.00 0 +phiX174:834 0 0.00 0 +phiX174:835 0 0.00 0 +phiX174:836 0 0.00 0 +phiX174:837 0 0.00 0 +phiX174:838 0 0.00 0 +phiX174:839 0 0.00 0 +phiX174:840 0 0.00 0 +phiX174:841 0 0.00 0 +phiX174:842 0 0.00 0 +phiX174:843 0 0.00 0 +phiX174:844 0 0.00 0 +phiX174:845 0 0.00 0 +phiX174:846 0 0.00 0 +phiX174:847 0 0.00 0 +phiX174:848 0 0.00 0 +phiX174:849 0 0.00 0 +phiX174:850 0 0.00 0 +phiX174:851 0 0.00 0 +phiX174:852 0 0.00 0 +phiX174:853 0 0.00 0 +phiX174:854 0 0.00 0 +phiX174:855 0 0.00 0 +phiX174:856 0 0.00 0 +phiX174:857 0 0.00 0 +phiX174:858 0 0.00 0 +phiX174:859 0 0.00 0 +phiX174:860 0 0.00 0 +phiX174:861 0 0.00 0 +phiX174:862 0 0.00 0 +phiX174:863 0 0.00 0 +phiX174:864 0 0.00 0 +phiX174:865 0 0.00 0 +phiX174:866 0 0.00 0 +phiX174:867 0 0.00 0 +phiX174:868 0 0.00 0 +phiX174:869 0 0.00 0 +phiX174:870 0 0.00 0 +phiX174:871 0 0.00 0 +phiX174:872 0 0.00 0 +phiX174:873 0 0.00 0 +phiX174:874 0 0.00 0 +phiX174:875 0 0.00 0 +phiX174:876 0 0.00 0 +phiX174:877 0 0.00 0 +phiX174:878 0 0.00 0 +phiX174:879 0 0.00 0 +phiX174:880 0 0.00 0 +phiX174:881 0 0.00 0 +phiX174:882 0 0.00 0 +phiX174:883 0 0.00 0 +phiX174:884 0 0.00 0 +phiX174:885 0 0.00 0 +phiX174:886 0 0.00 0 +phiX174:887 0 0.00 0 +phiX174:888 0 0.00 0 +phiX174:889 0 0.00 0 +phiX174:890 0 0.00 0 +phiX174:891 0 0.00 0 +phiX174:892 0 0.00 0 +phiX174:893 0 0.00 0 +phiX174:894 0 0.00 0 +phiX174:895 0 0.00 0 +phiX174:896 0 0.00 0 +phiX174:897 0 0.00 0 +phiX174:898 0 0.00 0 +phiX174:899 0 0.00 0 +phiX174:900 0 0.00 0 +phiX174:901 0 0.00 0 +phiX174:902 0 0.00 0 +phiX174:903 0 0.00 0 +phiX174:904 0 0.00 0 +phiX174:905 0 0.00 0 +phiX174:906 0 0.00 0 +phiX174:907 0 0.00 0 +phiX174:908 0 0.00 0 +phiX174:909 0 0.00 0 +phiX174:910 0 0.00 0 +phiX174:911 0 0.00 0 +phiX174:912 0 0.00 0 +phiX174:913 0 0.00 0 +phiX174:914 0 0.00 0 +phiX174:915 0 0.00 0 +phiX174:916 0 0.00 0 +phiX174:917 0 0.00 0 +phiX174:918 0 0.00 0 +phiX174:919 0 0.00 0 +phiX174:920 0 0.00 0 +phiX174:921 0 0.00 0 +phiX174:922 0 0.00 0 +phiX174:923 0 0.00 0 +phiX174:924 0 0.00 0 +phiX174:925 0 0.00 0 +phiX174:926 0 0.00 0 +phiX174:927 0 0.00 0 +phiX174:928 0 0.00 0 +phiX174:929 0 0.00 0 +phiX174:930 0 0.00 0 +phiX174:931 0 0.00 0 +phiX174:932 0 0.00 0 +phiX174:933 0 0.00 0 +phiX174:934 0 0.00 0 +phiX174:935 0 0.00 0 +phiX174:936 0 0.00 0 +phiX174:937 0 0.00 0 +phiX174:938 0 0.00 0 +phiX174:939 0 0.00 0 +phiX174:940 0 0.00 0 +phiX174:941 0 0.00 0 +phiX174:942 0 0.00 0 +phiX174:943 0 0.00 0 +phiX174:944 0 0.00 0 +phiX174:945 0 0.00 0 +phiX174:946 0 0.00 0 +phiX174:947 0 0.00 0 +phiX174:948 0 0.00 0 +phiX174:949 0 0.00 0 +phiX174:950 0 0.00 0 +phiX174:951 0 0.00 0 +phiX174:952 0 0.00 0 +phiX174:953 0 0.00 0 +phiX174:954 0 0.00 0 +phiX174:955 0 0.00 0 +phiX174:956 0 0.00 0 +phiX174:957 0 0.00 0 +phiX174:958 0 0.00 0 +phiX174:959 0 0.00 0 +phiX174:960 0 0.00 0 +phiX174:961 0 0.00 0 +phiX174:962 0 0.00 0 +phiX174:963 0 0.00 0 +phiX174:964 0 0.00 0 +phiX174:965 0 0.00 0 +phiX174:966 0 0.00 0 +phiX174:967 0 0.00 0 +phiX174:968 0 0.00 0 +phiX174:969 0 0.00 0 +phiX174:970 0 0.00 0 +phiX174:971 0 0.00 0 +phiX174:972 0 0.00 0 +phiX174:973 0 0.00 0 +phiX174:974 0 0.00 0 +phiX174:975 0 0.00 0 +phiX174:976 0 0.00 0 +phiX174:977 0 0.00 0 +phiX174:978 0 0.00 0 +phiX174:979 0 0.00 0 +phiX174:980 0 0.00 0 +phiX174:981 0 0.00 0 +phiX174:982 0 0.00 0 +phiX174:983 0 0.00 0 +phiX174:984 0 0.00 0 +phiX174:985 0 0.00 0 +phiX174:986 0 0.00 0 +phiX174:987 0 0.00 0 +phiX174:988 0 0.00 0 +phiX174:989 0 0.00 0 +phiX174:990 0 0.00 0 +phiX174:991 0 0.00 0 +phiX174:992 0 0.00 0 +phiX174:993 0 0.00 0 +phiX174:994 0 0.00 0 +phiX174:995 0 0.00 0 +phiX174:996 0 0.00 0 +phiX174:997 0 0.00 0 +phiX174:998 0 0.00 0 +phiX174:999 0 0.00 0 +phiX174:1000 0 0.00 0 +phiX174:1001 0 0.00 0 +phiX174:1002 0 0.00 0 +phiX174:1003 0 0.00 0 +phiX174:1004 0 0.00 0 +phiX174:1005 0 0.00 0 +phiX174:1006 0 0.00 0 +phiX174:1007 0 0.00 0 +phiX174:1008 0 0.00 0 +phiX174:1009 0 0.00 0 +phiX174:1010 0 0.00 0 +phiX174:1011 0 0.00 0 +phiX174:1012 0 0.00 0 +phiX174:1013 0 0.00 0 +phiX174:1014 0 0.00 0 +phiX174:1015 0 0.00 0 +phiX174:1016 0 0.00 0 +phiX174:1017 0 0.00 0 +phiX174:1018 0 0.00 0 +phiX174:1019 0 0.00 0 +phiX174:1020 0 0.00 0 +phiX174:1021 0 0.00 0 +phiX174:1022 0 0.00 0 +phiX174:1023 0 0.00 0 +phiX174:1024 0 0.00 0 +phiX174:1025 0 0.00 0 +phiX174:1026 0 0.00 0 +phiX174:1027 0 0.00 0 +phiX174:1028 0 0.00 0 +phiX174:1029 0 0.00 0 +phiX174:1030 0 0.00 0 +phiX174:1031 0 0.00 0 +phiX174:1032 0 0.00 0 +phiX174:1033 0 0.00 0 +phiX174:1034 0 0.00 0 +phiX174:1035 0 0.00 0 +phiX174:1036 0 0.00 0 +phiX174:1037 0 0.00 0 +phiX174:1038 0 0.00 0 +phiX174:1039 0 0.00 0 +phiX174:1040 0 0.00 0 +phiX174:1041 0 0.00 0 +phiX174:1042 0 0.00 0 +phiX174:1043 0 0.00 0 +phiX174:1044 0 0.00 0 +phiX174:1045 0 0.00 0 +phiX174:1046 0 0.00 0 +phiX174:1047 0 0.00 0 +phiX174:1048 0 0.00 0 +phiX174:1049 0 0.00 0 +phiX174:1050 0 0.00 0 +phiX174:1051 0 0.00 0 +phiX174:1052 0 0.00 0 +phiX174:1053 0 0.00 0 +phiX174:1054 0 0.00 0 +phiX174:1055 0 0.00 0 +phiX174:1056 0 0.00 0 +phiX174:1057 0 0.00 0 +phiX174:1058 0 0.00 0 +phiX174:1059 0 0.00 0 +phiX174:1060 0 0.00 0 +phiX174:1061 0 0.00 0 +phiX174:1062 0 0.00 0 +phiX174:1063 0 0.00 0 +phiX174:1064 0 0.00 0 +phiX174:1065 0 0.00 0 +phiX174:1066 0 0.00 0 +phiX174:1067 0 0.00 0 +phiX174:1068 0 0.00 0 +phiX174:1069 0 0.00 0 +phiX174:1070 0 0.00 0 +phiX174:1071 0 0.00 0 +phiX174:1072 0 0.00 0 +phiX174:1073 0 0.00 0 +phiX174:1074 0 0.00 0 +phiX174:1075 0 0.00 0 +phiX174:1076 0 0.00 0 +phiX174:1077 0 0.00 0 +phiX174:1078 0 0.00 0 +phiX174:1079 0 0.00 0 +phiX174:1080 0 0.00 0 +phiX174:1081 0 0.00 0 +phiX174:1082 0 0.00 0 +phiX174:1083 0 0.00 0 +phiX174:1084 0 0.00 0 +phiX174:1085 0 0.00 0 +phiX174:1086 0 0.00 0 +phiX174:1087 0 0.00 0 +phiX174:1088 0 0.00 0 +phiX174:1089 0 0.00 0 +phiX174:1090 0 0.00 0 +phiX174:1091 0 0.00 0 +phiX174:1092 0 0.00 0 +phiX174:1093 0 0.00 0 +phiX174:1094 0 0.00 0 +phiX174:1095 0 0.00 0 +phiX174:1096 0 0.00 0 +phiX174:1097 0 0.00 0 +phiX174:1098 0 0.00 0 +phiX174:1099 0 0.00 0 +phiX174:1100 0 0.00 0 +phiX174:1101 0 0.00 0 +phiX174:1102 0 0.00 0 +phiX174:1103 0 0.00 0 +phiX174:1104 0 0.00 0 +phiX174:1105 0 0.00 0 +phiX174:1106 0 0.00 0 +phiX174:1107 0 0.00 0 +phiX174:1108 0 0.00 0 +phiX174:1109 0 0.00 0 +phiX174:1110 0 0.00 0 +phiX174:1111 0 0.00 0 +phiX174:1112 0 0.00 0 +phiX174:1113 0 0.00 0 +phiX174:1114 0 0.00 0 +phiX174:1115 0 0.00 0 +phiX174:1116 0 0.00 0 +phiX174:1117 0 0.00 0 +phiX174:1118 0 0.00 0 +phiX174:1119 0 0.00 0 +phiX174:1120 0 0.00 0 +phiX174:1121 0 0.00 0 +phiX174:1122 0 0.00 0 +phiX174:1123 0 0.00 0 +phiX174:1124 0 0.00 0 +phiX174:1125 0 0.00 0 +phiX174:1126 0 0.00 0 +phiX174:1127 0 0.00 0 +phiX174:1128 0 0.00 0 +phiX174:1129 0 0.00 0 +phiX174:1130 0 0.00 0 +phiX174:1131 0 0.00 0 +phiX174:1132 0 0.00 0 +phiX174:1133 0 0.00 0 +phiX174:1134 0 0.00 0 +phiX174:1135 0 0.00 0 +phiX174:1136 0 0.00 0 +phiX174:1137 0 0.00 0 +phiX174:1138 0 0.00 0 +phiX174:1139 0 0.00 0 +phiX174:1140 0 0.00 0 +phiX174:1141 0 0.00 0 +phiX174:1142 0 0.00 0 +phiX174:1143 0 0.00 0 +phiX174:1144 0 0.00 0 +phiX174:1145 0 0.00 0 +phiX174:1146 0 0.00 0 +phiX174:1147 0 0.00 0 +phiX174:1148 0 0.00 0 +phiX174:1149 0 0.00 0 +phiX174:1150 0 0.00 0 +phiX174:1151 0 0.00 0 +phiX174:1152 0 0.00 0 +phiX174:1153 0 0.00 0 +phiX174:1154 0 0.00 0 +phiX174:1155 0 0.00 0 +phiX174:1156 0 0.00 0 +phiX174:1157 0 0.00 0 +phiX174:1158 0 0.00 0 +phiX174:1159 0 0.00 0 +phiX174:1160 0 0.00 0 +phiX174:1161 0 0.00 0 +phiX174:1162 0 0.00 0 +phiX174:1163 0 0.00 0 +phiX174:1164 0 0.00 0 +phiX174:1165 0 0.00 0 +phiX174:1166 0 0.00 0 +phiX174:1167 0 0.00 0 +phiX174:1168 0 0.00 0 +phiX174:1169 0 0.00 0 +phiX174:1170 0 0.00 0 +phiX174:1171 0 0.00 0 +phiX174:1172 0 0.00 0 +phiX174:1173 0 0.00 0 +phiX174:1174 0 0.00 0 +phiX174:1175 0 0.00 0 +phiX174:1176 0 0.00 0 +phiX174:1177 0 0.00 0 +phiX174:1178 0 0.00 0 +phiX174:1179 0 0.00 0 +phiX174:1180 0 0.00 0 +phiX174:1181 0 0.00 0 +phiX174:1182 0 0.00 0 +phiX174:1183 0 0.00 0 +phiX174:1184 0 0.00 0 +phiX174:1185 0 0.00 0 +phiX174:1186 0 0.00 0 +phiX174:1187 0 0.00 0 +phiX174:1188 0 0.00 0 +phiX174:1189 0 0.00 0 +phiX174:1190 0 0.00 0 +phiX174:1191 0 0.00 0 +phiX174:1192 0 0.00 0 +phiX174:1193 0 0.00 0 +phiX174:1194 0 0.00 0 +phiX174:1195 0 0.00 0 +phiX174:1196 0 0.00 0 +phiX174:1197 0 0.00 0 +phiX174:1198 0 0.00 0 +phiX174:1199 0 0.00 0 +phiX174:1200 0 0.00 0 +phiX174:1201 0 0.00 0 +phiX174:1202 0 0.00 0 +phiX174:1203 0 0.00 0 +phiX174:1204 0 0.00 0 +phiX174:1205 0 0.00 0 +phiX174:1206 0 0.00 0 +phiX174:1207 0 0.00 0 +phiX174:1208 0 0.00 0 +phiX174:1209 0 0.00 0 +phiX174:1210 0 0.00 0 +phiX174:1211 0 0.00 0 +phiX174:1212 0 0.00 0 +phiX174:1213 0 0.00 0 +phiX174:1214 0 0.00 0 +phiX174:1215 0 0.00 0 +phiX174:1216 0 0.00 0 +phiX174:1217 0 0.00 0 +phiX174:1218 0 0.00 0 +phiX174:1219 0 0.00 0 +phiX174:1220 0 0.00 0 +phiX174:1221 0 0.00 0 +phiX174:1222 0 0.00 0 +phiX174:1223 0 0.00 0 +phiX174:1224 0 0.00 0 +phiX174:1225 0 0.00 0 +phiX174:1226 0 0.00 0 +phiX174:1227 0 0.00 0 +phiX174:1228 0 0.00 0 +phiX174:1229 0 0.00 0 +phiX174:1230 0 0.00 0 +phiX174:1231 0 0.00 0 +phiX174:1232 0 0.00 0 +phiX174:1233 0 0.00 0 +phiX174:1234 0 0.00 0 +phiX174:1235 0 0.00 0 +phiX174:1236 0 0.00 0 +phiX174:1237 0 0.00 0 +phiX174:1238 0 0.00 0 +phiX174:1239 0 0.00 0 +phiX174:1240 0 0.00 0 +phiX174:1241 0 0.00 0 +phiX174:1242 0 0.00 0 +phiX174:1243 0 0.00 0 +phiX174:1244 0 0.00 0 +phiX174:1245 0 0.00 0 +phiX174:1246 0 0.00 0 +phiX174:1247 0 0.00 0 +phiX174:1248 0 0.00 0 +phiX174:1249 0 0.00 0 +phiX174:1250 0 0.00 0 +phiX174:1251 0 0.00 0 +phiX174:1252 0 0.00 0 +phiX174:1253 0 0.00 0 +phiX174:1254 0 0.00 0 +phiX174:1255 0 0.00 0 +phiX174:1256 0 0.00 0 +phiX174:1257 0 0.00 0 +phiX174:1258 0 0.00 0 +phiX174:1259 0 0.00 0 +phiX174:1260 0 0.00 0 +phiX174:1261 0 0.00 0 +phiX174:1262 0 0.00 0 +phiX174:1263 0 0.00 0 +phiX174:1264 0 0.00 0 +phiX174:1265 0 0.00 0 +phiX174:1266 0 0.00 0 +phiX174:1267 0 0.00 0 +phiX174:1268 0 0.00 0 +phiX174:1269 0 0.00 0 +phiX174:1270 0 0.00 0 +phiX174:1271 0 0.00 0 +phiX174:1272 0 0.00 0 +phiX174:1273 0 0.00 0 +phiX174:1274 0 0.00 0 +phiX174:1275 0 0.00 0 +phiX174:1276 0 0.00 0 +phiX174:1277 0 0.00 0 +phiX174:1278 0 0.00 0 +phiX174:1279 0 0.00 0 +phiX174:1280 0 0.00 0 +phiX174:1281 0 0.00 0 +phiX174:1282 0 0.00 0 +phiX174:1283 0 0.00 0 +phiX174:1284 0 0.00 0 +phiX174:1285 0 0.00 0 +phiX174:1286 0 0.00 0 +phiX174:1287 0 0.00 0 +phiX174:1288 0 0.00 0 +phiX174:1289 0 0.00 0 +phiX174:1290 0 0.00 0 +phiX174:1291 0 0.00 0 +phiX174:1292 0 0.00 0 +phiX174:1293 0 0.00 0 +phiX174:1294 0 0.00 0 +phiX174:1295 0 0.00 0 +phiX174:1296 0 0.00 0 +phiX174:1297 0 0.00 0 +phiX174:1298 0 0.00 0 +phiX174:1299 0 0.00 0 +phiX174:1300 0 0.00 0 +phiX174:1301 0 0.00 0 +phiX174:1302 0 0.00 0 +phiX174:1303 0 0.00 0 +phiX174:1304 0 0.00 0 +phiX174:1305 0 0.00 0 +phiX174:1306 0 0.00 0 +phiX174:1307 0 0.00 0 +phiX174:1308 0 0.00 0 +phiX174:1309 0 0.00 0 +phiX174:1310 0 0.00 0 +phiX174:1311 0 0.00 0 +phiX174:1312 0 0.00 0 +phiX174:1313 0 0.00 0 +phiX174:1314 0 0.00 0 +phiX174:1315 0 0.00 0 +phiX174:1316 0 0.00 0 +phiX174:1317 0 0.00 0 +phiX174:1318 0 0.00 0 +phiX174:1319 0 0.00 0 +phiX174:1320 0 0.00 0 +phiX174:1321 0 0.00 0 +phiX174:1322 0 0.00 0 +phiX174:1323 0 0.00 0 +phiX174:1324 0 0.00 0 +phiX174:1325 0 0.00 0 +phiX174:1326 0 0.00 0 +phiX174:1327 0 0.00 0 +phiX174:1328 0 0.00 0 +phiX174:1329 0 0.00 0 +phiX174:1330 0 0.00 0 +phiX174:1331 0 0.00 0 +phiX174:1332 0 0.00 0 +phiX174:1333 0 0.00 0 +phiX174:1334 0 0.00 0 +phiX174:1335 0 0.00 0 +phiX174:1336 0 0.00 0 +phiX174:1337 0 0.00 0 +phiX174:1338 0 0.00 0 +phiX174:1339 0 0.00 0 +phiX174:1340 0 0.00 0 +phiX174:1341 0 0.00 0 +phiX174:1342 0 0.00 0 +phiX174:1343 0 0.00 0 +phiX174:1344 0 0.00 0 +phiX174:1345 0 0.00 0 +phiX174:1346 0 0.00 0 +phiX174:1347 0 0.00 0 +phiX174:1348 0 0.00 0 +phiX174:1349 0 0.00 0 +phiX174:1350 0 0.00 0 +phiX174:1351 0 0.00 0 +phiX174:1352 0 0.00 0 +phiX174:1353 0 0.00 0 +phiX174:1354 0 0.00 0 +phiX174:1355 0 0.00 0 +phiX174:1356 0 0.00 0 +phiX174:1357 0 0.00 0 +phiX174:1358 0 0.00 0 +phiX174:1359 0 0.00 0 +phiX174:1360 0 0.00 0 +phiX174:1361 0 0.00 0 +phiX174:1362 0 0.00 0 +phiX174:1363 0 0.00 0 +phiX174:1364 0 0.00 0 +phiX174:1365 0 0.00 0 +phiX174:1366 0 0.00 0 +phiX174:1367 0 0.00 0 +phiX174:1368 0 0.00 0 +phiX174:1369 0 0.00 0 +phiX174:1370 0 0.00 0 +phiX174:1371 0 0.00 0 +phiX174:1372 0 0.00 0 +phiX174:1373 0 0.00 0 +phiX174:1374 0 0.00 0 +phiX174:1375 0 0.00 0 +phiX174:1376 0 0.00 0 +phiX174:1377 0 0.00 0 +phiX174:1378 0 0.00 0 +phiX174:1379 0 0.00 0 +phiX174:1380 0 0.00 0 +phiX174:1381 0 0.00 0 +phiX174:1382 0 0.00 0 +phiX174:1383 0 0.00 0 +phiX174:1384 0 0.00 0 +phiX174:1385 0 0.00 0 +phiX174:1386 0 0.00 0 +phiX174:1387 0 0.00 0 +phiX174:1388 0 0.00 0 +phiX174:1389 0 0.00 0 +phiX174:1390 0 0.00 0 +phiX174:1391 0 0.00 0 +phiX174:1392 0 0.00 0 +phiX174:1393 0 0.00 0 +phiX174:1394 0 0.00 0 +phiX174:1395 0 0.00 0 +phiX174:1396 0 0.00 0 +phiX174:1397 0 0.00 0 +phiX174:1398 0 0.00 0 +phiX174:1399 0 0.00 0 +phiX174:1400 0 0.00 0 +phiX174:1401 0 0.00 0 +phiX174:1402 0 0.00 0 +phiX174:1403 0 0.00 0 +phiX174:1404 0 0.00 0 +phiX174:1405 0 0.00 0 +phiX174:1406 0 0.00 0 +phiX174:1407 0 0.00 0 +phiX174:1408 0 0.00 0 +phiX174:1409 0 0.00 0 +phiX174:1410 0 0.00 0 +phiX174:1411 1 1.00 1 +phiX174:1412 3 3.00 3 +phiX174:1413 5 5.00 5 +phiX174:1414 6 6.00 6 +phiX174:1415 7 7.00 7 +phiX174:1416 8 8.00 8 +phiX174:1417 9 9.00 9 +phiX174:1418 10 10.00 10 +phiX174:1419 10 10.00 10 +phiX174:1420 10 10.00 10 +phiX174:1421 10 10.00 10 +phiX174:1422 10 10.00 10 +phiX174:1423 10 10.00 10 +phiX174:1424 10 10.00 10 +phiX174:1425 10 10.00 10 +phiX174:1426 10 10.00 10 +phiX174:1427 10 10.00 10 +phiX174:1428 10 10.00 10 +phiX174:1429 10 10.00 10 +phiX174:1430 10 10.00 10 +phiX174:1431 10 10.00 10 +phiX174:1432 10 10.00 10 +phiX174:1433 10 10.00 10 +phiX174:1434 10 10.00 10 +phiX174:1435 10 10.00 10 +phiX174:1436 10 10.00 10 +phiX174:1437 10 10.00 10 +phiX174:1438 10 10.00 10 +phiX174:1439 10 10.00 10 +phiX174:1440 10 10.00 10 +phiX174:1441 10 10.00 10 +phiX174:1442 10 10.00 10 +phiX174:1443 10 10.00 10 +phiX174:1444 7 7.00 7 +phiX174:1445 10 10.00 10 +phiX174:1446 10 10.00 10 +phiX174:1447 10 10.00 10 +phiX174:1448 8 8.00 8 +phiX174:1449 6 6.00 6 +phiX174:1450 4 4.00 4 +phiX174:1451 3 3.00 3 +phiX174:1452 2 2.00 2 +phiX174:1453 1 1.00 1 +phiX174:1454 0 0.00 0 +phiX174:1455 0 0.00 0 +phiX174:1456 0 0.00 0 +phiX174:1457 0 0.00 0 +phiX174:1458 0 0.00 0 +phiX174:1459 0 0.00 0 +phiX174:1460 0 0.00 0 +phiX174:1461 0 0.00 0 +phiX174:1462 0 0.00 0 +phiX174:1463 0 0.00 0 +phiX174:1464 0 0.00 0 +phiX174:1465 0 0.00 0 +phiX174:1466 0 0.00 0 +phiX174:1467 0 0.00 0 +phiX174:1468 0 0.00 0 +phiX174:1469 0 0.00 0 +phiX174:1470 0 0.00 0 +phiX174:1471 0 0.00 0 +phiX174:1472 0 0.00 0 +phiX174:1473 0 0.00 0 +phiX174:1474 0 0.00 0 +phiX174:1475 0 0.00 0 +phiX174:1476 0 0.00 0 +phiX174:1477 0 0.00 0 +phiX174:1478 0 0.00 0 +phiX174:1479 0 0.00 0 +phiX174:1480 0 0.00 0 +phiX174:1481 0 0.00 0 +phiX174:1482 0 0.00 0 +phiX174:1483 0 0.00 0 +phiX174:1484 0 0.00 0 +phiX174:1485 0 0.00 0 +phiX174:1486 0 0.00 0 +phiX174:1487 0 0.00 0 +phiX174:1488 0 0.00 0 +phiX174:1489 0 0.00 0 +phiX174:1490 0 0.00 0 +phiX174:1491 0 0.00 0 +phiX174:1492 0 0.00 0 +phiX174:1493 0 0.00 0 +phiX174:1494 0 0.00 0 +phiX174:1495 0 0.00 0 +phiX174:1496 0 0.00 0 +phiX174:1497 0 0.00 0 +phiX174:1498 0 0.00 0 +phiX174:1499 0 0.00 0 +phiX174:1500 0 0.00 0 +phiX174:1501 0 0.00 0 +phiX174:1502 0 0.00 0 +phiX174:1503 0 0.00 0 +phiX174:1504 0 0.00 0 +phiX174:1505 0 0.00 0 +phiX174:1506 0 0.00 0 +phiX174:1507 0 0.00 0 +phiX174:1508 0 0.00 0 +phiX174:1509 0 0.00 0 +phiX174:1510 0 0.00 0 +phiX174:1511 0 0.00 0 +phiX174:1512 0 0.00 0 +phiX174:1513 0 0.00 0 +phiX174:1514 0 0.00 0 +phiX174:1515 0 0.00 0 +phiX174:1516 0 0.00 0 +phiX174:1517 0 0.00 0 +phiX174:1518 0 0.00 0 +phiX174:1519 0 0.00 0 +phiX174:1520 0 0.00 0 +phiX174:1521 0 0.00 0 +phiX174:1522 0 0.00 0 +phiX174:1523 0 0.00 0 +phiX174:1524 0 0.00 0 +phiX174:1525 0 0.00 0 +phiX174:1526 0 0.00 0 +phiX174:1527 0 0.00 0 +phiX174:1528 0 0.00 0 +phiX174:1529 0 0.00 0 +phiX174:1530 0 0.00 0 +phiX174:1531 0 0.00 0 +phiX174:1532 0 0.00 0 +phiX174:1533 0 0.00 0 +phiX174:1534 0 0.00 0 +phiX174:1535 0 0.00 0 +phiX174:1536 0 0.00 0 +phiX174:1537 0 0.00 0 +phiX174:1538 0 0.00 0 +phiX174:1539 0 0.00 0 +phiX174:1540 0 0.00 0 +phiX174:1541 0 0.00 0 +phiX174:1542 0 0.00 0 +phiX174:1543 0 0.00 0 +phiX174:1544 0 0.00 0 +phiX174:1545 0 0.00 0 +phiX174:1546 0 0.00 0 +phiX174:1547 0 0.00 0 +phiX174:1548 0 0.00 0 +phiX174:1549 0 0.00 0 +phiX174:1550 0 0.00 0 +phiX174:1551 0 0.00 0 +phiX174:1552 0 0.00 0 +phiX174:1553 0 0.00 0 +phiX174:1554 0 0.00 0 +phiX174:1555 0 0.00 0 +phiX174:1556 0 0.00 0 +phiX174:1557 0 0.00 0 +phiX174:1558 0 0.00 0 +phiX174:1559 0 0.00 0 +phiX174:1560 0 0.00 0 +phiX174:1561 0 0.00 0 +phiX174:1562 0 0.00 0 +phiX174:1563 0 0.00 0 +phiX174:1564 0 0.00 0 +phiX174:1565 0 0.00 0 +phiX174:1566 0 0.00 0 +phiX174:1567 0 0.00 0 +phiX174:1568 0 0.00 0 +phiX174:1569 0 0.00 0 +phiX174:1570 0 0.00 0 +phiX174:1571 0 0.00 0 +phiX174:1572 0 0.00 0 +phiX174:1573 0 0.00 0 +phiX174:1574 0 0.00 0 +phiX174:1575 0 0.00 0 +phiX174:1576 0 0.00 0 +phiX174:1577 0 0.00 0 +phiX174:1578 0 0.00 0 +phiX174:1579 0 0.00 0 +phiX174:1580 0 0.00 0 +phiX174:1581 0 0.00 0 +phiX174:1582 0 0.00 0 +phiX174:1583 0 0.00 0 +phiX174:1584 0 0.00 0 +phiX174:1585 0 0.00 0 +phiX174:1586 0 0.00 0 +phiX174:1587 0 0.00 0 +phiX174:1588 0 0.00 0 +phiX174:1589 0 0.00 0 +phiX174:1590 0 0.00 0 +phiX174:1591 0 0.00 0 +phiX174:1592 0 0.00 0 +phiX174:1593 0 0.00 0 +phiX174:1594 0 0.00 0 +phiX174:1595 0 0.00 0 +phiX174:1596 0 0.00 0 +phiX174:1597 0 0.00 0 +phiX174:1598 0 0.00 0 +phiX174:1599 0 0.00 0 +phiX174:1600 0 0.00 0 +phiX174:1601 0 0.00 0 +phiX174:1602 0 0.00 0 +phiX174:1603 0 0.00 0 +phiX174:1604 0 0.00 0 +phiX174:1605 0 0.00 0 +phiX174:1606 0 0.00 0 +phiX174:1607 0 0.00 0 +phiX174:1608 0 0.00 0 +phiX174:1609 0 0.00 0 +phiX174:1610 0 0.00 0 +phiX174:1611 0 0.00 0 +phiX174:1612 0 0.00 0 +phiX174:1613 0 0.00 0 +phiX174:1614 0 0.00 0 +phiX174:1615 0 0.00 0 +phiX174:1616 0 0.00 0 +phiX174:1617 0 0.00 0 +phiX174:1618 0 0.00 0 +phiX174:1619 0 0.00 0 +phiX174:1620 0 0.00 0 +phiX174:1621 0 0.00 0 +phiX174:1622 0 0.00 0 +phiX174:1623 0 0.00 0 +phiX174:1624 0 0.00 0 +phiX174:1625 0 0.00 0 +phiX174:1626 0 0.00 0 +phiX174:1627 0 0.00 0 +phiX174:1628 0 0.00 0 +phiX174:1629 0 0.00 0 +phiX174:1630 0 0.00 0 +phiX174:1631 0 0.00 0 +phiX174:1632 0 0.00 0 +phiX174:1633 0 0.00 0 +phiX174:1634 0 0.00 0 +phiX174:1635 0 0.00 0 +phiX174:1636 0 0.00 0 +phiX174:1637 0 0.00 0 +phiX174:1638 0 0.00 0 +phiX174:1639 0 0.00 0 +phiX174:1640 0 0.00 0 +phiX174:1641 0 0.00 0 +phiX174:1642 0 0.00 0 +phiX174:1643 0 0.00 0 +phiX174:1644 0 0.00 0 +phiX174:1645 0 0.00 0 +phiX174:1646 0 0.00 0 +phiX174:1647 0 0.00 0 +phiX174:1648 0 0.00 0 +phiX174:1649 0 0.00 0 +phiX174:1650 0 0.00 0 +phiX174:1651 0 0.00 0 +phiX174:1652 0 0.00 0 +phiX174:1653 0 0.00 0 +phiX174:1654 0 0.00 0 +phiX174:1655 0 0.00 0 +phiX174:1656 0 0.00 0 +phiX174:1657 0 0.00 0 +phiX174:1658 0 0.00 0 +phiX174:1659 0 0.00 0 +phiX174:1660 0 0.00 0 +phiX174:1661 0 0.00 0 +phiX174:1662 0 0.00 0 +phiX174:1663 0 0.00 0 +phiX174:1664 0 0.00 0 +phiX174:1665 0 0.00 0 +phiX174:1666 0 0.00 0 +phiX174:1667 0 0.00 0 +phiX174:1668 0 0.00 0 +phiX174:1669 0 0.00 0 +phiX174:1670 0 0.00 0 +phiX174:1671 0 0.00 0 +phiX174:1672 0 0.00 0 +phiX174:1673 0 0.00 0 +phiX174:1674 0 0.00 0 +phiX174:1675 0 0.00 0 +phiX174:1676 0 0.00 0 +phiX174:1677 0 0.00 0 +phiX174:1678 0 0.00 0 +phiX174:1679 0 0.00 0 +phiX174:1680 0 0.00 0 +phiX174:1681 0 0.00 0 +phiX174:1682 0 0.00 0 +phiX174:1683 0 0.00 0 +phiX174:1684 0 0.00 0 +phiX174:1685 0 0.00 0 +phiX174:1686 0 0.00 0 +phiX174:1687 0 0.00 0 +phiX174:1688 0 0.00 0 +phiX174:1689 0 0.00 0 +phiX174:1690 0 0.00 0 +phiX174:1691 0 0.00 0 +phiX174:1692 0 0.00 0 +phiX174:1693 0 0.00 0 +phiX174:1694 0 0.00 0 +phiX174:1695 0 0.00 0 +phiX174:1696 0 0.00 0 +phiX174:1697 0 0.00 0 +phiX174:1698 0 0.00 0 +phiX174:1699 0 0.00 0 +phiX174:1700 0 0.00 0 +phiX174:1701 0 0.00 0 +phiX174:1702 0 0.00 0 +phiX174:1703 0 0.00 0 +phiX174:1704 0 0.00 0 +phiX174:1705 0 0.00 0 +phiX174:1706 0 0.00 0 +phiX174:1707 0 0.00 0 +phiX174:1708 0 0.00 0 +phiX174:1709 0 0.00 0 +phiX174:1710 0 0.00 0 +phiX174:1711 0 0.00 0 +phiX174:1712 0 0.00 0 +phiX174:1713 0 0.00 0 +phiX174:1714 0 0.00 0 +phiX174:1715 0 0.00 0 +phiX174:1716 0 0.00 0 +phiX174:1717 0 0.00 0 +phiX174:1718 0 0.00 0 +phiX174:1719 0 0.00 0 +phiX174:1720 0 0.00 0 +phiX174:1721 0 0.00 0 +phiX174:1722 0 0.00 0 +phiX174:1723 0 0.00 0 +phiX174:1724 0 0.00 0 +phiX174:1725 0 0.00 0 +phiX174:1726 0 0.00 0 +phiX174:1727 0 0.00 0 +phiX174:1728 0 0.00 0 +phiX174:1729 0 0.00 0 +phiX174:1730 0 0.00 0 +phiX174:1731 0 0.00 0 +phiX174:1732 0 0.00 0 +phiX174:1733 0 0.00 0 +phiX174:1734 0 0.00 0 +phiX174:1735 0 0.00 0 +phiX174:1736 0 0.00 0 +phiX174:1737 0 0.00 0 +phiX174:1738 0 0.00 0 +phiX174:1739 0 0.00 0 +phiX174:1740 0 0.00 0 +phiX174:1741 0 0.00 0 +phiX174:1742 0 0.00 0 +phiX174:1743 0 0.00 0 +phiX174:1744 0 0.00 0 +phiX174:1745 0 0.00 0 +phiX174:1746 0 0.00 0 +phiX174:1747 0 0.00 0 +phiX174:1748 0 0.00 0 +phiX174:1749 0 0.00 0 +phiX174:1750 0 0.00 0 +phiX174:1751 0 0.00 0 +phiX174:1752 0 0.00 0 +phiX174:1753 0 0.00 0 +phiX174:1754 0 0.00 0 +phiX174:1755 0 0.00 0 +phiX174:1756 0 0.00 0 +phiX174:1757 0 0.00 0 +phiX174:1758 0 0.00 0 +phiX174:1759 0 0.00 0 +phiX174:1760 0 0.00 0 +phiX174:1761 0 0.00 0 +phiX174:1762 0 0.00 0 +phiX174:1763 0 0.00 0 +phiX174:1764 0 0.00 0 +phiX174:1765 0 0.00 0 +phiX174:1766 0 0.00 0 +phiX174:1767 0 0.00 0 +phiX174:1768 0 0.00 0 +phiX174:1769 0 0.00 0 +phiX174:1770 0 0.00 0 +phiX174:1771 0 0.00 0 +phiX174:1772 0 0.00 0 +phiX174:1773 0 0.00 0 +phiX174:1774 0 0.00 0 +phiX174:1775 0 0.00 0 +phiX174:1776 0 0.00 0 +phiX174:1777 0 0.00 0 +phiX174:1778 0 0.00 0 +phiX174:1779 0 0.00 0 +phiX174:1780 0 0.00 0 +phiX174:1781 0 0.00 0 +phiX174:1782 0 0.00 0 +phiX174:1783 0 0.00 0 +phiX174:1784 0 0.00 0 +phiX174:1785 0 0.00 0 +phiX174:1786 0 0.00 0 +phiX174:1787 0 0.00 0 +phiX174:1788 0 0.00 0 +phiX174:1789 0 0.00 0 +phiX174:1790 0 0.00 0 +phiX174:1791 0 0.00 0 +phiX174:1792 0 0.00 0 +phiX174:1793 0 0.00 0 +phiX174:1794 0 0.00 0 +phiX174:1795 0 0.00 0 +phiX174:1796 0 0.00 0 +phiX174:1797 0 0.00 0 +phiX174:1798 0 0.00 0 +phiX174:1799 0 0.00 0 +phiX174:1800 0 0.00 0 +phiX174:1801 0 0.00 0 +phiX174:1802 0 0.00 0 +phiX174:1803 0 0.00 0 +phiX174:1804 0 0.00 0 +phiX174:1805 0 0.00 0 +phiX174:1806 0 0.00 0 +phiX174:1807 0 0.00 0 +phiX174:1808 0 0.00 0 +phiX174:1809 0 0.00 0 +phiX174:1810 0 0.00 0 +phiX174:1811 0 0.00 0 +phiX174:1812 0 0.00 0 +phiX174:1813 0 0.00 0 +phiX174:1814 0 0.00 0 +phiX174:1815 0 0.00 0 +phiX174:1816 0 0.00 0 +phiX174:1817 0 0.00 0 +phiX174:1818 0 0.00 0 +phiX174:1819 0 0.00 0 +phiX174:1820 0 0.00 0 +phiX174:1821 0 0.00 0 +phiX174:1822 0 0.00 0 +phiX174:1823 0 0.00 0 +phiX174:1824 0 0.00 0 +phiX174:1825 0 0.00 0 +phiX174:1826 0 0.00 0 +phiX174:1827 0 0.00 0 +phiX174:1828 0 0.00 0 +phiX174:1829 0 0.00 0 +phiX174:1830 0 0.00 0 +phiX174:1831 0 0.00 0 +phiX174:1832 0 0.00 0 +phiX174:1833 0 0.00 0 +phiX174:1834 0 0.00 0 +phiX174:1835 0 0.00 0 +phiX174:1836 0 0.00 0 +phiX174:1837 0 0.00 0 +phiX174:1838 0 0.00 0 +phiX174:1839 0 0.00 0 +phiX174:1840 0 0.00 0 +phiX174:1841 0 0.00 0 +phiX174:1842 0 0.00 0 +phiX174:1843 0 0.00 0 +phiX174:1844 0 0.00 0 +phiX174:1845 0 0.00 0 +phiX174:1846 0 0.00 0 +phiX174:1847 0 0.00 0 +phiX174:1848 0 0.00 0 +phiX174:1849 0 0.00 0 +phiX174:1850 0 0.00 0 +phiX174:1851 0 0.00 0 +phiX174:1852 0 0.00 0 +phiX174:1853 0 0.00 0 +phiX174:1854 0 0.00 0 +phiX174:1855 0 0.00 0 +phiX174:1856 0 0.00 0 +phiX174:1857 0 0.00 0 +phiX174:1858 0 0.00 0 +phiX174:1859 0 0.00 0 +phiX174:1860 0 0.00 0 +phiX174:1861 0 0.00 0 +phiX174:1862 0 0.00 0 +phiX174:1863 0 0.00 0 +phiX174:1864 0 0.00 0 +phiX174:1865 0 0.00 0 +phiX174:1866 0 0.00 0 +phiX174:1867 0 0.00 0 +phiX174:1868 0 0.00 0 +phiX174:1869 0 0.00 0 +phiX174:1870 0 0.00 0 +phiX174:1871 0 0.00 0 +phiX174:1872 0 0.00 0 +phiX174:1873 0 0.00 0 +phiX174:1874 0 0.00 0 +phiX174:1875 0 0.00 0 +phiX174:1876 0 0.00 0 +phiX174:1877 0 0.00 0 +phiX174:1878 0 0.00 0 +phiX174:1879 0 0.00 0 +phiX174:1880 0 0.00 0 +phiX174:1881 0 0.00 0 +phiX174:1882 0 0.00 0 +phiX174:1883 0 0.00 0 +phiX174:1884 0 0.00 0 +phiX174:1885 0 0.00 0 +phiX174:1886 0 0.00 0 +phiX174:1887 0 0.00 0 +phiX174:1888 0 0.00 0 +phiX174:1889 0 0.00 0 +phiX174:1890 0 0.00 0 +phiX174:1891 0 0.00 0 +phiX174:1892 0 0.00 0 +phiX174:1893 0 0.00 0 +phiX174:1894 0 0.00 0 +phiX174:1895 0 0.00 0 +phiX174:1896 0 0.00 0 +phiX174:1897 0 0.00 0 +phiX174:1898 0 0.00 0 +phiX174:1899 0 0.00 0 +phiX174:1900 0 0.00 0 +phiX174:1901 0 0.00 0 +phiX174:1902 0 0.00 0 +phiX174:1903 0 0.00 0 +phiX174:1904 0 0.00 0 +phiX174:1905 0 0.00 0 +phiX174:1906 0 0.00 0 +phiX174:1907 0 0.00 0 +phiX174:1908 0 0.00 0 +phiX174:1909 0 0.00 0 +phiX174:1910 0 0.00 0 +phiX174:1911 0 0.00 0 +phiX174:1912 0 0.00 0 +phiX174:1913 0 0.00 0 +phiX174:1914 0 0.00 0 +phiX174:1915 0 0.00 0 +phiX174:1916 0 0.00 0 +phiX174:1917 0 0.00 0 +phiX174:1918 0 0.00 0 +phiX174:1919 0 0.00 0 +phiX174:1920 0 0.00 0 +phiX174:1921 0 0.00 0 +phiX174:1922 0 0.00 0 +phiX174:1923 0 0.00 0 +phiX174:1924 0 0.00 0 +phiX174:1925 0 0.00 0 +phiX174:1926 0 0.00 0 +phiX174:1927 0 0.00 0 +phiX174:1928 0 0.00 0 +phiX174:1929 0 0.00 0 +phiX174:1930 0 0.00 0 +phiX174:1931 0 0.00 0 +phiX174:1932 0 0.00 0 +phiX174:1933 0 0.00 0 +phiX174:1934 0 0.00 0 +phiX174:1935 0 0.00 0 +phiX174:1936 0 0.00 0 +phiX174:1937 0 0.00 0 +phiX174:1938 0 0.00 0 +phiX174:1939 0 0.00 0 +phiX174:1940 0 0.00 0 +phiX174:1941 0 0.00 0 +phiX174:1942 0 0.00 0 +phiX174:1943 0 0.00 0 +phiX174:1944 0 0.00 0 +phiX174:1945 0 0.00 0 +phiX174:1946 0 0.00 0 +phiX174:1947 0 0.00 0 +phiX174:1948 0 0.00 0 +phiX174:1949 0 0.00 0 +phiX174:1950 0 0.00 0 +phiX174:1951 0 0.00 0 +phiX174:1952 0 0.00 0 +phiX174:1953 0 0.00 0 +phiX174:1954 0 0.00 0 +phiX174:1955 0 0.00 0 +phiX174:1956 0 0.00 0 +phiX174:1957 0 0.00 0 +phiX174:1958 0 0.00 0 +phiX174:1959 0 0.00 0 +phiX174:1960 0 0.00 0 +phiX174:1961 0 0.00 0 +phiX174:1962 0 0.00 0 +phiX174:1963 0 0.00 0 +phiX174:1964 0 0.00 0 +phiX174:1965 0 0.00 0 +phiX174:1966 0 0.00 0 +phiX174:1967 0 0.00 0 +phiX174:1968 0 0.00 0 +phiX174:1969 0 0.00 0 +phiX174:1970 0 0.00 0 +phiX174:1971 0 0.00 0 +phiX174:1972 0 0.00 0 +phiX174:1973 0 0.00 0 +phiX174:1974 0 0.00 0 +phiX174:1975 0 0.00 0 +phiX174:1976 0 0.00 0 +phiX174:1977 0 0.00 0 +phiX174:1978 0 0.00 0 +phiX174:1979 0 0.00 0 +phiX174:1980 0 0.00 0 +phiX174:1981 0 0.00 0 +phiX174:1982 0 0.00 0 +phiX174:1983 0 0.00 0 +phiX174:1984 0 0.00 0 +phiX174:1985 0 0.00 0 +phiX174:1986 0 0.00 0 +phiX174:1987 0 0.00 0 +phiX174:1988 0 0.00 0 +phiX174:1989 0 0.00 0 +phiX174:1990 0 0.00 0 +phiX174:1991 0 0.00 0 +phiX174:1992 0 0.00 0 +phiX174:1993 0 0.00 0 +phiX174:1994 0 0.00 0 +phiX174:1995 0 0.00 0 +phiX174:1996 0 0.00 0 +phiX174:1997 0 0.00 0 +phiX174:1998 0 0.00 0 +phiX174:1999 0 0.00 0 +phiX174:2000 0 0.00 0 +phiX174:2001 0 0.00 0 +phiX174:2002 0 0.00 0 +phiX174:2003 0 0.00 0 +phiX174:2004 0 0.00 0 +phiX174:2005 0 0.00 0 +phiX174:2006 0 0.00 0 +phiX174:2007 0 0.00 0 +phiX174:2008 0 0.00 0 +phiX174:2009 0 0.00 0 +phiX174:2010 0 0.00 0 +phiX174:2011 0 0.00 0 +phiX174:2012 0 0.00 0 +phiX174:2013 0 0.00 0 +phiX174:2014 0 0.00 0 +phiX174:2015 0 0.00 0 +phiX174:2016 0 0.00 0 +phiX174:2017 0 0.00 0 +phiX174:2018 0 0.00 0 +phiX174:2019 0 0.00 0 +phiX174:2020 0 0.00 0 +phiX174:2021 0 0.00 0 +phiX174:2022 0 0.00 0 +phiX174:2023 0 0.00 0 +phiX174:2024 0 0.00 0 +phiX174:2025 0 0.00 0 +phiX174:2026 0 0.00 0 +phiX174:2027 0 0.00 0 +phiX174:2028 0 0.00 0 +phiX174:2029 0 0.00 0 +phiX174:2030 0 0.00 0 +phiX174:2031 0 0.00 0 +phiX174:2032 0 0.00 0 +phiX174:2033 0 0.00 0 +phiX174:2034 0 0.00 0 +phiX174:2035 0 0.00 0 +phiX174:2036 0 0.00 0 +phiX174:2037 0 0.00 0 +phiX174:2038 0 0.00 0 +phiX174:2039 0 0.00 0 +phiX174:2040 0 0.00 0 +phiX174:2041 0 0.00 0 +phiX174:2042 0 0.00 0 +phiX174:2043 0 0.00 0 +phiX174:2044 0 0.00 0 +phiX174:2045 0 0.00 0 +phiX174:2046 0 0.00 0 +phiX174:2047 0 0.00 0 +phiX174:2048 0 0.00 0 +phiX174:2049 0 0.00 0 +phiX174:2050 0 0.00 0 +phiX174:2051 0 0.00 0 +phiX174:2052 0 0.00 0 +phiX174:2053 0 0.00 0 +phiX174:2054 0 0.00 0 +phiX174:2055 0 0.00 0 +phiX174:2056 0 0.00 0 +phiX174:2057 0 0.00 0 +phiX174:2058 0 0.00 0 +phiX174:2059 0 0.00 0 +phiX174:2060 0 0.00 0 +phiX174:2061 0 0.00 0 +phiX174:2062 0 0.00 0 +phiX174:2063 0 0.00 0 +phiX174:2064 0 0.00 0 +phiX174:2065 0 0.00 0 +phiX174:2066 0 0.00 0 +phiX174:2067 0 0.00 0 +phiX174:2068 0 0.00 0 +phiX174:2069 0 0.00 0 +phiX174:2070 0 0.00 0 +phiX174:2071 0 0.00 0 +phiX174:2072 0 0.00 0 +phiX174:2073 0 0.00 0 +phiX174:2074 0 0.00 0 +phiX174:2075 0 0.00 0 +phiX174:2076 0 0.00 0 +phiX174:2077 0 0.00 0 +phiX174:2078 0 0.00 0 +phiX174:2079 0 0.00 0 +phiX174:2080 0 0.00 0 +phiX174:2081 0 0.00 0 +phiX174:2082 0 0.00 0 +phiX174:2083 0 0.00 0 +phiX174:2084 0 0.00 0 +phiX174:2085 0 0.00 0 +phiX174:2086 0 0.00 0 +phiX174:2087 0 0.00 0 +phiX174:2088 0 0.00 0 +phiX174:2089 0 0.00 0 +phiX174:2090 0 0.00 0 +phiX174:2091 0 0.00 0 +phiX174:2092 0 0.00 0 +phiX174:2093 0 0.00 0 +phiX174:2094 0 0.00 0 +phiX174:2095 0 0.00 0 +phiX174:2096 0 0.00 0 +phiX174:2097 0 0.00 0 +phiX174:2098 0 0.00 0 +phiX174:2099 0 0.00 0 +phiX174:2100 0 0.00 0 +phiX174:2101 0 0.00 0 +phiX174:2102 0 0.00 0 +phiX174:2103 0 0.00 0 +phiX174:2104 0 0.00 0 +phiX174:2105 0 0.00 0 +phiX174:2106 0 0.00 0 +phiX174:2107 0 0.00 0 +phiX174:2108 0 0.00 0 +phiX174:2109 0 0.00 0 +phiX174:2110 0 0.00 0 +phiX174:2111 0 0.00 0 +phiX174:2112 0 0.00 0 +phiX174:2113 0 0.00 0 +phiX174:2114 0 0.00 0 +phiX174:2115 0 0.00 0 +phiX174:2116 0 0.00 0 +phiX174:2117 0 0.00 0 +phiX174:2118 0 0.00 0 +phiX174:2119 0 0.00 0 +phiX174:2120 0 0.00 0 +phiX174:2121 0 0.00 0 +phiX174:2122 0 0.00 0 +phiX174:2123 0 0.00 0 +phiX174:2124 0 0.00 0 +phiX174:2125 0 0.00 0 +phiX174:2126 0 0.00 0 +phiX174:2127 0 0.00 0 +phiX174:2128 0 0.00 0 +phiX174:2129 0 0.00 0 +phiX174:2130 0 0.00 0 +phiX174:2131 0 0.00 0 +phiX174:2132 0 0.00 0 +phiX174:2133 0 0.00 0 +phiX174:2134 0 0.00 0 +phiX174:2135 0 0.00 0 +phiX174:2136 0 0.00 0 +phiX174:2137 0 0.00 0 +phiX174:2138 0 0.00 0 +phiX174:2139 0 0.00 0 +phiX174:2140 0 0.00 0 +phiX174:2141 0 0.00 0 +phiX174:2142 0 0.00 0 +phiX174:2143 0 0.00 0 +phiX174:2144 0 0.00 0 +phiX174:2145 0 0.00 0 +phiX174:2146 0 0.00 0 +phiX174:2147 0 0.00 0 +phiX174:2148 0 0.00 0 +phiX174:2149 0 0.00 0 +phiX174:2150 0 0.00 0 +phiX174:2151 0 0.00 0 +phiX174:2152 0 0.00 0 +phiX174:2153 0 0.00 0 +phiX174:2154 0 0.00 0 +phiX174:2155 0 0.00 0 +phiX174:2156 0 0.00 0 +phiX174:2157 0 0.00 0 +phiX174:2158 0 0.00 0 +phiX174:2159 0 0.00 0 +phiX174:2160 0 0.00 0 +phiX174:2161 0 0.00 0 +phiX174:2162 0 0.00 0 +phiX174:2163 0 0.00 0 +phiX174:2164 0 0.00 0 +phiX174:2165 0 0.00 0 +phiX174:2166 0 0.00 0 +phiX174:2167 0 0.00 0 +phiX174:2168 0 0.00 0 +phiX174:2169 0 0.00 0 +phiX174:2170 0 0.00 0 +phiX174:2171 0 0.00 0 +phiX174:2172 0 0.00 0 +phiX174:2173 0 0.00 0 +phiX174:2174 0 0.00 0 +phiX174:2175 0 0.00 0 +phiX174:2176 0 0.00 0 +phiX174:2177 0 0.00 0 +phiX174:2178 0 0.00 0 +phiX174:2179 0 0.00 0 +phiX174:2180 0 0.00 0 +phiX174:2181 0 0.00 0 +phiX174:2182 0 0.00 0 +phiX174:2183 0 0.00 0 +phiX174:2184 0 0.00 0 +phiX174:2185 0 0.00 0 +phiX174:2186 0 0.00 0 +phiX174:2187 0 0.00 0 +phiX174:2188 0 0.00 0 +phiX174:2189 0 0.00 0 +phiX174:2190 0 0.00 0 +phiX174:2191 0 0.00 0 +phiX174:2192 0 0.00 0 +phiX174:2193 0 0.00 0 +phiX174:2194 0 0.00 0 +phiX174:2195 0 0.00 0 +phiX174:2196 0 0.00 0 +phiX174:2197 0 0.00 0 +phiX174:2198 0 0.00 0 +phiX174:2199 0 0.00 0 +phiX174:2200 0 0.00 0 +phiX174:2201 0 0.00 0 +phiX174:2202 0 0.00 0 +phiX174:2203 0 0.00 0 +phiX174:2204 0 0.00 0 +phiX174:2205 0 0.00 0 +phiX174:2206 0 0.00 0 +phiX174:2207 0 0.00 0 +phiX174:2208 0 0.00 0 +phiX174:2209 0 0.00 0 +phiX174:2210 0 0.00 0 +phiX174:2211 0 0.00 0 +phiX174:2212 0 0.00 0 +phiX174:2213 0 0.00 0 +phiX174:2214 0 0.00 0 +phiX174:2215 0 0.00 0 +phiX174:2216 0 0.00 0 +phiX174:2217 0 0.00 0 +phiX174:2218 0 0.00 0 +phiX174:2219 0 0.00 0 +phiX174:2220 0 0.00 0 +phiX174:2221 0 0.00 0 +phiX174:2222 0 0.00 0 +phiX174:2223 0 0.00 0 +phiX174:2224 0 0.00 0 +phiX174:2225 0 0.00 0 +phiX174:2226 0 0.00 0 +phiX174:2227 0 0.00 0 +phiX174:2228 0 0.00 0 +phiX174:2229 0 0.00 0 +phiX174:2230 0 0.00 0 +phiX174:2231 0 0.00 0 +phiX174:2232 0 0.00 0 +phiX174:2233 0 0.00 0 +phiX174:2234 0 0.00 0 +phiX174:2235 0 0.00 0 +phiX174:2236 0 0.00 0 +phiX174:2237 0 0.00 0 +phiX174:2238 0 0.00 0 +phiX174:2239 0 0.00 0 +phiX174:2240 0 0.00 0 +phiX174:2241 0 0.00 0 +phiX174:2242 0 0.00 0 +phiX174:2243 0 0.00 0 +phiX174:2244 0 0.00 0 +phiX174:2245 0 0.00 0 +phiX174:2246 0 0.00 0 +phiX174:2247 0 0.00 0 +phiX174:2248 0 0.00 0 +phiX174:2249 0 0.00 0 +phiX174:2250 0 0.00 0 +phiX174:2251 0 0.00 0 +phiX174:2252 0 0.00 0 +phiX174:2253 0 0.00 0 +phiX174:2254 0 0.00 0 +phiX174:2255 0 0.00 0 +phiX174:2256 0 0.00 0 +phiX174:2257 0 0.00 0 +phiX174:2258 0 0.00 0 +phiX174:2259 0 0.00 0 +phiX174:2260 0 0.00 0 +phiX174:2261 0 0.00 0 +phiX174:2262 0 0.00 0 +phiX174:2263 0 0.00 0 +phiX174:2264 0 0.00 0 +phiX174:2265 0 0.00 0 +phiX174:2266 0 0.00 0 +phiX174:2267 0 0.00 0 +phiX174:2268 0 0.00 0 +phiX174:2269 0 0.00 0 +phiX174:2270 0 0.00 0 +phiX174:2271 0 0.00 0 +phiX174:2272 0 0.00 0 +phiX174:2273 0 0.00 0 +phiX174:2274 0 0.00 0 +phiX174:2275 0 0.00 0 +phiX174:2276 0 0.00 0 +phiX174:2277 0 0.00 0 +phiX174:2278 0 0.00 0 +phiX174:2279 0 0.00 0 +phiX174:2280 0 0.00 0 +phiX174:2281 0 0.00 0 +phiX174:2282 0 0.00 0 +phiX174:2283 0 0.00 0 +phiX174:2284 0 0.00 0 +phiX174:2285 0 0.00 0 +phiX174:2286 0 0.00 0 +phiX174:2287 0 0.00 0 +phiX174:2288 0 0.00 0 +phiX174:2289 0 0.00 0 +phiX174:2290 0 0.00 0 +phiX174:2291 0 0.00 0 +phiX174:2292 0 0.00 0 +phiX174:2293 0 0.00 0 +phiX174:2294 0 0.00 0 +phiX174:2295 0 0.00 0 +phiX174:2296 0 0.00 0 +phiX174:2297 0 0.00 0 +phiX174:2298 0 0.00 0 +phiX174:2299 0 0.00 0 +phiX174:2300 0 0.00 0 +phiX174:2301 0 0.00 0 +phiX174:2302 0 0.00 0 +phiX174:2303 0 0.00 0 +phiX174:2304 0 0.00 0 +phiX174:2305 0 0.00 0 +phiX174:2306 0 0.00 0 +phiX174:2307 0 0.00 0 +phiX174:2308 0 0.00 0 +phiX174:2309 0 0.00 0 +phiX174:2310 0 0.00 0 +phiX174:2311 0 0.00 0 +phiX174:2312 0 0.00 0 +phiX174:2313 0 0.00 0 +phiX174:2314 0 0.00 0 +phiX174:2315 0 0.00 0 +phiX174:2316 0 0.00 0 +phiX174:2317 0 0.00 0 +phiX174:2318 0 0.00 0 +phiX174:2319 0 0.00 0 +phiX174:2320 0 0.00 0 +phiX174:2321 0 0.00 0 +phiX174:2322 0 0.00 0 +phiX174:2323 0 0.00 0 +phiX174:2324 0 0.00 0 +phiX174:2325 0 0.00 0 +phiX174:2326 0 0.00 0 +phiX174:2327 0 0.00 0 +phiX174:2328 0 0.00 0 +phiX174:2329 0 0.00 0 +phiX174:2330 0 0.00 0 +phiX174:2331 0 0.00 0 +phiX174:2332 0 0.00 0 +phiX174:2333 0 0.00 0 +phiX174:2334 0 0.00 0 +phiX174:2335 0 0.00 0 +phiX174:2336 0 0.00 0 +phiX174:2337 0 0.00 0 +phiX174:2338 0 0.00 0 +phiX174:2339 0 0.00 0 +phiX174:2340 0 0.00 0 +phiX174:2341 0 0.00 0 +phiX174:2342 0 0.00 0 +phiX174:2343 0 0.00 0 +phiX174:2344 0 0.00 0 +phiX174:2345 0 0.00 0 +phiX174:2346 0 0.00 0 +phiX174:2347 0 0.00 0 +phiX174:2348 0 0.00 0 +phiX174:2349 0 0.00 0 +phiX174:2350 0 0.00 0 +phiX174:2351 0 0.00 0 +phiX174:2352 0 0.00 0 +phiX174:2353 0 0.00 0 +phiX174:2354 0 0.00 0 +phiX174:2355 0 0.00 0 +phiX174:2356 0 0.00 0 +phiX174:2357 0 0.00 0 +phiX174:2358 0 0.00 0 +phiX174:2359 0 0.00 0 +phiX174:2360 0 0.00 0 +phiX174:2361 0 0.00 0 +phiX174:2362 0 0.00 0 +phiX174:2363 0 0.00 0 +phiX174:2364 0 0.00 0 +phiX174:2365 0 0.00 0 +phiX174:2366 0 0.00 0 +phiX174:2367 0 0.00 0 +phiX174:2368 0 0.00 0 +phiX174:2369 0 0.00 0 +phiX174:2370 0 0.00 0 +phiX174:2371 0 0.00 0 +phiX174:2372 0 0.00 0 +phiX174:2373 0 0.00 0 +phiX174:2374 0 0.00 0 +phiX174:2375 0 0.00 0 +phiX174:2376 0 0.00 0 +phiX174:2377 0 0.00 0 +phiX174:2378 0 0.00 0 +phiX174:2379 0 0.00 0 +phiX174:2380 0 0.00 0 +phiX174:2381 0 0.00 0 +phiX174:2382 0 0.00 0 +phiX174:2383 0 0.00 0 +phiX174:2384 0 0.00 0 +phiX174:2385 0 0.00 0 +phiX174:2386 0 0.00 0 +phiX174:2387 0 0.00 0 +phiX174:2388 0 0.00 0 +phiX174:2389 0 0.00 0 +phiX174:2390 0 0.00 0 +phiX174:2391 0 0.00 0 +phiX174:2392 0 0.00 0 +phiX174:2393 0 0.00 0 +phiX174:2394 0 0.00 0 +phiX174:2395 0 0.00 0 +phiX174:2396 0 0.00 0 +phiX174:2397 0 0.00 0 +phiX174:2398 0 0.00 0 +phiX174:2399 0 0.00 0 +phiX174:2400 0 0.00 0 +phiX174:2401 0 0.00 0 +phiX174:2402 0 0.00 0 +phiX174:2403 0 0.00 0 +phiX174:2404 0 0.00 0 +phiX174:2405 0 0.00 0 +phiX174:2406 0 0.00 0 +phiX174:2407 0 0.00 0 +phiX174:2408 0 0.00 0 +phiX174:2409 0 0.00 0 +phiX174:2410 0 0.00 0 +phiX174:2411 0 0.00 0 +phiX174:2412 0 0.00 0 +phiX174:2413 0 0.00 0 +phiX174:2414 0 0.00 0 +phiX174:2415 0 0.00 0 +phiX174:2416 0 0.00 0 +phiX174:2417 0 0.00 0 +phiX174:2418 0 0.00 0 +phiX174:2419 0 0.00 0 +phiX174:2420 0 0.00 0 +phiX174:2421 0 0.00 0 +phiX174:2422 0 0.00 0 +phiX174:2423 0 0.00 0 +phiX174:2424 0 0.00 0 +phiX174:2425 0 0.00 0 +phiX174:2426 0 0.00 0 +phiX174:2427 0 0.00 0 +phiX174:2428 0 0.00 0 +phiX174:2429 0 0.00 0 +phiX174:2430 0 0.00 0 +phiX174:2431 0 0.00 0 +phiX174:2432 0 0.00 0 +phiX174:2433 0 0.00 0 +phiX174:2434 0 0.00 0 +phiX174:2435 0 0.00 0 +phiX174:2436 0 0.00 0 +phiX174:2437 0 0.00 0 +phiX174:2438 0 0.00 0 +phiX174:2439 0 0.00 0 +phiX174:2440 0 0.00 0 +phiX174:2441 0 0.00 0 +phiX174:2442 0 0.00 0 +phiX174:2443 0 0.00 0 +phiX174:2444 0 0.00 0 +phiX174:2445 0 0.00 0 +phiX174:2446 0 0.00 0 +phiX174:2447 0 0.00 0 +phiX174:2448 0 0.00 0 +phiX174:2449 0 0.00 0 +phiX174:2450 0 0.00 0 +phiX174:2451 0 0.00 0 +phiX174:2452 0 0.00 0 +phiX174:2453 0 0.00 0 +phiX174:2454 0 0.00 0 +phiX174:2455 0 0.00 0 +phiX174:2456 0 0.00 0 +phiX174:2457 0 0.00 0 +phiX174:2458 0 0.00 0 +phiX174:2459 0 0.00 0 +phiX174:2460 0 0.00 0 +phiX174:2461 0 0.00 0 +phiX174:2462 0 0.00 0 +phiX174:2463 0 0.00 0 +phiX174:2464 0 0.00 0 +phiX174:2465 0 0.00 0 +phiX174:2466 0 0.00 0 +phiX174:2467 0 0.00 0 +phiX174:2468 0 0.00 0 +phiX174:2469 0 0.00 0 +phiX174:2470 0 0.00 0 +phiX174:2471 0 0.00 0 +phiX174:2472 0 0.00 0 +phiX174:2473 0 0.00 0 +phiX174:2474 0 0.00 0 +phiX174:2475 0 0.00 0 +phiX174:2476 0 0.00 0 +phiX174:2477 0 0.00 0 +phiX174:2478 0 0.00 0 +phiX174:2479 0 0.00 0 +phiX174:2480 0 0.00 0 +phiX174:2481 0 0.00 0 +phiX174:2482 0 0.00 0 +phiX174:2483 0 0.00 0 +phiX174:2484 0 0.00 0 +phiX174:2485 0 0.00 0 +phiX174:2486 0 0.00 0 +phiX174:2487 0 0.00 0 +phiX174:2488 0 0.00 0 +phiX174:2489 0 0.00 0 +phiX174:2490 0 0.00 0 +phiX174:2491 0 0.00 0 +phiX174:2492 0 0.00 0 +phiX174:2493 0 0.00 0 +phiX174:2494 0 0.00 0 +phiX174:2495 0 0.00 0 +phiX174:2496 0 0.00 0 +phiX174:2497 0 0.00 0 +phiX174:2498 0 0.00 0 +phiX174:2499 0 0.00 0 +phiX174:2500 0 0.00 0 +phiX174:2501 0 0.00 0 +phiX174:2502 0 0.00 0 +phiX174:2503 0 0.00 0 +phiX174:2504 0 0.00 0 +phiX174:2505 0 0.00 0 +phiX174:2506 0 0.00 0 +phiX174:2507 0 0.00 0 +phiX174:2508 0 0.00 0 +phiX174:2509 0 0.00 0 +phiX174:2510 0 0.00 0 +phiX174:2511 0 0.00 0 +phiX174:2512 0 0.00 0 +phiX174:2513 0 0.00 0 +phiX174:2514 0 0.00 0 +phiX174:2515 0 0.00 0 +phiX174:2516 0 0.00 0 +phiX174:2517 0 0.00 0 +phiX174:2518 0 0.00 0 +phiX174:2519 0 0.00 0 +phiX174:2520 0 0.00 0 +phiX174:2521 0 0.00 0 +phiX174:2522 0 0.00 0 +phiX174:2523 0 0.00 0 +phiX174:2524 0 0.00 0 +phiX174:2525 0 0.00 0 +phiX174:2526 0 0.00 0 +phiX174:2527 0 0.00 0 +phiX174:2528 0 0.00 0 +phiX174:2529 0 0.00 0 +phiX174:2530 0 0.00 0 +phiX174:2531 0 0.00 0 +phiX174:2532 0 0.00 0 +phiX174:2533 0 0.00 0 +phiX174:2534 0 0.00 0 +phiX174:2535 0 0.00 0 +phiX174:2536 0 0.00 0 +phiX174:2537 0 0.00 0 +phiX174:2538 0 0.00 0 +phiX174:2539 0 0.00 0 +phiX174:2540 0 0.00 0 +phiX174:2541 0 0.00 0 +phiX174:2542 0 0.00 0 +phiX174:2543 0 0.00 0 +phiX174:2544 0 0.00 0 +phiX174:2545 0 0.00 0 +phiX174:2546 0 0.00 0 +phiX174:2547 0 0.00 0 +phiX174:2548 0 0.00 0 +phiX174:2549 0 0.00 0 +phiX174:2550 0 0.00 0 +phiX174:2551 0 0.00 0 +phiX174:2552 0 0.00 0 +phiX174:2553 0 0.00 0 +phiX174:2554 0 0.00 0 +phiX174:2555 0 0.00 0 +phiX174:2556 0 0.00 0 +phiX174:2557 0 0.00 0 +phiX174:2558 0 0.00 0 +phiX174:2559 0 0.00 0 +phiX174:2560 0 0.00 0 +phiX174:2561 0 0.00 0 +phiX174:2562 0 0.00 0 +phiX174:2563 0 0.00 0 +phiX174:2564 0 0.00 0 +phiX174:2565 0 0.00 0 +phiX174:2566 0 0.00 0 +phiX174:2567 0 0.00 0 +phiX174:2568 0 0.00 0 +phiX174:2569 0 0.00 0 +phiX174:2570 0 0.00 0 +phiX174:2571 0 0.00 0 +phiX174:2572 0 0.00 0 +phiX174:2573 0 0.00 0 +phiX174:2574 0 0.00 0 +phiX174:2575 0 0.00 0 +phiX174:2576 0 0.00 0 +phiX174:2577 0 0.00 0 +phiX174:2578 0 0.00 0 +phiX174:2579 0 0.00 0 +phiX174:2580 0 0.00 0 +phiX174:2581 0 0.00 0 +phiX174:2582 0 0.00 0 +phiX174:2583 0 0.00 0 +phiX174:2584 0 0.00 0 +phiX174:2585 0 0.00 0 +phiX174:2586 0 0.00 0 +phiX174:2587 0 0.00 0 +phiX174:2588 0 0.00 0 +phiX174:2589 0 0.00 0 +phiX174:2590 0 0.00 0 +phiX174:2591 0 0.00 0 +phiX174:2592 0 0.00 0 +phiX174:2593 0 0.00 0 +phiX174:2594 0 0.00 0 +phiX174:2595 0 0.00 0 +phiX174:2596 0 0.00 0 +phiX174:2597 0 0.00 0 +phiX174:2598 0 0.00 0 +phiX174:2599 0 0.00 0 +phiX174:2600 0 0.00 0 +phiX174:2601 0 0.00 0 +phiX174:2602 0 0.00 0 +phiX174:2603 0 0.00 0 +phiX174:2604 0 0.00 0 +phiX174:2605 0 0.00 0 +phiX174:2606 0 0.00 0 +phiX174:2607 0 0.00 0 +phiX174:2608 0 0.00 0 +phiX174:2609 0 0.00 0 +phiX174:2610 0 0.00 0 +phiX174:2611 0 0.00 0 +phiX174:2612 0 0.00 0 +phiX174:2613 0 0.00 0 +phiX174:2614 0 0.00 0 +phiX174:2615 0 0.00 0 +phiX174:2616 0 0.00 0 +phiX174:2617 0 0.00 0 +phiX174:2618 0 0.00 0 +phiX174:2619 0 0.00 0 +phiX174:2620 0 0.00 0 +phiX174:2621 0 0.00 0 +phiX174:2622 0 0.00 0 +phiX174:2623 0 0.00 0 +phiX174:2624 0 0.00 0 +phiX174:2625 0 0.00 0 +phiX174:2626 0 0.00 0 +phiX174:2627 0 0.00 0 +phiX174:2628 0 0.00 0 +phiX174:2629 0 0.00 0 +phiX174:2630 0 0.00 0 +phiX174:2631 0 0.00 0 +phiX174:2632 0 0.00 0 +phiX174:2633 0 0.00 0 +phiX174:2634 0 0.00 0 +phiX174:2635 0 0.00 0 +phiX174:2636 0 0.00 0 +phiX174:2637 0 0.00 0 +phiX174:2638 0 0.00 0 +phiX174:2639 0 0.00 0 +phiX174:2640 0 0.00 0 +phiX174:2641 0 0.00 0 +phiX174:2642 0 0.00 0 +phiX174:2643 0 0.00 0 +phiX174:2644 0 0.00 0 +phiX174:2645 0 0.00 0 +phiX174:2646 0 0.00 0 +phiX174:2647 0 0.00 0 +phiX174:2648 0 0.00 0 +phiX174:2649 0 0.00 0 +phiX174:2650 0 0.00 0 +phiX174:2651 0 0.00 0 +phiX174:2652 0 0.00 0 +phiX174:2653 0 0.00 0 +phiX174:2654 0 0.00 0 +phiX174:2655 0 0.00 0 +phiX174:2656 0 0.00 0 +phiX174:2657 0 0.00 0 +phiX174:2658 0 0.00 0 +phiX174:2659 0 0.00 0 +phiX174:2660 0 0.00 0 +phiX174:2661 0 0.00 0 +phiX174:2662 0 0.00 0 +phiX174:2663 0 0.00 0 +phiX174:2664 0 0.00 0 +phiX174:2665 0 0.00 0 +phiX174:2666 0 0.00 0 +phiX174:2667 0 0.00 0 +phiX174:2668 0 0.00 0 +phiX174:2669 0 0.00 0 +phiX174:2670 0 0.00 0 +phiX174:2671 0 0.00 0 +phiX174:2672 0 0.00 0 +phiX174:2673 0 0.00 0 +phiX174:2674 0 0.00 0 +phiX174:2675 0 0.00 0 +phiX174:2676 0 0.00 0 +phiX174:2677 0 0.00 0 +phiX174:2678 0 0.00 0 +phiX174:2679 0 0.00 0 +phiX174:2680 0 0.00 0 +phiX174:2681 0 0.00 0 +phiX174:2682 0 0.00 0 +phiX174:2683 0 0.00 0 +phiX174:2684 0 0.00 0 +phiX174:2685 0 0.00 0 +phiX174:2686 0 0.00 0 +phiX174:2687 0 0.00 0 +phiX174:2688 0 0.00 0 +phiX174:2689 0 0.00 0 +phiX174:2690 0 0.00 0 +phiX174:2691 0 0.00 0 +phiX174:2692 0 0.00 0 +phiX174:2693 0 0.00 0 +phiX174:2694 0 0.00 0 +phiX174:2695 0 0.00 0 +phiX174:2696 0 0.00 0 +phiX174:2697 0 0.00 0 +phiX174:2698 0 0.00 0 +phiX174:2699 0 0.00 0 +phiX174:2700 0 0.00 0 +phiX174:2701 0 0.00 0 +phiX174:2702 0 0.00 0 +phiX174:2703 0 0.00 0 +phiX174:2704 0 0.00 0 +phiX174:2705 0 0.00 0 +phiX174:2706 0 0.00 0 +phiX174:2707 0 0.00 0 +phiX174:2708 0 0.00 0 +phiX174:2709 0 0.00 0 +phiX174:2710 0 0.00 0 +phiX174:2711 0 0.00 0 +phiX174:2712 0 0.00 0 +phiX174:2713 0 0.00 0 +phiX174:2714 0 0.00 0 +phiX174:2715 0 0.00 0 +phiX174:2716 0 0.00 0 +phiX174:2717 0 0.00 0 +phiX174:2718 0 0.00 0 +phiX174:2719 0 0.00 0 +phiX174:2720 0 0.00 0 +phiX174:2721 0 0.00 0 +phiX174:2722 0 0.00 0 +phiX174:2723 0 0.00 0 +phiX174:2724 0 0.00 0 +phiX174:2725 0 0.00 0 +phiX174:2726 0 0.00 0 +phiX174:2727 0 0.00 0 +phiX174:2728 0 0.00 0 +phiX174:2729 0 0.00 0 +phiX174:2730 0 0.00 0 +phiX174:2731 0 0.00 0 +phiX174:2732 0 0.00 0 +phiX174:2733 0 0.00 0 +phiX174:2734 0 0.00 0 +phiX174:2735 0 0.00 0 +phiX174:2736 0 0.00 0 +phiX174:2737 0 0.00 0 +phiX174:2738 0 0.00 0 +phiX174:2739 0 0.00 0 +phiX174:2740 0 0.00 0 +phiX174:2741 0 0.00 0 +phiX174:2742 0 0.00 0 +phiX174:2743 0 0.00 0 +phiX174:2744 0 0.00 0 +phiX174:2745 0 0.00 0 +phiX174:2746 0 0.00 0 +phiX174:2747 0 0.00 0 +phiX174:2748 0 0.00 0 +phiX174:2749 0 0.00 0 +phiX174:2750 0 0.00 0 +phiX174:2751 0 0.00 0 +phiX174:2752 0 0.00 0 +phiX174:2753 0 0.00 0 +phiX174:2754 0 0.00 0 +phiX174:2755 0 0.00 0 +phiX174:2756 0 0.00 0 +phiX174:2757 0 0.00 0 +phiX174:2758 0 0.00 0 +phiX174:2759 0 0.00 0 +phiX174:2760 0 0.00 0 +phiX174:2761 0 0.00 0 +phiX174:2762 0 0.00 0 +phiX174:2763 0 0.00 0 +phiX174:2764 0 0.00 0 +phiX174:2765 0 0.00 0 +phiX174:2766 0 0.00 0 +phiX174:2767 0 0.00 0 +phiX174:2768 0 0.00 0 +phiX174:2769 0 0.00 0 +phiX174:2770 0 0.00 0 +phiX174:2771 0 0.00 0 +phiX174:2772 0 0.00 0 +phiX174:2773 0 0.00 0 +phiX174:2774 0 0.00 0 +phiX174:2775 0 0.00 0 +phiX174:2776 0 0.00 0 +phiX174:2777 0 0.00 0 +phiX174:2778 0 0.00 0 +phiX174:2779 0 0.00 0 +phiX174:2780 0 0.00 0 +phiX174:2781 0 0.00 0 +phiX174:2782 0 0.00 0 +phiX174:2783 0 0.00 0 +phiX174:2784 0 0.00 0 +phiX174:2785 0 0.00 0 +phiX174:2786 0 0.00 0 +phiX174:2787 0 0.00 0 +phiX174:2788 0 0.00 0 +phiX174:2789 0 0.00 0 +phiX174:2790 0 0.00 0 +phiX174:2791 0 0.00 0 +phiX174:2792 0 0.00 0 +phiX174:2793 0 0.00 0 +phiX174:2794 0 0.00 0 +phiX174:2795 0 0.00 0 +phiX174:2796 0 0.00 0 +phiX174:2797 0 0.00 0 +phiX174:2798 0 0.00 0 +phiX174:2799 0 0.00 0 +phiX174:2800 0 0.00 0 +phiX174:2801 0 0.00 0 +phiX174:2802 0 0.00 0 +phiX174:2803 0 0.00 0 +phiX174:2804 0 0.00 0 +phiX174:2805 0 0.00 0 +phiX174:2806 0 0.00 0 +phiX174:2807 0 0.00 0 +phiX174:2808 0 0.00 0 +phiX174:2809 0 0.00 0 +phiX174:2810 0 0.00 0 +phiX174:2811 0 0.00 0 +phiX174:2812 0 0.00 0 +phiX174:2813 0 0.00 0 +phiX174:2814 0 0.00 0 +phiX174:2815 0 0.00 0 +phiX174:2816 0 0.00 0 +phiX174:2817 0 0.00 0 +phiX174:2818 0 0.00 0 +phiX174:2819 0 0.00 0 +phiX174:2820 0 0.00 0 +phiX174:2821 0 0.00 0 +phiX174:2822 0 0.00 0 +phiX174:2823 0 0.00 0 +phiX174:2824 0 0.00 0 +phiX174:2825 0 0.00 0 +phiX174:2826 0 0.00 0 +phiX174:2827 0 0.00 0 +phiX174:2828 0 0.00 0 +phiX174:2829 0 0.00 0 +phiX174:2830 0 0.00 0 +phiX174:2831 0 0.00 0 +phiX174:2832 0 0.00 0 +phiX174:2833 0 0.00 0 +phiX174:2834 0 0.00 0 +phiX174:2835 0 0.00 0 +phiX174:2836 0 0.00 0 +phiX174:2837 0 0.00 0 +phiX174:2838 0 0.00 0 +phiX174:2839 0 0.00 0 +phiX174:2840 0 0.00 0 +phiX174:2841 0 0.00 0 +phiX174:2842 0 0.00 0 +phiX174:2843 0 0.00 0 +phiX174:2844 0 0.00 0 +phiX174:2845 0 0.00 0 +phiX174:2846 0 0.00 0 +phiX174:2847 0 0.00 0 +phiX174:2848 0 0.00 0 +phiX174:2849 0 0.00 0 +phiX174:2850 0 0.00 0 +phiX174:2851 0 0.00 0 +phiX174:2852 0 0.00 0 +phiX174:2853 0 0.00 0 +phiX174:2854 0 0.00 0 +phiX174:2855 0 0.00 0 +phiX174:2856 0 0.00 0 +phiX174:2857 0 0.00 0 +phiX174:2858 0 0.00 0 +phiX174:2859 0 0.00 0 +phiX174:2860 0 0.00 0 +phiX174:2861 0 0.00 0 +phiX174:2862 0 0.00 0 +phiX174:2863 0 0.00 0 +phiX174:2864 0 0.00 0 +phiX174:2865 0 0.00 0 +phiX174:2866 0 0.00 0 +phiX174:2867 0 0.00 0 +phiX174:2868 0 0.00 0 +phiX174:2869 0 0.00 0 +phiX174:2870 0 0.00 0 +phiX174:2871 0 0.00 0 +phiX174:2872 0 0.00 0 +phiX174:2873 0 0.00 0 +phiX174:2874 0 0.00 0 +phiX174:2875 0 0.00 0 +phiX174:2876 0 0.00 0 +phiX174:2877 0 0.00 0 +phiX174:2878 0 0.00 0 +phiX174:2879 0 0.00 0 +phiX174:2880 0 0.00 0 +phiX174:2881 0 0.00 0 +phiX174:2882 0 0.00 0 +phiX174:2883 0 0.00 0 +phiX174:2884 0 0.00 0 +phiX174:2885 0 0.00 0 +phiX174:2886 0 0.00 0 +phiX174:2887 0 0.00 0 +phiX174:2888 0 0.00 0 +phiX174:2889 0 0.00 0 +phiX174:2890 0 0.00 0 +phiX174:2891 0 0.00 0 +phiX174:2892 0 0.00 0 +phiX174:2893 0 0.00 0 +phiX174:2894 0 0.00 0 +phiX174:2895 0 0.00 0 +phiX174:2896 0 0.00 0 +phiX174:2897 0 0.00 0 +phiX174:2898 0 0.00 0 +phiX174:2899 0 0.00 0 +phiX174:2900 0 0.00 0 +phiX174:2901 0 0.00 0 +phiX174:2902 0 0.00 0 +phiX174:2903 0 0.00 0 +phiX174:2904 0 0.00 0 +phiX174:2905 0 0.00 0 +phiX174:2906 0 0.00 0 +phiX174:2907 0 0.00 0 +phiX174:2908 0 0.00 0 +phiX174:2909 0 0.00 0 +phiX174:2910 0 0.00 0 +phiX174:2911 0 0.00 0 +phiX174:2912 0 0.00 0 +phiX174:2913 0 0.00 0 +phiX174:2914 0 0.00 0 +phiX174:2915 0 0.00 0 +phiX174:2916 0 0.00 0 +phiX174:2917 0 0.00 0 +phiX174:2918 0 0.00 0 +phiX174:2919 0 0.00 0 +phiX174:2920 0 0.00 0 +phiX174:2921 0 0.00 0 +phiX174:2922 0 0.00 0 +phiX174:2923 0 0.00 0 +phiX174:2924 0 0.00 0 +phiX174:2925 0 0.00 0 +phiX174:2926 0 0.00 0 +phiX174:2927 0 0.00 0 +phiX174:2928 0 0.00 0 +phiX174:2929 0 0.00 0 +phiX174:2930 0 0.00 0 +phiX174:2931 0 0.00 0 +phiX174:2932 0 0.00 0 +phiX174:2933 0 0.00 0 +phiX174:2934 0 0.00 0 +phiX174:2935 0 0.00 0 +phiX174:2936 0 0.00 0 +phiX174:2937 0 0.00 0 +phiX174:2938 0 0.00 0 +phiX174:2939 0 0.00 0 +phiX174:2940 0 0.00 0 +phiX174:2941 0 0.00 0 +phiX174:2942 0 0.00 0 +phiX174:2943 0 0.00 0 +phiX174:2944 0 0.00 0 +phiX174:2945 0 0.00 0 +phiX174:2946 0 0.00 0 +phiX174:2947 0 0.00 0 +phiX174:2948 0 0.00 0 +phiX174:2949 0 0.00 0 +phiX174:2950 0 0.00 0 +phiX174:2951 0 0.00 0 +phiX174:2952 0 0.00 0 +phiX174:2953 0 0.00 0 +phiX174:2954 0 0.00 0 +phiX174:2955 0 0.00 0 +phiX174:2956 0 0.00 0 +phiX174:2957 0 0.00 0 +phiX174:2958 0 0.00 0 +phiX174:2959 0 0.00 0 +phiX174:2960 0 0.00 0 +phiX174:2961 0 0.00 0 +phiX174:2962 0 0.00 0 +phiX174:2963 0 0.00 0 +phiX174:2964 0 0.00 0 +phiX174:2965 0 0.00 0 +phiX174:2966 0 0.00 0 +phiX174:2967 0 0.00 0 +phiX174:2968 0 0.00 0 +phiX174:2969 0 0.00 0 +phiX174:2970 0 0.00 0 +phiX174:2971 0 0.00 0 +phiX174:2972 0 0.00 0 +phiX174:2973 0 0.00 0 +phiX174:2974 0 0.00 0 +phiX174:2975 0 0.00 0 +phiX174:2976 0 0.00 0 +phiX174:2977 0 0.00 0 +phiX174:2978 0 0.00 0 +phiX174:2979 0 0.00 0 +phiX174:2980 0 0.00 0 +phiX174:2981 0 0.00 0 +phiX174:2982 0 0.00 0 +phiX174:2983 0 0.00 0 +phiX174:2984 0 0.00 0 +phiX174:2985 0 0.00 0 +phiX174:2986 0 0.00 0 +phiX174:2987 0 0.00 0 +phiX174:2988 0 0.00 0 +phiX174:2989 0 0.00 0 +phiX174:2990 0 0.00 0 +phiX174:2991 0 0.00 0 +phiX174:2992 0 0.00 0 +phiX174:2993 0 0.00 0 +phiX174:2994 0 0.00 0 +phiX174:2995 0 0.00 0 +phiX174:2996 0 0.00 0 +phiX174:2997 0 0.00 0 +phiX174:2998 0 0.00 0 +phiX174:2999 0 0.00 0 +phiX174:3000 0 0.00 0 +phiX174:3001 0 0.00 0 +phiX174:3002 0 0.00 0 +phiX174:3003 0 0.00 0 +phiX174:3004 0 0.00 0 +phiX174:3005 0 0.00 0 +phiX174:3006 0 0.00 0 +phiX174:3007 0 0.00 0 +phiX174:3008 0 0.00 0 +phiX174:3009 0 0.00 0 +phiX174:3010 0 0.00 0 +phiX174:3011 0 0.00 0 +phiX174:3012 0 0.00 0 +phiX174:3013 0 0.00 0 +phiX174:3014 0 0.00 0 +phiX174:3015 0 0.00 0 +phiX174:3016 0 0.00 0 +phiX174:3017 0 0.00 0 +phiX174:3018 0 0.00 0 +phiX174:3019 0 0.00 0 +phiX174:3020 0 0.00 0 +phiX174:3021 0 0.00 0 +phiX174:3022 0 0.00 0 +phiX174:3023 0 0.00 0 +phiX174:3024 0 0.00 0 +phiX174:3025 0 0.00 0 +phiX174:3026 0 0.00 0 +phiX174:3027 0 0.00 0 +phiX174:3028 0 0.00 0 +phiX174:3029 0 0.00 0 +phiX174:3030 0 0.00 0 +phiX174:3031 0 0.00 0 +phiX174:3032 0 0.00 0 +phiX174:3033 0 0.00 0 +phiX174:3034 0 0.00 0 +phiX174:3035 0 0.00 0 +phiX174:3036 0 0.00 0 +phiX174:3037 0 0.00 0 +phiX174:3038 0 0.00 0 +phiX174:3039 0 0.00 0 +phiX174:3040 0 0.00 0 +phiX174:3041 0 0.00 0 +phiX174:3042 0 0.00 0 +phiX174:3043 0 0.00 0 +phiX174:3044 0 0.00 0 +phiX174:3045 0 0.00 0 +phiX174:3046 0 0.00 0 +phiX174:3047 0 0.00 0 +phiX174:3048 0 0.00 0 +phiX174:3049 0 0.00 0 +phiX174:3050 0 0.00 0 +phiX174:3051 0 0.00 0 +phiX174:3052 0 0.00 0 +phiX174:3053 0 0.00 0 +phiX174:3054 0 0.00 0 +phiX174:3055 0 0.00 0 +phiX174:3056 0 0.00 0 +phiX174:3057 0 0.00 0 +phiX174:3058 0 0.00 0 +phiX174:3059 0 0.00 0 +phiX174:3060 0 0.00 0 +phiX174:3061 0 0.00 0 +phiX174:3062 0 0.00 0 +phiX174:3063 0 0.00 0 +phiX174:3064 0 0.00 0 +phiX174:3065 0 0.00 0 +phiX174:3066 0 0.00 0 +phiX174:3067 0 0.00 0 +phiX174:3068 0 0.00 0 +phiX174:3069 0 0.00 0 +phiX174:3070 0 0.00 0 +phiX174:3071 0 0.00 0 +phiX174:3072 0 0.00 0 +phiX174:3073 0 0.00 0 +phiX174:3074 0 0.00 0 +phiX174:3075 0 0.00 0 +phiX174:3076 0 0.00 0 +phiX174:3077 0 0.00 0 +phiX174:3078 0 0.00 0 +phiX174:3079 0 0.00 0 +phiX174:3080 0 0.00 0 +phiX174:3081 0 0.00 0 +phiX174:3082 0 0.00 0 +phiX174:3083 0 0.00 0 +phiX174:3084 0 0.00 0 +phiX174:3085 0 0.00 0 +phiX174:3086 0 0.00 0 +phiX174:3087 0 0.00 0 +phiX174:3088 0 0.00 0 +phiX174:3089 0 0.00 0 +phiX174:3090 0 0.00 0 +phiX174:3091 0 0.00 0 +phiX174:3092 0 0.00 0 +phiX174:3093 0 0.00 0 +phiX174:3094 0 0.00 0 +phiX174:3095 0 0.00 0 +phiX174:3096 0 0.00 0 +phiX174:3097 0 0.00 0 +phiX174:3098 0 0.00 0 +phiX174:3099 0 0.00 0 +phiX174:3100 0 0.00 0 +phiX174:3101 0 0.00 0 +phiX174:3102 0 0.00 0 +phiX174:3103 0 0.00 0 +phiX174:3104 0 0.00 0 +phiX174:3105 0 0.00 0 +phiX174:3106 0 0.00 0 +phiX174:3107 0 0.00 0 +phiX174:3108 0 0.00 0 +phiX174:3109 0 0.00 0 +phiX174:3110 0 0.00 0 +phiX174:3111 0 0.00 0 +phiX174:3112 0 0.00 0 +phiX174:3113 0 0.00 0 +phiX174:3114 0 0.00 0 +phiX174:3115 0 0.00 0 +phiX174:3116 0 0.00 0 +phiX174:3117 0 0.00 0 +phiX174:3118 0 0.00 0 +phiX174:3119 0 0.00 0 +phiX174:3120 0 0.00 0 +phiX174:3121 0 0.00 0 +phiX174:3122 0 0.00 0 +phiX174:3123 0 0.00 0 +phiX174:3124 0 0.00 0 +phiX174:3125 0 0.00 0 +phiX174:3126 0 0.00 0 +phiX174:3127 0 0.00 0 +phiX174:3128 0 0.00 0 +phiX174:3129 0 0.00 0 +phiX174:3130 0 0.00 0 +phiX174:3131 0 0.00 0 +phiX174:3132 0 0.00 0 +phiX174:3133 0 0.00 0 +phiX174:3134 0 0.00 0 +phiX174:3135 0 0.00 0 +phiX174:3136 0 0.00 0 +phiX174:3137 0 0.00 0 +phiX174:3138 0 0.00 0 +phiX174:3139 0 0.00 0 +phiX174:3140 0 0.00 0 +phiX174:3141 0 0.00 0 +phiX174:3142 0 0.00 0 +phiX174:3143 0 0.00 0 +phiX174:3144 0 0.00 0 +phiX174:3145 0 0.00 0 +phiX174:3146 0 0.00 0 +phiX174:3147 0 0.00 0 +phiX174:3148 0 0.00 0 +phiX174:3149 0 0.00 0 +phiX174:3150 0 0.00 0 +phiX174:3151 0 0.00 0 +phiX174:3152 0 0.00 0 +phiX174:3153 0 0.00 0 +phiX174:3154 0 0.00 0 +phiX174:3155 0 0.00 0 +phiX174:3156 0 0.00 0 +phiX174:3157 0 0.00 0 +phiX174:3158 0 0.00 0 +phiX174:3159 0 0.00 0 +phiX174:3160 0 0.00 0 +phiX174:3161 0 0.00 0 +phiX174:3162 0 0.00 0 +phiX174:3163 0 0.00 0 +phiX174:3164 0 0.00 0 +phiX174:3165 0 0.00 0 +phiX174:3166 0 0.00 0 +phiX174:3167 0 0.00 0 +phiX174:3168 0 0.00 0 +phiX174:3169 0 0.00 0 +phiX174:3170 0 0.00 0 +phiX174:3171 0 0.00 0 +phiX174:3172 0 0.00 0 +phiX174:3173 0 0.00 0 +phiX174:3174 0 0.00 0 +phiX174:3175 0 0.00 0 +phiX174:3176 0 0.00 0 +phiX174:3177 0 0.00 0 +phiX174:3178 0 0.00 0 +phiX174:3179 0 0.00 0 +phiX174:3180 0 0.00 0 +phiX174:3181 0 0.00 0 +phiX174:3182 0 0.00 0 +phiX174:3183 0 0.00 0 +phiX174:3184 0 0.00 0 +phiX174:3185 0 0.00 0 +phiX174:3186 0 0.00 0 +phiX174:3187 0 0.00 0 +phiX174:3188 0 0.00 0 +phiX174:3189 0 0.00 0 +phiX174:3190 0 0.00 0 +phiX174:3191 0 0.00 0 +phiX174:3192 0 0.00 0 +phiX174:3193 0 0.00 0 +phiX174:3194 0 0.00 0 +phiX174:3195 0 0.00 0 +phiX174:3196 0 0.00 0 +phiX174:3197 0 0.00 0 +phiX174:3198 0 0.00 0 +phiX174:3199 0 0.00 0 +phiX174:3200 0 0.00 0 +phiX174:3201 0 0.00 0 +phiX174:3202 0 0.00 0 +phiX174:3203 0 0.00 0 +phiX174:3204 0 0.00 0 +phiX174:3205 0 0.00 0 +phiX174:3206 0 0.00 0 +phiX174:3207 0 0.00 0 +phiX174:3208 0 0.00 0 +phiX174:3209 0 0.00 0 +phiX174:3210 0 0.00 0 +phiX174:3211 0 0.00 0 +phiX174:3212 0 0.00 0 +phiX174:3213 0 0.00 0 +phiX174:3214 0 0.00 0 +phiX174:3215 0 0.00 0 +phiX174:3216 0 0.00 0 +phiX174:3217 0 0.00 0 +phiX174:3218 0 0.00 0 +phiX174:3219 0 0.00 0 +phiX174:3220 0 0.00 0 +phiX174:3221 0 0.00 0 +phiX174:3222 0 0.00 0 +phiX174:3223 0 0.00 0 +phiX174:3224 0 0.00 0 +phiX174:3225 0 0.00 0 +phiX174:3226 0 0.00 0 +phiX174:3227 0 0.00 0 +phiX174:3228 0 0.00 0 +phiX174:3229 0 0.00 0 +phiX174:3230 0 0.00 0 +phiX174:3231 0 0.00 0 +phiX174:3232 0 0.00 0 +phiX174:3233 0 0.00 0 +phiX174:3234 0 0.00 0 +phiX174:3235 0 0.00 0 +phiX174:3236 0 0.00 0 +phiX174:3237 0 0.00 0 +phiX174:3238 0 0.00 0 +phiX174:3239 0 0.00 0 +phiX174:3240 0 0.00 0 +phiX174:3241 0 0.00 0 +phiX174:3242 0 0.00 0 +phiX174:3243 0 0.00 0 +phiX174:3244 0 0.00 0 +phiX174:3245 0 0.00 0 +phiX174:3246 0 0.00 0 +phiX174:3247 0 0.00 0 +phiX174:3248 0 0.00 0 +phiX174:3249 0 0.00 0 +phiX174:3250 0 0.00 0 +phiX174:3251 0 0.00 0 +phiX174:3252 0 0.00 0 +phiX174:3253 0 0.00 0 +phiX174:3254 0 0.00 0 +phiX174:3255 0 0.00 0 +phiX174:3256 0 0.00 0 +phiX174:3257 0 0.00 0 +phiX174:3258 0 0.00 0 +phiX174:3259 0 0.00 0 +phiX174:3260 0 0.00 0 +phiX174:3261 0 0.00 0 +phiX174:3262 0 0.00 0 +phiX174:3263 0 0.00 0 +phiX174:3264 0 0.00 0 +phiX174:3265 0 0.00 0 +phiX174:3266 0 0.00 0 +phiX174:3267 0 0.00 0 +phiX174:3268 0 0.00 0 +phiX174:3269 0 0.00 0 +phiX174:3270 0 0.00 0 +phiX174:3271 0 0.00 0 +phiX174:3272 0 0.00 0 +phiX174:3273 0 0.00 0 +phiX174:3274 0 0.00 0 +phiX174:3275 0 0.00 0 +phiX174:3276 0 0.00 0 +phiX174:3277 0 0.00 0 +phiX174:3278 0 0.00 0 +phiX174:3279 0 0.00 0 +phiX174:3280 0 0.00 0 +phiX174:3281 0 0.00 0 +phiX174:3282 0 0.00 0 +phiX174:3283 0 0.00 0 +phiX174:3284 0 0.00 0 +phiX174:3285 0 0.00 0 +phiX174:3286 0 0.00 0 +phiX174:3287 0 0.00 0 +phiX174:3288 0 0.00 0 +phiX174:3289 0 0.00 0 +phiX174:3290 0 0.00 0 +phiX174:3291 0 0.00 0 +phiX174:3292 0 0.00 0 +phiX174:3293 0 0.00 0 +phiX174:3294 0 0.00 0 +phiX174:3295 0 0.00 0 +phiX174:3296 0 0.00 0 +phiX174:3297 0 0.00 0 +phiX174:3298 0 0.00 0 +phiX174:3299 0 0.00 0 +phiX174:3300 0 0.00 0 +phiX174:3301 0 0.00 0 +phiX174:3302 0 0.00 0 +phiX174:3303 0 0.00 0 +phiX174:3304 0 0.00 0 +phiX174:3305 0 0.00 0 +phiX174:3306 0 0.00 0 +phiX174:3307 0 0.00 0 +phiX174:3308 0 0.00 0 +phiX174:3309 0 0.00 0 +phiX174:3310 0 0.00 0 +phiX174:3311 0 0.00 0 +phiX174:3312 0 0.00 0 +phiX174:3313 0 0.00 0 +phiX174:3314 0 0.00 0 +phiX174:3315 0 0.00 0 +phiX174:3316 0 0.00 0 +phiX174:3317 0 0.00 0 +phiX174:3318 0 0.00 0 +phiX174:3319 0 0.00 0 +phiX174:3320 0 0.00 0 +phiX174:3321 0 0.00 0 +phiX174:3322 0 0.00 0 +phiX174:3323 0 0.00 0 +phiX174:3324 0 0.00 0 +phiX174:3325 0 0.00 0 +phiX174:3326 0 0.00 0 +phiX174:3327 0 0.00 0 +phiX174:3328 0 0.00 0 +phiX174:3329 0 0.00 0 +phiX174:3330 0 0.00 0 +phiX174:3331 0 0.00 0 +phiX174:3332 0 0.00 0 +phiX174:3333 0 0.00 0 +phiX174:3334 0 0.00 0 +phiX174:3335 0 0.00 0 +phiX174:3336 0 0.00 0 +phiX174:3337 0 0.00 0 +phiX174:3338 0 0.00 0 +phiX174:3339 0 0.00 0 +phiX174:3340 0 0.00 0 +phiX174:3341 0 0.00 0 +phiX174:3342 0 0.00 0 +phiX174:3343 0 0.00 0 +phiX174:3344 0 0.00 0 +phiX174:3345 0 0.00 0 +phiX174:3346 0 0.00 0 +phiX174:3347 0 0.00 0 +phiX174:3348 0 0.00 0 +phiX174:3349 0 0.00 0 +phiX174:3350 0 0.00 0 +phiX174:3351 0 0.00 0 +phiX174:3352 0 0.00 0 +phiX174:3353 0 0.00 0 +phiX174:3354 0 0.00 0 +phiX174:3355 0 0.00 0 +phiX174:3356 0 0.00 0 +phiX174:3357 0 0.00 0 +phiX174:3358 0 0.00 0 +phiX174:3359 0 0.00 0 +phiX174:3360 0 0.00 0 +phiX174:3361 0 0.00 0 +phiX174:3362 0 0.00 0 +phiX174:3363 0 0.00 0 +phiX174:3364 0 0.00 0 +phiX174:3365 0 0.00 0 +phiX174:3366 0 0.00 0 +phiX174:3367 0 0.00 0 +phiX174:3368 0 0.00 0 +phiX174:3369 0 0.00 0 +phiX174:3370 0 0.00 0 +phiX174:3371 0 0.00 0 +phiX174:3372 0 0.00 0 +phiX174:3373 0 0.00 0 +phiX174:3374 0 0.00 0 +phiX174:3375 0 0.00 0 +phiX174:3376 0 0.00 0 +phiX174:3377 0 0.00 0 +phiX174:3378 0 0.00 0 +phiX174:3379 0 0.00 0 +phiX174:3380 0 0.00 0 +phiX174:3381 0 0.00 0 +phiX174:3382 0 0.00 0 +phiX174:3383 0 0.00 0 +phiX174:3384 0 0.00 0 +phiX174:3385 0 0.00 0 +phiX174:3386 0 0.00 0 +phiX174:3387 0 0.00 0 +phiX174:3388 0 0.00 0 +phiX174:3389 0 0.00 0 +phiX174:3390 0 0.00 0 +phiX174:3391 0 0.00 0 +phiX174:3392 0 0.00 0 +phiX174:3393 0 0.00 0 +phiX174:3394 0 0.00 0 +phiX174:3395 0 0.00 0 +phiX174:3396 0 0.00 0 +phiX174:3397 0 0.00 0 +phiX174:3398 0 0.00 0 +phiX174:3399 0 0.00 0 +phiX174:3400 0 0.00 0 +phiX174:3401 0 0.00 0 +phiX174:3402 0 0.00 0 +phiX174:3403 0 0.00 0 +phiX174:3404 0 0.00 0 +phiX174:3405 0 0.00 0 +phiX174:3406 0 0.00 0 +phiX174:3407 0 0.00 0 +phiX174:3408 0 0.00 0 +phiX174:3409 0 0.00 0 +phiX174:3410 0 0.00 0 +phiX174:3411 0 0.00 0 +phiX174:3412 0 0.00 0 +phiX174:3413 0 0.00 0 +phiX174:3414 0 0.00 0 +phiX174:3415 0 0.00 0 +phiX174:3416 0 0.00 0 +phiX174:3417 0 0.00 0 +phiX174:3418 0 0.00 0 +phiX174:3419 0 0.00 0 +phiX174:3420 0 0.00 0 +phiX174:3421 0 0.00 0 +phiX174:3422 0 0.00 0 +phiX174:3423 0 0.00 0 +phiX174:3424 0 0.00 0 +phiX174:3425 0 0.00 0 +phiX174:3426 0 0.00 0 +phiX174:3427 0 0.00 0 +phiX174:3428 0 0.00 0 +phiX174:3429 0 0.00 0 +phiX174:3430 0 0.00 0 +phiX174:3431 0 0.00 0 +phiX174:3432 0 0.00 0 +phiX174:3433 0 0.00 0 +phiX174:3434 0 0.00 0 +phiX174:3435 0 0.00 0 +phiX174:3436 0 0.00 0 +phiX174:3437 0 0.00 0 +phiX174:3438 0 0.00 0 +phiX174:3439 0 0.00 0 +phiX174:3440 0 0.00 0 +phiX174:3441 0 0.00 0 +phiX174:3442 0 0.00 0 +phiX174:3443 0 0.00 0 +phiX174:3444 0 0.00 0 +phiX174:3445 0 0.00 0 +phiX174:3446 0 0.00 0 +phiX174:3447 0 0.00 0 +phiX174:3448 0 0.00 0 +phiX174:3449 0 0.00 0 +phiX174:3450 0 0.00 0 +phiX174:3451 0 0.00 0 +phiX174:3452 0 0.00 0 +phiX174:3453 0 0.00 0 +phiX174:3454 0 0.00 0 +phiX174:3455 0 0.00 0 +phiX174:3456 0 0.00 0 +phiX174:3457 0 0.00 0 +phiX174:3458 0 0.00 0 +phiX174:3459 0 0.00 0 +phiX174:3460 0 0.00 0 +phiX174:3461 0 0.00 0 +phiX174:3462 0 0.00 0 +phiX174:3463 0 0.00 0 +phiX174:3464 0 0.00 0 +phiX174:3465 0 0.00 0 +phiX174:3466 0 0.00 0 +phiX174:3467 0 0.00 0 +phiX174:3468 0 0.00 0 +phiX174:3469 0 0.00 0 +phiX174:3470 0 0.00 0 +phiX174:3471 0 0.00 0 +phiX174:3472 0 0.00 0 +phiX174:3473 0 0.00 0 +phiX174:3474 0 0.00 0 +phiX174:3475 0 0.00 0 +phiX174:3476 0 0.00 0 +phiX174:3477 0 0.00 0 +phiX174:3478 0 0.00 0 +phiX174:3479 0 0.00 0 +phiX174:3480 0 0.00 0 +phiX174:3481 0 0.00 0 +phiX174:3482 0 0.00 0 +phiX174:3483 0 0.00 0 +phiX174:3484 0 0.00 0 +phiX174:3485 0 0.00 0 +phiX174:3486 0 0.00 0 +phiX174:3487 0 0.00 0 +phiX174:3488 0 0.00 0 +phiX174:3489 0 0.00 0 +phiX174:3490 0 0.00 0 +phiX174:3491 0 0.00 0 +phiX174:3492 0 0.00 0 +phiX174:3493 0 0.00 0 +phiX174:3494 0 0.00 0 +phiX174:3495 0 0.00 0 +phiX174:3496 0 0.00 0 +phiX174:3497 0 0.00 0 +phiX174:3498 0 0.00 0 +phiX174:3499 0 0.00 0 +phiX174:3500 0 0.00 0 +phiX174:3501 0 0.00 0 +phiX174:3502 0 0.00 0 +phiX174:3503 0 0.00 0 +phiX174:3504 0 0.00 0 +phiX174:3505 0 0.00 0 +phiX174:3506 0 0.00 0 +phiX174:3507 0 0.00 0 +phiX174:3508 0 0.00 0 +phiX174:3509 0 0.00 0 +phiX174:3510 0 0.00 0 +phiX174:3511 0 0.00 0 +phiX174:3512 0 0.00 0 +phiX174:3513 0 0.00 0 +phiX174:3514 0 0.00 0 +phiX174:3515 0 0.00 0 +phiX174:3516 0 0.00 0 +phiX174:3517 0 0.00 0 +phiX174:3518 0 0.00 0 +phiX174:3519 0 0.00 0 +phiX174:3520 0 0.00 0 +phiX174:3521 0 0.00 0 +phiX174:3522 0 0.00 0 +phiX174:3523 0 0.00 0 +phiX174:3524 0 0.00 0 +phiX174:3525 0 0.00 0 +phiX174:3526 0 0.00 0 +phiX174:3527 0 0.00 0 +phiX174:3528 0 0.00 0 +phiX174:3529 0 0.00 0 +phiX174:3530 0 0.00 0 +phiX174:3531 0 0.00 0 +phiX174:3532 0 0.00 0 +phiX174:3533 0 0.00 0 +phiX174:3534 0 0.00 0 +phiX174:3535 0 0.00 0 +phiX174:3536 0 0.00 0 +phiX174:3537 0 0.00 0 +phiX174:3538 0 0.00 0 +phiX174:3539 0 0.00 0 +phiX174:3540 0 0.00 0 +phiX174:3541 0 0.00 0 +phiX174:3542 0 0.00 0 +phiX174:3543 0 0.00 0 +phiX174:3544 0 0.00 0 +phiX174:3545 0 0.00 0 +phiX174:3546 0 0.00 0 +phiX174:3547 0 0.00 0 +phiX174:3548 0 0.00 0 +phiX174:3549 0 0.00 0 +phiX174:3550 0 0.00 0 +phiX174:3551 0 0.00 0 +phiX174:3552 0 0.00 0 +phiX174:3553 0 0.00 0 +phiX174:3554 0 0.00 0 +phiX174:3555 0 0.00 0 +phiX174:3556 0 0.00 0 +phiX174:3557 0 0.00 0 +phiX174:3558 0 0.00 0 +phiX174:3559 0 0.00 0 +phiX174:3560 0 0.00 0 +phiX174:3561 0 0.00 0 +phiX174:3562 0 0.00 0 +phiX174:3563 0 0.00 0 +phiX174:3564 0 0.00 0 +phiX174:3565 0 0.00 0 +phiX174:3566 0 0.00 0 +phiX174:3567 0 0.00 0 +phiX174:3568 0 0.00 0 +phiX174:3569 0 0.00 0 +phiX174:3570 0 0.00 0 +phiX174:3571 0 0.00 0 +phiX174:3572 0 0.00 0 +phiX174:3573 0 0.00 0 +phiX174:3574 0 0.00 0 +phiX174:3575 0 0.00 0 +phiX174:3576 0 0.00 0 +phiX174:3577 0 0.00 0 +phiX174:3578 0 0.00 0 +phiX174:3579 0 0.00 0 +phiX174:3580 0 0.00 0 +phiX174:3581 0 0.00 0 +phiX174:3582 0 0.00 0 +phiX174:3583 0 0.00 0 +phiX174:3584 0 0.00 0 +phiX174:3585 0 0.00 0 +phiX174:3586 0 0.00 0 +phiX174:3587 0 0.00 0 +phiX174:3588 0 0.00 0 +phiX174:3589 0 0.00 0 +phiX174:3590 0 0.00 0 +phiX174:3591 0 0.00 0 +phiX174:3592 0 0.00 0 +phiX174:3593 0 0.00 0 +phiX174:3594 0 0.00 0 +phiX174:3595 0 0.00 0 +phiX174:3596 0 0.00 0 +phiX174:3597 0 0.00 0 +phiX174:3598 0 0.00 0 +phiX174:3599 0 0.00 0 +phiX174:3600 0 0.00 0 +phiX174:3601 0 0.00 0 +phiX174:3602 0 0.00 0 +phiX174:3603 0 0.00 0 +phiX174:3604 0 0.00 0 +phiX174:3605 0 0.00 0 +phiX174:3606 0 0.00 0 +phiX174:3607 0 0.00 0 +phiX174:3608 0 0.00 0 +phiX174:3609 0 0.00 0 +phiX174:3610 0 0.00 0 +phiX174:3611 0 0.00 0 +phiX174:3612 0 0.00 0 +phiX174:3613 0 0.00 0 +phiX174:3614 0 0.00 0 +phiX174:3615 0 0.00 0 +phiX174:3616 0 0.00 0 +phiX174:3617 0 0.00 0 +phiX174:3618 0 0.00 0 +phiX174:3619 0 0.00 0 +phiX174:3620 0 0.00 0 +phiX174:3621 0 0.00 0 +phiX174:3622 0 0.00 0 +phiX174:3623 0 0.00 0 +phiX174:3624 0 0.00 0 +phiX174:3625 0 0.00 0 +phiX174:3626 0 0.00 0 +phiX174:3627 0 0.00 0 +phiX174:3628 0 0.00 0 +phiX174:3629 0 0.00 0 +phiX174:3630 0 0.00 0 +phiX174:3631 0 0.00 0 +phiX174:3632 0 0.00 0 +phiX174:3633 0 0.00 0 +phiX174:3634 0 0.00 0 +phiX174:3635 0 0.00 0 +phiX174:3636 0 0.00 0 +phiX174:3637 0 0.00 0 +phiX174:3638 0 0.00 0 +phiX174:3639 0 0.00 0 +phiX174:3640 0 0.00 0 +phiX174:3641 0 0.00 0 +phiX174:3642 0 0.00 0 +phiX174:3643 0 0.00 0 +phiX174:3644 0 0.00 0 +phiX174:3645 0 0.00 0 +phiX174:3646 0 0.00 0 +phiX174:3647 0 0.00 0 +phiX174:3648 0 0.00 0 +phiX174:3649 0 0.00 0 +phiX174:3650 0 0.00 0 +phiX174:3651 0 0.00 0 +phiX174:3652 0 0.00 0 +phiX174:3653 0 0.00 0 +phiX174:3654 0 0.00 0 +phiX174:3655 0 0.00 0 +phiX174:3656 0 0.00 0 +phiX174:3657 0 0.00 0 +phiX174:3658 0 0.00 0 +phiX174:3659 0 0.00 0 +phiX174:3660 0 0.00 0 +phiX174:3661 0 0.00 0 +phiX174:3662 0 0.00 0 +phiX174:3663 0 0.00 0 +phiX174:3664 0 0.00 0 +phiX174:3665 0 0.00 0 +phiX174:3666 0 0.00 0 +phiX174:3667 0 0.00 0 +phiX174:3668 0 0.00 0 +phiX174:3669 0 0.00 0 +phiX174:3670 0 0.00 0 +phiX174:3671 0 0.00 0 +phiX174:3672 0 0.00 0 +phiX174:3673 0 0.00 0 +phiX174:3674 0 0.00 0 +phiX174:3675 0 0.00 0 +phiX174:3676 0 0.00 0 +phiX174:3677 0 0.00 0 +phiX174:3678 0 0.00 0 +phiX174:3679 0 0.00 0 +phiX174:3680 0 0.00 0 +phiX174:3681 0 0.00 0 +phiX174:3682 0 0.00 0 +phiX174:3683 0 0.00 0 +phiX174:3684 0 0.00 0 +phiX174:3685 0 0.00 0 +phiX174:3686 0 0.00 0 +phiX174:3687 0 0.00 0 +phiX174:3688 0 0.00 0 +phiX174:3689 0 0.00 0 +phiX174:3690 0 0.00 0 +phiX174:3691 0 0.00 0 +phiX174:3692 0 0.00 0 +phiX174:3693 0 0.00 0 +phiX174:3694 0 0.00 0 +phiX174:3695 0 0.00 0 +phiX174:3696 0 0.00 0 +phiX174:3697 0 0.00 0 +phiX174:3698 0 0.00 0 +phiX174:3699 0 0.00 0 +phiX174:3700 0 0.00 0 +phiX174:3701 0 0.00 0 +phiX174:3702 0 0.00 0 +phiX174:3703 0 0.00 0 +phiX174:3704 0 0.00 0 +phiX174:3705 0 0.00 0 +phiX174:3706 0 0.00 0 +phiX174:3707 0 0.00 0 +phiX174:3708 0 0.00 0 +phiX174:3709 0 0.00 0 +phiX174:3710 0 0.00 0 +phiX174:3711 0 0.00 0 +phiX174:3712 0 0.00 0 +phiX174:3713 0 0.00 0 +phiX174:3714 0 0.00 0 +phiX174:3715 0 0.00 0 +phiX174:3716 0 0.00 0 +phiX174:3717 0 0.00 0 +phiX174:3718 0 0.00 0 +phiX174:3719 0 0.00 0 +phiX174:3720 0 0.00 0 +phiX174:3721 0 0.00 0 +phiX174:3722 0 0.00 0 +phiX174:3723 0 0.00 0 +phiX174:3724 0 0.00 0 +phiX174:3725 0 0.00 0 +phiX174:3726 0 0.00 0 +phiX174:3727 0 0.00 0 +phiX174:3728 0 0.00 0 +phiX174:3729 0 0.00 0 +phiX174:3730 0 0.00 0 +phiX174:3731 0 0.00 0 +phiX174:3732 0 0.00 0 +phiX174:3733 0 0.00 0 +phiX174:3734 0 0.00 0 +phiX174:3735 0 0.00 0 +phiX174:3736 0 0.00 0 +phiX174:3737 0 0.00 0 +phiX174:3738 0 0.00 0 +phiX174:3739 0 0.00 0 +phiX174:3740 0 0.00 0 +phiX174:3741 0 0.00 0 +phiX174:3742 0 0.00 0 +phiX174:3743 0 0.00 0 +phiX174:3744 0 0.00 0 +phiX174:3745 0 0.00 0 +phiX174:3746 0 0.00 0 +phiX174:3747 0 0.00 0 +phiX174:3748 0 0.00 0 +phiX174:3749 0 0.00 0 +phiX174:3750 0 0.00 0 +phiX174:3751 0 0.00 0 +phiX174:3752 0 0.00 0 +phiX174:3753 0 0.00 0 +phiX174:3754 0 0.00 0 +phiX174:3755 0 0.00 0 +phiX174:3756 0 0.00 0 +phiX174:3757 0 0.00 0 +phiX174:3758 0 0.00 0 +phiX174:3759 0 0.00 0 +phiX174:3760 0 0.00 0 +phiX174:3761 0 0.00 0 +phiX174:3762 0 0.00 0 +phiX174:3763 0 0.00 0 +phiX174:3764 0 0.00 0 +phiX174:3765 0 0.00 0 +phiX174:3766 0 0.00 0 +phiX174:3767 0 0.00 0 +phiX174:3768 0 0.00 0 +phiX174:3769 0 0.00 0 +phiX174:3770 0 0.00 0 +phiX174:3771 0 0.00 0 +phiX174:3772 0 0.00 0 +phiX174:3773 0 0.00 0 +phiX174:3774 0 0.00 0 +phiX174:3775 0 0.00 0 +phiX174:3776 0 0.00 0 +phiX174:3777 0 0.00 0 +phiX174:3778 0 0.00 0 +phiX174:3779 0 0.00 0 +phiX174:3780 0 0.00 0 +phiX174:3781 0 0.00 0 +phiX174:3782 0 0.00 0 +phiX174:3783 0 0.00 0 +phiX174:3784 0 0.00 0 +phiX174:3785 0 0.00 0 +phiX174:3786 0 0.00 0 +phiX174:3787 0 0.00 0 +phiX174:3788 0 0.00 0 +phiX174:3789 0 0.00 0 +phiX174:3790 0 0.00 0 +phiX174:3791 0 0.00 0 +phiX174:3792 0 0.00 0 +phiX174:3793 0 0.00 0 +phiX174:3794 0 0.00 0 +phiX174:3795 0 0.00 0 +phiX174:3796 0 0.00 0 +phiX174:3797 0 0.00 0 +phiX174:3798 0 0.00 0 +phiX174:3799 0 0.00 0 +phiX174:3800 0 0.00 0 +phiX174:3801 0 0.00 0 +phiX174:3802 0 0.00 0 +phiX174:3803 0 0.00 0 +phiX174:3804 0 0.00 0 +phiX174:3805 0 0.00 0 +phiX174:3806 0 0.00 0 +phiX174:3807 0 0.00 0 +phiX174:3808 0 0.00 0 +phiX174:3809 0 0.00 0 +phiX174:3810 0 0.00 0 +phiX174:3811 0 0.00 0 +phiX174:3812 0 0.00 0 +phiX174:3813 0 0.00 0 +phiX174:3814 0 0.00 0 +phiX174:3815 0 0.00 0 +phiX174:3816 0 0.00 0 +phiX174:3817 0 0.00 0 +phiX174:3818 0 0.00 0 +phiX174:3819 0 0.00 0 +phiX174:3820 0 0.00 0 +phiX174:3821 0 0.00 0 +phiX174:3822 0 0.00 0 +phiX174:3823 0 0.00 0 +phiX174:3824 0 0.00 0 +phiX174:3825 0 0.00 0 +phiX174:3826 0 0.00 0 +phiX174:3827 0 0.00 0 +phiX174:3828 0 0.00 0 +phiX174:3829 0 0.00 0 +phiX174:3830 0 0.00 0 +phiX174:3831 0 0.00 0 +phiX174:3832 0 0.00 0 +phiX174:3833 0 0.00 0 +phiX174:3834 0 0.00 0 +phiX174:3835 0 0.00 0 +phiX174:3836 0 0.00 0 +phiX174:3837 0 0.00 0 +phiX174:3838 0 0.00 0 +phiX174:3839 0 0.00 0 +phiX174:3840 0 0.00 0 +phiX174:3841 0 0.00 0 +phiX174:3842 0 0.00 0 +phiX174:3843 0 0.00 0 +phiX174:3844 0 0.00 0 +phiX174:3845 0 0.00 0 +phiX174:3846 0 0.00 0 +phiX174:3847 0 0.00 0 +phiX174:3848 0 0.00 0 +phiX174:3849 0 0.00 0 +phiX174:3850 0 0.00 0 +phiX174:3851 0 0.00 0 +phiX174:3852 0 0.00 0 +phiX174:3853 0 0.00 0 +phiX174:3854 0 0.00 0 +phiX174:3855 0 0.00 0 +phiX174:3856 0 0.00 0 +phiX174:3857 0 0.00 0 +phiX174:3858 0 0.00 0 +phiX174:3859 0 0.00 0 +phiX174:3860 0 0.00 0 +phiX174:3861 0 0.00 0 +phiX174:3862 0 0.00 0 +phiX174:3863 0 0.00 0 +phiX174:3864 0 0.00 0 +phiX174:3865 0 0.00 0 +phiX174:3866 0 0.00 0 +phiX174:3867 0 0.00 0 +phiX174:3868 0 0.00 0 +phiX174:3869 0 0.00 0 +phiX174:3870 0 0.00 0 +phiX174:3871 0 0.00 0 +phiX174:3872 0 0.00 0 +phiX174:3873 0 0.00 0 +phiX174:3874 0 0.00 0 +phiX174:3875 0 0.00 0 +phiX174:3876 0 0.00 0 +phiX174:3877 0 0.00 0 +phiX174:3878 0 0.00 0 +phiX174:3879 0 0.00 0 +phiX174:3880 0 0.00 0 +phiX174:3881 0 0.00 0 +phiX174:3882 0 0.00 0 +phiX174:3883 0 0.00 0 +phiX174:3884 0 0.00 0 +phiX174:3885 0 0.00 0 +phiX174:3886 0 0.00 0 +phiX174:3887 0 0.00 0 +phiX174:3888 0 0.00 0 +phiX174:3889 0 0.00 0 +phiX174:3890 0 0.00 0 +phiX174:3891 0 0.00 0 +phiX174:3892 0 0.00 0 +phiX174:3893 0 0.00 0 +phiX174:3894 0 0.00 0 +phiX174:3895 0 0.00 0 +phiX174:3896 0 0.00 0 +phiX174:3897 0 0.00 0 +phiX174:3898 0 0.00 0 +phiX174:3899 0 0.00 0 +phiX174:3900 0 0.00 0 +phiX174:3901 0 0.00 0 +phiX174:3902 0 0.00 0 +phiX174:3903 0 0.00 0 +phiX174:3904 0 0.00 0 +phiX174:3905 0 0.00 0 +phiX174:3906 0 0.00 0 +phiX174:3907 0 0.00 0 +phiX174:3908 0 0.00 0 +phiX174:3909 0 0.00 0 +phiX174:3910 0 0.00 0 +phiX174:3911 0 0.00 0 +phiX174:3912 0 0.00 0 +phiX174:3913 0 0.00 0 +phiX174:3914 0 0.00 0 +phiX174:3915 0 0.00 0 +phiX174:3916 0 0.00 0 +phiX174:3917 0 0.00 0 +phiX174:3918 0 0.00 0 +phiX174:3919 0 0.00 0 +phiX174:3920 0 0.00 0 +phiX174:3921 0 0.00 0 +phiX174:3922 0 0.00 0 +phiX174:3923 0 0.00 0 +phiX174:3924 0 0.00 0 +phiX174:3925 0 0.00 0 +phiX174:3926 0 0.00 0 +phiX174:3927 0 0.00 0 +phiX174:3928 0 0.00 0 +phiX174:3929 0 0.00 0 +phiX174:3930 0 0.00 0 +phiX174:3931 0 0.00 0 +phiX174:3932 0 0.00 0 +phiX174:3933 0 0.00 0 +phiX174:3934 0 0.00 0 +phiX174:3935 0 0.00 0 +phiX174:3936 0 0.00 0 +phiX174:3937 0 0.00 0 +phiX174:3938 0 0.00 0 +phiX174:3939 0 0.00 0 +phiX174:3940 0 0.00 0 +phiX174:3941 0 0.00 0 +phiX174:3942 0 0.00 0 +phiX174:3943 0 0.00 0 +phiX174:3944 0 0.00 0 +phiX174:3945 0 0.00 0 +phiX174:3946 0 0.00 0 +phiX174:3947 0 0.00 0 +phiX174:3948 0 0.00 0 +phiX174:3949 0 0.00 0 +phiX174:3950 0 0.00 0 +phiX174:3951 0 0.00 0 +phiX174:3952 0 0.00 0 +phiX174:3953 0 0.00 0 +phiX174:3954 0 0.00 0 +phiX174:3955 0 0.00 0 +phiX174:3956 0 0.00 0 +phiX174:3957 0 0.00 0 +phiX174:3958 0 0.00 0 +phiX174:3959 0 0.00 0 +phiX174:3960 0 0.00 0 +phiX174:3961 0 0.00 0 +phiX174:3962 0 0.00 0 +phiX174:3963 0 0.00 0 +phiX174:3964 0 0.00 0 +phiX174:3965 0 0.00 0 +phiX174:3966 0 0.00 0 +phiX174:3967 0 0.00 0 +phiX174:3968 0 0.00 0 +phiX174:3969 0 0.00 0 +phiX174:3970 0 0.00 0 +phiX174:3971 0 0.00 0 +phiX174:3972 0 0.00 0 +phiX174:3973 0 0.00 0 +phiX174:3974 0 0.00 0 +phiX174:3975 0 0.00 0 +phiX174:3976 0 0.00 0 +phiX174:3977 0 0.00 0 +phiX174:3978 0 0.00 0 +phiX174:3979 0 0.00 0 +phiX174:3980 0 0.00 0 +phiX174:3981 0 0.00 0 +phiX174:3982 0 0.00 0 +phiX174:3983 0 0.00 0 +phiX174:3984 0 0.00 0 +phiX174:3985 0 0.00 0 +phiX174:3986 0 0.00 0 +phiX174:3987 0 0.00 0 +phiX174:3988 0 0.00 0 +phiX174:3989 0 0.00 0 +phiX174:3990 0 0.00 0 +phiX174:3991 0 0.00 0 +phiX174:3992 0 0.00 0 +phiX174:3993 0 0.00 0 +phiX174:3994 0 0.00 0 +phiX174:3995 0 0.00 0 +phiX174:3996 0 0.00 0 +phiX174:3997 0 0.00 0 +phiX174:3998 0 0.00 0 +phiX174:3999 0 0.00 0 +phiX174:4000 0 0.00 0 +phiX174:4001 0 0.00 0 +phiX174:4002 0 0.00 0 +phiX174:4003 0 0.00 0 +phiX174:4004 0 0.00 0 +phiX174:4005 0 0.00 0 +phiX174:4006 0 0.00 0 +phiX174:4007 0 0.00 0 +phiX174:4008 0 0.00 0 +phiX174:4009 0 0.00 0 +phiX174:4010 0 0.00 0 +phiX174:4011 0 0.00 0 +phiX174:4012 0 0.00 0 +phiX174:4013 0 0.00 0 +phiX174:4014 0 0.00 0 +phiX174:4015 0 0.00 0 +phiX174:4016 0 0.00 0 +phiX174:4017 0 0.00 0 +phiX174:4018 0 0.00 0 +phiX174:4019 0 0.00 0 +phiX174:4020 0 0.00 0 +phiX174:4021 0 0.00 0 +phiX174:4022 0 0.00 0 +phiX174:4023 0 0.00 0 +phiX174:4024 0 0.00 0 +phiX174:4025 0 0.00 0 +phiX174:4026 0 0.00 0 +phiX174:4027 0 0.00 0 +phiX174:4028 0 0.00 0 +phiX174:4029 0 0.00 0 +phiX174:4030 0 0.00 0 +phiX174:4031 0 0.00 0 +phiX174:4032 0 0.00 0 +phiX174:4033 0 0.00 0 +phiX174:4034 0 0.00 0 +phiX174:4035 0 0.00 0 +phiX174:4036 0 0.00 0 +phiX174:4037 0 0.00 0 +phiX174:4038 0 0.00 0 +phiX174:4039 0 0.00 0 +phiX174:4040 0 0.00 0 +phiX174:4041 0 0.00 0 +phiX174:4042 0 0.00 0 +phiX174:4043 0 0.00 0 +phiX174:4044 0 0.00 0 +phiX174:4045 0 0.00 0 +phiX174:4046 0 0.00 0 +phiX174:4047 0 0.00 0 +phiX174:4048 0 0.00 0 +phiX174:4049 0 0.00 0 +phiX174:4050 0 0.00 0 +phiX174:4051 0 0.00 0 +phiX174:4052 0 0.00 0 +phiX174:4053 0 0.00 0 +phiX174:4054 0 0.00 0 +phiX174:4055 0 0.00 0 +phiX174:4056 0 0.00 0 +phiX174:4057 0 0.00 0 +phiX174:4058 0 0.00 0 +phiX174:4059 0 0.00 0 +phiX174:4060 0 0.00 0 +phiX174:4061 0 0.00 0 +phiX174:4062 0 0.00 0 +phiX174:4063 0 0.00 0 +phiX174:4064 0 0.00 0 +phiX174:4065 0 0.00 0 +phiX174:4066 0 0.00 0 +phiX174:4067 0 0.00 0 +phiX174:4068 0 0.00 0 +phiX174:4069 0 0.00 0 +phiX174:4070 0 0.00 0 +phiX174:4071 0 0.00 0 +phiX174:4072 0 0.00 0 +phiX174:4073 0 0.00 0 +phiX174:4074 0 0.00 0 +phiX174:4075 0 0.00 0 +phiX174:4076 0 0.00 0 +phiX174:4077 0 0.00 0 +phiX174:4078 0 0.00 0 +phiX174:4079 0 0.00 0 +phiX174:4080 0 0.00 0 +phiX174:4081 0 0.00 0 +phiX174:4082 0 0.00 0 +phiX174:4083 0 0.00 0 +phiX174:4084 0 0.00 0 +phiX174:4085 0 0.00 0 +phiX174:4086 0 0.00 0 +phiX174:4087 0 0.00 0 +phiX174:4088 0 0.00 0 +phiX174:4089 0 0.00 0 +phiX174:4090 0 0.00 0 +phiX174:4091 0 0.00 0 +phiX174:4092 0 0.00 0 +phiX174:4093 0 0.00 0 +phiX174:4094 0 0.00 0 +phiX174:4095 0 0.00 0 +phiX174:4096 0 0.00 0 +phiX174:4097 0 0.00 0 +phiX174:4098 0 0.00 0 +phiX174:4099 0 0.00 0 +phiX174:4100 0 0.00 0 +phiX174:4101 0 0.00 0 +phiX174:4102 0 0.00 0 +phiX174:4103 0 0.00 0 +phiX174:4104 0 0.00 0 +phiX174:4105 0 0.00 0 +phiX174:4106 0 0.00 0 +phiX174:4107 0 0.00 0 +phiX174:4108 0 0.00 0 +phiX174:4109 0 0.00 0 +phiX174:4110 0 0.00 0 +phiX174:4111 0 0.00 0 +phiX174:4112 0 0.00 0 +phiX174:4113 0 0.00 0 +phiX174:4114 0 0.00 0 +phiX174:4115 0 0.00 0 +phiX174:4116 0 0.00 0 +phiX174:4117 0 0.00 0 +phiX174:4118 0 0.00 0 +phiX174:4119 0 0.00 0 +phiX174:4120 0 0.00 0 +phiX174:4121 0 0.00 0 +phiX174:4122 0 0.00 0 +phiX174:4123 0 0.00 0 +phiX174:4124 0 0.00 0 +phiX174:4125 0 0.00 0 +phiX174:4126 0 0.00 0 +phiX174:4127 0 0.00 0 +phiX174:4128 0 0.00 0 +phiX174:4129 0 0.00 0 +phiX174:4130 0 0.00 0 +phiX174:4131 0 0.00 0 +phiX174:4132 0 0.00 0 +phiX174:4133 0 0.00 0 +phiX174:4134 0 0.00 0 +phiX174:4135 0 0.00 0 +phiX174:4136 0 0.00 0 +phiX174:4137 0 0.00 0 +phiX174:4138 0 0.00 0 +phiX174:4139 0 0.00 0 +phiX174:4140 0 0.00 0 +phiX174:4141 0 0.00 0 +phiX174:4142 0 0.00 0 +phiX174:4143 0 0.00 0 +phiX174:4144 0 0.00 0 +phiX174:4145 0 0.00 0 +phiX174:4146 0 0.00 0 +phiX174:4147 0 0.00 0 +phiX174:4148 0 0.00 0 +phiX174:4149 0 0.00 0 +phiX174:4150 0 0.00 0 +phiX174:4151 0 0.00 0 +phiX174:4152 0 0.00 0 +phiX174:4153 0 0.00 0 +phiX174:4154 0 0.00 0 +phiX174:4155 0 0.00 0 +phiX174:4156 0 0.00 0 +phiX174:4157 0 0.00 0 +phiX174:4158 0 0.00 0 +phiX174:4159 0 0.00 0 +phiX174:4160 0 0.00 0 +phiX174:4161 0 0.00 0 +phiX174:4162 0 0.00 0 +phiX174:4163 0 0.00 0 +phiX174:4164 0 0.00 0 +phiX174:4165 0 0.00 0 +phiX174:4166 0 0.00 0 +phiX174:4167 0 0.00 0 +phiX174:4168 0 0.00 0 +phiX174:4169 0 0.00 0 +phiX174:4170 0 0.00 0 +phiX174:4171 0 0.00 0 +phiX174:4172 0 0.00 0 +phiX174:4173 0 0.00 0 +phiX174:4174 0 0.00 0 +phiX174:4175 0 0.00 0 +phiX174:4176 0 0.00 0 +phiX174:4177 0 0.00 0 +phiX174:4178 0 0.00 0 +phiX174:4179 0 0.00 0 +phiX174:4180 0 0.00 0 +phiX174:4181 0 0.00 0 +phiX174:4182 0 0.00 0 +phiX174:4183 0 0.00 0 +phiX174:4184 0 0.00 0 +phiX174:4185 0 0.00 0 +phiX174:4186 0 0.00 0 +phiX174:4187 0 0.00 0 +phiX174:4188 0 0.00 0 +phiX174:4189 0 0.00 0 +phiX174:4190 0 0.00 0 +phiX174:4191 0 0.00 0 +phiX174:4192 0 0.00 0 +phiX174:4193 0 0.00 0 +phiX174:4194 0 0.00 0 +phiX174:4195 0 0.00 0 +phiX174:4196 0 0.00 0 +phiX174:4197 0 0.00 0 +phiX174:4198 0 0.00 0 +phiX174:4199 0 0.00 0 +phiX174:4200 0 0.00 0 +phiX174:4201 0 0.00 0 +phiX174:4202 0 0.00 0 +phiX174:4203 0 0.00 0 +phiX174:4204 0 0.00 0 +phiX174:4205 0 0.00 0 +phiX174:4206 0 0.00 0 +phiX174:4207 0 0.00 0 +phiX174:4208 0 0.00 0 +phiX174:4209 0 0.00 0 +phiX174:4210 0 0.00 0 +phiX174:4211 0 0.00 0 +phiX174:4212 0 0.00 0 +phiX174:4213 0 0.00 0 +phiX174:4214 0 0.00 0 +phiX174:4215 0 0.00 0 +phiX174:4216 0 0.00 0 +phiX174:4217 0 0.00 0 +phiX174:4218 0 0.00 0 +phiX174:4219 0 0.00 0 +phiX174:4220 0 0.00 0 +phiX174:4221 0 0.00 0 +phiX174:4222 0 0.00 0 +phiX174:4223 0 0.00 0 +phiX174:4224 0 0.00 0 +phiX174:4225 0 0.00 0 +phiX174:4226 0 0.00 0 +phiX174:4227 0 0.00 0 +phiX174:4228 0 0.00 0 +phiX174:4229 0 0.00 0 +phiX174:4230 0 0.00 0 +phiX174:4231 0 0.00 0 +phiX174:4232 0 0.00 0 +phiX174:4233 0 0.00 0 +phiX174:4234 0 0.00 0 +phiX174:4235 0 0.00 0 +phiX174:4236 0 0.00 0 +phiX174:4237 0 0.00 0 +phiX174:4238 0 0.00 0 +phiX174:4239 0 0.00 0 +phiX174:4240 0 0.00 0 +phiX174:4241 0 0.00 0 +phiX174:4242 0 0.00 0 +phiX174:4243 0 0.00 0 +phiX174:4244 0 0.00 0 +phiX174:4245 0 0.00 0 +phiX174:4246 0 0.00 0 +phiX174:4247 0 0.00 0 +phiX174:4248 0 0.00 0 +phiX174:4249 0 0.00 0 +phiX174:4250 0 0.00 0 +phiX174:4251 0 0.00 0 +phiX174:4252 0 0.00 0 +phiX174:4253 0 0.00 0 +phiX174:4254 0 0.00 0 +phiX174:4255 0 0.00 0 +phiX174:4256 0 0.00 0 +phiX174:4257 0 0.00 0 +phiX174:4258 0 0.00 0 +phiX174:4259 0 0.00 0 +phiX174:4260 0 0.00 0 +phiX174:4261 0 0.00 0 +phiX174:4262 0 0.00 0 +phiX174:4263 0 0.00 0 +phiX174:4264 0 0.00 0 +phiX174:4265 0 0.00 0 +phiX174:4266 0 0.00 0 +phiX174:4267 0 0.00 0 +phiX174:4268 0 0.00 0 +phiX174:4269 0 0.00 0 +phiX174:4270 0 0.00 0 +phiX174:4271 0 0.00 0 +phiX174:4272 0 0.00 0 +phiX174:4273 0 0.00 0 +phiX174:4274 0 0.00 0 +phiX174:4275 0 0.00 0 +phiX174:4276 0 0.00 0 +phiX174:4277 0 0.00 0 +phiX174:4278 0 0.00 0 +phiX174:4279 0 0.00 0 +phiX174:4280 0 0.00 0 +phiX174:4281 0 0.00 0 +phiX174:4282 0 0.00 0 +phiX174:4283 0 0.00 0 +phiX174:4284 0 0.00 0 +phiX174:4285 0 0.00 0 +phiX174:4286 0 0.00 0 +phiX174:4287 0 0.00 0 +phiX174:4288 0 0.00 0 +phiX174:4289 0 0.00 0 +phiX174:4290 0 0.00 0 +phiX174:4291 0 0.00 0 +phiX174:4292 0 0.00 0 +phiX174:4293 0 0.00 0 +phiX174:4294 0 0.00 0 +phiX174:4295 0 0.00 0 +phiX174:4296 0 0.00 0 +phiX174:4297 0 0.00 0 +phiX174:4298 0 0.00 0 +phiX174:4299 0 0.00 0 +phiX174:4300 0 0.00 0 +phiX174:4301 0 0.00 0 +phiX174:4302 0 0.00 0 +phiX174:4303 0 0.00 0 +phiX174:4304 0 0.00 0 +phiX174:4305 0 0.00 0 +phiX174:4306 0 0.00 0 +phiX174:4307 0 0.00 0 +phiX174:4308 0 0.00 0 +phiX174:4309 0 0.00 0 +phiX174:4310 0 0.00 0 +phiX174:4311 0 0.00 0 +phiX174:4312 0 0.00 0 +phiX174:4313 0 0.00 0 +phiX174:4314 0 0.00 0 +phiX174:4315 0 0.00 0 +phiX174:4316 0 0.00 0 +phiX174:4317 0 0.00 0 +phiX174:4318 0 0.00 0 +phiX174:4319 0 0.00 0 +phiX174:4320 0 0.00 0 +phiX174:4321 0 0.00 0 +phiX174:4322 0 0.00 0 +phiX174:4323 0 0.00 0 +phiX174:4324 0 0.00 0 +phiX174:4325 0 0.00 0 +phiX174:4326 0 0.00 0 +phiX174:4327 0 0.00 0 +phiX174:4328 0 0.00 0 +phiX174:4329 0 0.00 0 +phiX174:4330 0 0.00 0 +phiX174:4331 0 0.00 0 +phiX174:4332 0 0.00 0 +phiX174:4333 0 0.00 0 +phiX174:4334 0 0.00 0 +phiX174:4335 0 0.00 0 +phiX174:4336 0 0.00 0 +phiX174:4337 0 0.00 0 +phiX174:4338 0 0.00 0 +phiX174:4339 0 0.00 0 +phiX174:4340 0 0.00 0 +phiX174:4341 0 0.00 0 +phiX174:4342 0 0.00 0 +phiX174:4343 0 0.00 0 +phiX174:4344 0 0.00 0 +phiX174:4345 0 0.00 0 +phiX174:4346 0 0.00 0 +phiX174:4347 0 0.00 0 +phiX174:4348 0 0.00 0 +phiX174:4349 0 0.00 0 +phiX174:4350 0 0.00 0 +phiX174:4351 0 0.00 0 +phiX174:4352 0 0.00 0 +phiX174:4353 0 0.00 0 +phiX174:4354 0 0.00 0 +phiX174:4355 0 0.00 0 +phiX174:4356 0 0.00 0 +phiX174:4357 0 0.00 0 +phiX174:4358 0 0.00 0 +phiX174:4359 0 0.00 0 +phiX174:4360 0 0.00 0 +phiX174:4361 0 0.00 0 +phiX174:4362 0 0.00 0 +phiX174:4363 0 0.00 0 +phiX174:4364 0 0.00 0 +phiX174:4365 0 0.00 0 +phiX174:4366 0 0.00 0 +phiX174:4367 0 0.00 0 +phiX174:4368 0 0.00 0 +phiX174:4369 0 0.00 0 +phiX174:4370 0 0.00 0 +phiX174:4371 0 0.00 0 +phiX174:4372 0 0.00 0 +phiX174:4373 0 0.00 0 +phiX174:4374 0 0.00 0 +phiX174:4375 0 0.00 0 +phiX174:4376 0 0.00 0 +phiX174:4377 0 0.00 0 +phiX174:4378 0 0.00 0 +phiX174:4379 0 0.00 0 +phiX174:4380 0 0.00 0 +phiX174:4381 0 0.00 0 +phiX174:4382 0 0.00 0 +phiX174:4383 0 0.00 0 +phiX174:4384 0 0.00 0 +phiX174:4385 0 0.00 0 +phiX174:4386 0 0.00 0 +phiX174:4387 0 0.00 0 +phiX174:4388 0 0.00 0 +phiX174:4389 0 0.00 0 +phiX174:4390 0 0.00 0 +phiX174:4391 0 0.00 0 +phiX174:4392 0 0.00 0 +phiX174:4393 0 0.00 0 +phiX174:4394 0 0.00 0 +phiX174:4395 0 0.00 0 +phiX174:4396 0 0.00 0 +phiX174:4397 0 0.00 0 +phiX174:4398 0 0.00 0 +phiX174:4399 0 0.00 0 +phiX174:4400 0 0.00 0 +phiX174:4401 0 0.00 0 +phiX174:4402 0 0.00 0 +phiX174:4403 0 0.00 0 +phiX174:4404 0 0.00 0 +phiX174:4405 0 0.00 0 +phiX174:4406 0 0.00 0 +phiX174:4407 0 0.00 0 +phiX174:4408 0 0.00 0 +phiX174:4409 0 0.00 0 +phiX174:4410 0 0.00 0 +phiX174:4411 0 0.00 0 +phiX174:4412 0 0.00 0 +phiX174:4413 0 0.00 0 +phiX174:4414 0 0.00 0 +phiX174:4415 0 0.00 0 +phiX174:4416 0 0.00 0 +phiX174:4417 0 0.00 0 +phiX174:4418 0 0.00 0 +phiX174:4419 0 0.00 0 +phiX174:4420 0 0.00 0 +phiX174:4421 0 0.00 0 +phiX174:4422 0 0.00 0 +phiX174:4423 0 0.00 0 +phiX174:4424 0 0.00 0 +phiX174:4425 0 0.00 0 +phiX174:4426 0 0.00 0 +phiX174:4427 0 0.00 0 +phiX174:4428 0 0.00 0 +phiX174:4429 0 0.00 0 +phiX174:4430 0 0.00 0 +phiX174:4431 0 0.00 0 +phiX174:4432 0 0.00 0 +phiX174:4433 0 0.00 0 +phiX174:4434 0 0.00 0 +phiX174:4435 0 0.00 0 +phiX174:4436 0 0.00 0 +phiX174:4437 0 0.00 0 +phiX174:4438 0 0.00 0 +phiX174:4439 0 0.00 0 +phiX174:4440 0 0.00 0 +phiX174:4441 0 0.00 0 +phiX174:4442 0 0.00 0 +phiX174:4443 0 0.00 0 +phiX174:4444 0 0.00 0 +phiX174:4445 0 0.00 0 +phiX174:4446 0 0.00 0 +phiX174:4447 0 0.00 0 +phiX174:4448 0 0.00 0 +phiX174:4449 0 0.00 0 +phiX174:4450 0 0.00 0 +phiX174:4451 0 0.00 0 +phiX174:4452 0 0.00 0 +phiX174:4453 0 0.00 0 +phiX174:4454 0 0.00 0 +phiX174:4455 0 0.00 0 +phiX174:4456 0 0.00 0 +phiX174:4457 0 0.00 0 +phiX174:4458 0 0.00 0 +phiX174:4459 0 0.00 0 +phiX174:4460 0 0.00 0 +phiX174:4461 0 0.00 0 +phiX174:4462 0 0.00 0 +phiX174:4463 0 0.00 0 +phiX174:4464 0 0.00 0 +phiX174:4465 0 0.00 0 +phiX174:4466 0 0.00 0 +phiX174:4467 0 0.00 0 +phiX174:4468 0 0.00 0 +phiX174:4469 0 0.00 0 +phiX174:4470 0 0.00 0 +phiX174:4471 0 0.00 0 +phiX174:4472 0 0.00 0 +phiX174:4473 0 0.00 0 +phiX174:4474 0 0.00 0 +phiX174:4475 0 0.00 0 +phiX174:4476 0 0.00 0 +phiX174:4477 0 0.00 0 +phiX174:4478 0 0.00 0 +phiX174:4479 0 0.00 0 +phiX174:4480 0 0.00 0 +phiX174:4481 0 0.00 0 +phiX174:4482 0 0.00 0 +phiX174:4483 0 0.00 0 +phiX174:4484 0 0.00 0 +phiX174:4485 0 0.00 0 +phiX174:4486 0 0.00 0 +phiX174:4487 0 0.00 0 +phiX174:4488 0 0.00 0 +phiX174:4489 0 0.00 0 +phiX174:4490 0 0.00 0 +phiX174:4491 0 0.00 0 +phiX174:4492 0 0.00 0 +phiX174:4493 0 0.00 0 +phiX174:4494 0 0.00 0 +phiX174:4495 0 0.00 0 +phiX174:4496 0 0.00 0 +phiX174:4497 0 0.00 0 +phiX174:4498 0 0.00 0 +phiX174:4499 0 0.00 0 +phiX174:4500 0 0.00 0 +phiX174:4501 0 0.00 0 +phiX174:4502 0 0.00 0 +phiX174:4503 0 0.00 0 +phiX174:4504 0 0.00 0 +phiX174:4505 0 0.00 0 +phiX174:4506 0 0.00 0 +phiX174:4507 0 0.00 0 +phiX174:4508 0 0.00 0 +phiX174:4509 0 0.00 0 +phiX174:4510 0 0.00 0 +phiX174:4511 0 0.00 0 +phiX174:4512 0 0.00 0 +phiX174:4513 0 0.00 0 +phiX174:4514 0 0.00 0 +phiX174:4515 0 0.00 0 +phiX174:4516 0 0.00 0 +phiX174:4517 0 0.00 0 +phiX174:4518 0 0.00 0 +phiX174:4519 0 0.00 0 +phiX174:4520 0 0.00 0 +phiX174:4521 0 0.00 0 +phiX174:4522 0 0.00 0 +phiX174:4523 0 0.00 0 +phiX174:4524 0 0.00 0 +phiX174:4525 0 0.00 0 +phiX174:4526 0 0.00 0 +phiX174:4527 0 0.00 0 +phiX174:4528 0 0.00 0 +phiX174:4529 0 0.00 0 +phiX174:4530 0 0.00 0 +phiX174:4531 0 0.00 0 +phiX174:4532 0 0.00 0 +phiX174:4533 0 0.00 0 +phiX174:4534 0 0.00 0 +phiX174:4535 0 0.00 0 +phiX174:4536 0 0.00 0 +phiX174:4537 0 0.00 0 +phiX174:4538 0 0.00 0 +phiX174:4539 0 0.00 0 +phiX174:4540 0 0.00 0 +phiX174:4541 0 0.00 0 +phiX174:4542 0 0.00 0 +phiX174:4543 0 0.00 0 +phiX174:4544 0 0.00 0 +phiX174:4545 0 0.00 0 +phiX174:4546 0 0.00 0 +phiX174:4547 0 0.00 0 +phiX174:4548 0 0.00 0 +phiX174:4549 0 0.00 0 +phiX174:4550 0 0.00 0 +phiX174:4551 0 0.00 0 +phiX174:4552 0 0.00 0 +phiX174:4553 0 0.00 0 +phiX174:4554 0 0.00 0 +phiX174:4555 0 0.00 0 +phiX174:4556 0 0.00 0 +phiX174:4557 0 0.00 0 +phiX174:4558 0 0.00 0 +phiX174:4559 0 0.00 0 +phiX174:4560 0 0.00 0 +phiX174:4561 0 0.00 0 +phiX174:4562 0 0.00 0 +phiX174:4563 0 0.00 0 +phiX174:4564 0 0.00 0 +phiX174:4565 0 0.00 0 +phiX174:4566 0 0.00 0 +phiX174:4567 0 0.00 0 +phiX174:4568 0 0.00 0 +phiX174:4569 0 0.00 0 +phiX174:4570 0 0.00 0 +phiX174:4571 0 0.00 0 +phiX174:4572 0 0.00 0 +phiX174:4573 0 0.00 0 +phiX174:4574 0 0.00 0 +phiX174:4575 0 0.00 0 +phiX174:4576 0 0.00 0 +phiX174:4577 0 0.00 0 +phiX174:4578 0 0.00 0 +phiX174:4579 0 0.00 0 +phiX174:4580 0 0.00 0 +phiX174:4581 0 0.00 0 +phiX174:4582 0 0.00 0 +phiX174:4583 0 0.00 0 +phiX174:4584 0 0.00 0 +phiX174:4585 0 0.00 0 +phiX174:4586 0 0.00 0 +phiX174:4587 0 0.00 0 +phiX174:4588 0 0.00 0 +phiX174:4589 0 0.00 0 +phiX174:4590 0 0.00 0 +phiX174:4591 0 0.00 0 +phiX174:4592 0 0.00 0 +phiX174:4593 0 0.00 0 +phiX174:4594 0 0.00 0 +phiX174:4595 0 0.00 0 +phiX174:4596 0 0.00 0 +phiX174:4597 0 0.00 0 +phiX174:4598 0 0.00 0 +phiX174:4599 0 0.00 0 +phiX174:4600 0 0.00 0 +phiX174:4601 0 0.00 0 +phiX174:4602 0 0.00 0 +phiX174:4603 0 0.00 0 +phiX174:4604 0 0.00 0 +phiX174:4605 0 0.00 0 +phiX174:4606 0 0.00 0 +phiX174:4607 0 0.00 0 +phiX174:4608 0 0.00 0 +phiX174:4609 0 0.00 0 +phiX174:4610 0 0.00 0 +phiX174:4611 0 0.00 0 +phiX174:4612 0 0.00 0 +phiX174:4613 0 0.00 0 +phiX174:4614 0 0.00 0 +phiX174:4615 0 0.00 0 +phiX174:4616 0 0.00 0 +phiX174:4617 0 0.00 0 +phiX174:4618 0 0.00 0 +phiX174:4619 0 0.00 0 +phiX174:4620 0 0.00 0 +phiX174:4621 0 0.00 0 +phiX174:4622 0 0.00 0 +phiX174:4623 0 0.00 0 +phiX174:4624 0 0.00 0 +phiX174:4625 0 0.00 0 +phiX174:4626 0 0.00 0 +phiX174:4627 0 0.00 0 +phiX174:4628 0 0.00 0 +phiX174:4629 0 0.00 0 +phiX174:4630 0 0.00 0 +phiX174:4631 0 0.00 0 +phiX174:4632 0 0.00 0 +phiX174:4633 0 0.00 0 +phiX174:4634 0 0.00 0 +phiX174:4635 0 0.00 0 +phiX174:4636 0 0.00 0 +phiX174:4637 0 0.00 0 +phiX174:4638 0 0.00 0 +phiX174:4639 0 0.00 0 +phiX174:4640 0 0.00 0 +phiX174:4641 0 0.00 0 +phiX174:4642 0 0.00 0 +phiX174:4643 0 0.00 0 +phiX174:4644 0 0.00 0 +phiX174:4645 0 0.00 0 +phiX174:4646 0 0.00 0 +phiX174:4647 0 0.00 0 +phiX174:4648 0 0.00 0 +phiX174:4649 0 0.00 0 +phiX174:4650 0 0.00 0 +phiX174:4651 0 0.00 0 +phiX174:4652 0 0.00 0 +phiX174:4653 0 0.00 0 +phiX174:4654 0 0.00 0 +phiX174:4655 0 0.00 0 +phiX174:4656 0 0.00 0 +phiX174:4657 0 0.00 0 +phiX174:4658 0 0.00 0 +phiX174:4659 0 0.00 0 +phiX174:4660 0 0.00 0 +phiX174:4661 0 0.00 0 +phiX174:4662 0 0.00 0 +phiX174:4663 0 0.00 0 +phiX174:4664 0 0.00 0 +phiX174:4665 0 0.00 0 +phiX174:4666 0 0.00 0 +phiX174:4667 0 0.00 0 +phiX174:4668 0 0.00 0 +phiX174:4669 0 0.00 0 +phiX174:4670 0 0.00 0 +phiX174:4671 0 0.00 0 +phiX174:4672 0 0.00 0 +phiX174:4673 0 0.00 0 +phiX174:4674 0 0.00 0 +phiX174:4675 0 0.00 0 +phiX174:4676 0 0.00 0 +phiX174:4677 0 0.00 0 +phiX174:4678 0 0.00 0 +phiX174:4679 0 0.00 0 +phiX174:4680 0 0.00 0 +phiX174:4681 0 0.00 0 +phiX174:4682 0 0.00 0 +phiX174:4683 0 0.00 0 +phiX174:4684 0 0.00 0 +phiX174:4685 0 0.00 0 +phiX174:4686 0 0.00 0 +phiX174:4687 0 0.00 0 +phiX174:4688 0 0.00 0 +phiX174:4689 0 0.00 0 +phiX174:4690 0 0.00 0 +phiX174:4691 0 0.00 0 +phiX174:4692 0 0.00 0 +phiX174:4693 0 0.00 0 +phiX174:4694 0 0.00 0 +phiX174:4695 0 0.00 0 +phiX174:4696 0 0.00 0 +phiX174:4697 0 0.00 0 +phiX174:4698 0 0.00 0 +phiX174:4699 0 0.00 0 +phiX174:4700 0 0.00 0 +phiX174:4701 0 0.00 0 +phiX174:4702 0 0.00 0 +phiX174:4703 0 0.00 0 +phiX174:4704 0 0.00 0 +phiX174:4705 0 0.00 0 +phiX174:4706 0 0.00 0 +phiX174:4707 0 0.00 0 +phiX174:4708 0 0.00 0 +phiX174:4709 0 0.00 0 +phiX174:4710 0 0.00 0 +phiX174:4711 0 0.00 0 +phiX174:4712 0 0.00 0 +phiX174:4713 0 0.00 0 +phiX174:4714 0 0.00 0 +phiX174:4715 0 0.00 0 +phiX174:4716 0 0.00 0 +phiX174:4717 0 0.00 0 +phiX174:4718 0 0.00 0 +phiX174:4719 0 0.00 0 +phiX174:4720 0 0.00 0 +phiX174:4721 0 0.00 0 +phiX174:4722 0 0.00 0 +phiX174:4723 0 0.00 0 +phiX174:4724 0 0.00 0 +phiX174:4725 0 0.00 0 +phiX174:4726 0 0.00 0 +phiX174:4727 0 0.00 0 +phiX174:4728 0 0.00 0 +phiX174:4729 0 0.00 0 +phiX174:4730 0 0.00 0 +phiX174:4731 0 0.00 0 +phiX174:4732 0 0.00 0 +phiX174:4733 0 0.00 0 +phiX174:4734 0 0.00 0 +phiX174:4735 0 0.00 0 +phiX174:4736 0 0.00 0 +phiX174:4737 0 0.00 0 +phiX174:4738 0 0.00 0 +phiX174:4739 0 0.00 0 +phiX174:4740 0 0.00 0 +phiX174:4741 0 0.00 0 +phiX174:4742 0 0.00 0 +phiX174:4743 0 0.00 0 +phiX174:4744 0 0.00 0 +phiX174:4745 0 0.00 0 +phiX174:4746 0 0.00 0 +phiX174:4747 0 0.00 0 +phiX174:4748 0 0.00 0 +phiX174:4749 0 0.00 0 +phiX174:4750 0 0.00 0 +phiX174:4751 0 0.00 0 +phiX174:4752 0 0.00 0 +phiX174:4753 0 0.00 0 +phiX174:4754 0 0.00 0 +phiX174:4755 0 0.00 0 +phiX174:4756 0 0.00 0 +phiX174:4757 0 0.00 0 +phiX174:4758 0 0.00 0 +phiX174:4759 0 0.00 0 +phiX174:4760 0 0.00 0 +phiX174:4761 0 0.00 0 +phiX174:4762 0 0.00 0 +phiX174:4763 0 0.00 0 +phiX174:4764 0 0.00 0 +phiX174:4765 0 0.00 0 +phiX174:4766 0 0.00 0 +phiX174:4767 0 0.00 0 +phiX174:4768 0 0.00 0 +phiX174:4769 0 0.00 0 +phiX174:4770 0 0.00 0 +phiX174:4771 0 0.00 0 +phiX174:4772 0 0.00 0 +phiX174:4773 0 0.00 0 +phiX174:4774 0 0.00 0 +phiX174:4775 0 0.00 0 +phiX174:4776 0 0.00 0 +phiX174:4777 0 0.00 0 +phiX174:4778 0 0.00 0 +phiX174:4779 0 0.00 0 +phiX174:4780 0 0.00 0 +phiX174:4781 0 0.00 0 +phiX174:4782 0 0.00 0 +phiX174:4783 0 0.00 0 +phiX174:4784 0 0.00 0 +phiX174:4785 0 0.00 0 +phiX174:4786 0 0.00 0 +phiX174:4787 0 0.00 0 +phiX174:4788 0 0.00 0 +phiX174:4789 0 0.00 0 +phiX174:4790 0 0.00 0 +phiX174:4791 0 0.00 0 +phiX174:4792 0 0.00 0 +phiX174:4793 0 0.00 0 +phiX174:4794 0 0.00 0 +phiX174:4795 0 0.00 0 +phiX174:4796 0 0.00 0 +phiX174:4797 0 0.00 0 +phiX174:4798 0 0.00 0 +phiX174:4799 0 0.00 0 +phiX174:4800 0 0.00 0 +phiX174:4801 0 0.00 0 +phiX174:4802 0 0.00 0 +phiX174:4803 0 0.00 0 +phiX174:4804 0 0.00 0 +phiX174:4805 0 0.00 0 +phiX174:4806 0 0.00 0 +phiX174:4807 0 0.00 0 +phiX174:4808 0 0.00 0 +phiX174:4809 0 0.00 0 +phiX174:4810 0 0.00 0 +phiX174:4811 0 0.00 0 +phiX174:4812 0 0.00 0 +phiX174:4813 0 0.00 0 +phiX174:4814 0 0.00 0 +phiX174:4815 0 0.00 0 +phiX174:4816 0 0.00 0 +phiX174:4817 0 0.00 0 +phiX174:4818 0 0.00 0 +phiX174:4819 0 0.00 0 +phiX174:4820 0 0.00 0 +phiX174:4821 0 0.00 0 +phiX174:4822 0 0.00 0 +phiX174:4823 0 0.00 0 +phiX174:4824 0 0.00 0 +phiX174:4825 0 0.00 0 +phiX174:4826 0 0.00 0 +phiX174:4827 0 0.00 0 +phiX174:4828 0 0.00 0 +phiX174:4829 0 0.00 0 +phiX174:4830 0 0.00 0 +phiX174:4831 0 0.00 0 +phiX174:4832 0 0.00 0 +phiX174:4833 0 0.00 0 +phiX174:4834 0 0.00 0 +phiX174:4835 0 0.00 0 +phiX174:4836 0 0.00 0 +phiX174:4837 0 0.00 0 +phiX174:4838 0 0.00 0 +phiX174:4839 0 0.00 0 +phiX174:4840 0 0.00 0 +phiX174:4841 0 0.00 0 +phiX174:4842 0 0.00 0 +phiX174:4843 0 0.00 0 +phiX174:4844 0 0.00 0 +phiX174:4845 0 0.00 0 +phiX174:4846 0 0.00 0 +phiX174:4847 0 0.00 0 +phiX174:4848 0 0.00 0 +phiX174:4849 0 0.00 0 +phiX174:4850 0 0.00 0 +phiX174:4851 0 0.00 0 +phiX174:4852 0 0.00 0 +phiX174:4853 0 0.00 0 +phiX174:4854 0 0.00 0 +phiX174:4855 0 0.00 0 +phiX174:4856 0 0.00 0 +phiX174:4857 0 0.00 0 +phiX174:4858 0 0.00 0 +phiX174:4859 0 0.00 0 +phiX174:4860 0 0.00 0 +phiX174:4861 0 0.00 0 +phiX174:4862 0 0.00 0 +phiX174:4863 0 0.00 0 +phiX174:4864 0 0.00 0 +phiX174:4865 0 0.00 0 +phiX174:4866 0 0.00 0 +phiX174:4867 0 0.00 0 +phiX174:4868 0 0.00 0 +phiX174:4869 0 0.00 0 +phiX174:4870 0 0.00 0 +phiX174:4871 0 0.00 0 +phiX174:4872 0 0.00 0 +phiX174:4873 0 0.00 0 +phiX174:4874 0 0.00 0 +phiX174:4875 0 0.00 0 +phiX174:4876 0 0.00 0 +phiX174:4877 0 0.00 0 +phiX174:4878 0 0.00 0 +phiX174:4879 0 0.00 0 +phiX174:4880 0 0.00 0 +phiX174:4881 0 0.00 0 +phiX174:4882 0 0.00 0 +phiX174:4883 0 0.00 0 +phiX174:4884 0 0.00 0 +phiX174:4885 0 0.00 0 +phiX174:4886 0 0.00 0 +phiX174:4887 0 0.00 0 +phiX174:4888 0 0.00 0 +phiX174:4889 0 0.00 0 +phiX174:4890 0 0.00 0 +phiX174:4891 0 0.00 0 +phiX174:4892 0 0.00 0 +phiX174:4893 0 0.00 0 +phiX174:4894 0 0.00 0 +phiX174:4895 0 0.00 0 +phiX174:4896 0 0.00 0 +phiX174:4897 0 0.00 0 +phiX174:4898 0 0.00 0 +phiX174:4899 0 0.00 0 +phiX174:4900 0 0.00 0 +phiX174:4901 0 0.00 0 +phiX174:4902 0 0.00 0 +phiX174:4903 0 0.00 0 +phiX174:4904 0 0.00 0 +phiX174:4905 0 0.00 0 +phiX174:4906 0 0.00 0 +phiX174:4907 0 0.00 0 +phiX174:4908 0 0.00 0 +phiX174:4909 0 0.00 0 +phiX174:4910 0 0.00 0 +phiX174:4911 0 0.00 0 +phiX174:4912 0 0.00 0 +phiX174:4913 0 0.00 0 +phiX174:4914 0 0.00 0 +phiX174:4915 0 0.00 0 +phiX174:4916 0 0.00 0 +phiX174:4917 0 0.00 0 +phiX174:4918 0 0.00 0 +phiX174:4919 0 0.00 0 +phiX174:4920 0 0.00 0 +phiX174:4921 0 0.00 0 +phiX174:4922 0 0.00 0 +phiX174:4923 0 0.00 0 +phiX174:4924 0 0.00 0 +phiX174:4925 0 0.00 0 +phiX174:4926 0 0.00 0 +phiX174:4927 0 0.00 0 +phiX174:4928 0 0.00 0 +phiX174:4929 0 0.00 0 +phiX174:4930 0 0.00 0 +phiX174:4931 0 0.00 0 +phiX174:4932 0 0.00 0 +phiX174:4933 0 0.00 0 +phiX174:4934 0 0.00 0 +phiX174:4935 0 0.00 0 +phiX174:4936 0 0.00 0 +phiX174:4937 0 0.00 0 +phiX174:4938 0 0.00 0 +phiX174:4939 0 0.00 0 +phiX174:4940 0 0.00 0 +phiX174:4941 0 0.00 0 +phiX174:4942 0 0.00 0 +phiX174:4943 0 0.00 0 +phiX174:4944 0 0.00 0 +phiX174:4945 0 0.00 0 +phiX174:4946 0 0.00 0 +phiX174:4947 0 0.00 0 +phiX174:4948 0 0.00 0 +phiX174:4949 0 0.00 0 +phiX174:4950 0 0.00 0 +phiX174:4951 0 0.00 0 +phiX174:4952 0 0.00 0 +phiX174:4953 0 0.00 0 +phiX174:4954 0 0.00 0 +phiX174:4955 0 0.00 0 +phiX174:4956 0 0.00 0 +phiX174:4957 0 0.00 0 +phiX174:4958 0 0.00 0 +phiX174:4959 0 0.00 0 +phiX174:4960 0 0.00 0 +phiX174:4961 0 0.00 0 +phiX174:4962 0 0.00 0 +phiX174:4963 0 0.00 0 +phiX174:4964 0 0.00 0 +phiX174:4965 0 0.00 0 +phiX174:4966 0 0.00 0 +phiX174:4967 0 0.00 0 +phiX174:4968 0 0.00 0 +phiX174:4969 0 0.00 0 +phiX174:4970 0 0.00 0 +phiX174:4971 0 0.00 0 +phiX174:4972 0 0.00 0 +phiX174:4973 0 0.00 0 +phiX174:4974 0 0.00 0 +phiX174:4975 0 0.00 0 +phiX174:4976 0 0.00 0 +phiX174:4977 0 0.00 0 +phiX174:4978 0 0.00 0 +phiX174:4979 0 0.00 0 +phiX174:4980 0 0.00 0 +phiX174:4981 0 0.00 0 +phiX174:4982 0 0.00 0 +phiX174:4983 0 0.00 0 +phiX174:4984 0 0.00 0 +phiX174:4985 0 0.00 0 +phiX174:4986 0 0.00 0 +phiX174:4987 0 0.00 0 +phiX174:4988 0 0.00 0 +phiX174:4989 0 0.00 0 +phiX174:4990 0 0.00 0 +phiX174:4991 0 0.00 0 +phiX174:4992 0 0.00 0 +phiX174:4993 0 0.00 0 +phiX174:4994 0 0.00 0 +phiX174:4995 0 0.00 0 +phiX174:4996 0 0.00 0 +phiX174:4997 0 0.00 0 +phiX174:4998 0 0.00 0 +phiX174:4999 0 0.00 0 +phiX174:5000 0 0.00 0 +phiX174:5001 0 0.00 0 +phiX174:5002 0 0.00 0 +phiX174:5003 0 0.00 0 +phiX174:5004 0 0.00 0 +phiX174:5005 0 0.00 0 +phiX174:5006 0 0.00 0 +phiX174:5007 0 0.00 0 +phiX174:5008 0 0.00 0 +phiX174:5009 0 0.00 0 +phiX174:5010 0 0.00 0 +phiX174:5011 0 0.00 0 +phiX174:5012 0 0.00 0 +phiX174:5013 0 0.00 0 +phiX174:5014 0 0.00 0 +phiX174:5015 0 0.00 0 +phiX174:5016 0 0.00 0 +phiX174:5017 0 0.00 0 +phiX174:5018 0 0.00 0 +phiX174:5019 0 0.00 0 +phiX174:5020 0 0.00 0 +phiX174:5021 0 0.00 0 +phiX174:5022 0 0.00 0 +phiX174:5023 0 0.00 0 +phiX174:5024 0 0.00 0 +phiX174:5025 0 0.00 0 +phiX174:5026 0 0.00 0 +phiX174:5027 0 0.00 0 +phiX174:5028 0 0.00 0 +phiX174:5029 0 0.00 0 +phiX174:5030 0 0.00 0 +phiX174:5031 0 0.00 0 +phiX174:5032 0 0.00 0 +phiX174:5033 0 0.00 0 +phiX174:5034 0 0.00 0 +phiX174:5035 0 0.00 0 +phiX174:5036 0 0.00 0 +phiX174:5037 0 0.00 0 +phiX174:5038 0 0.00 0 +phiX174:5039 0 0.00 0 +phiX174:5040 0 0.00 0 +phiX174:5041 0 0.00 0 +phiX174:5042 0 0.00 0 +phiX174:5043 0 0.00 0 +phiX174:5044 0 0.00 0 +phiX174:5045 0 0.00 0 +phiX174:5046 0 0.00 0 +phiX174:5047 0 0.00 0 +phiX174:5048 0 0.00 0 +phiX174:5049 0 0.00 0 +phiX174:5050 0 0.00 0 +phiX174:5051 0 0.00 0 +phiX174:5052 0 0.00 0 +phiX174:5053 0 0.00 0 +phiX174:5054 0 0.00 0 +phiX174:5055 0 0.00 0 +phiX174:5056 0 0.00 0 +phiX174:5057 0 0.00 0 +phiX174:5058 0 0.00 0 +phiX174:5059 0 0.00 0 +phiX174:5060 0 0.00 0 +phiX174:5061 0 0.00 0 +phiX174:5062 0 0.00 0 +phiX174:5063 0 0.00 0 +phiX174:5064 0 0.00 0 +phiX174:5065 0 0.00 0 +phiX174:5066 0 0.00 0 +phiX174:5067 0 0.00 0 +phiX174:5068 0 0.00 0 +phiX174:5069 0 0.00 0 +phiX174:5070 0 0.00 0 +phiX174:5071 0 0.00 0 +phiX174:5072 0 0.00 0 +phiX174:5073 0 0.00 0 +phiX174:5074 0 0.00 0 +phiX174:5075 0 0.00 0 +phiX174:5076 0 0.00 0 +phiX174:5077 0 0.00 0 +phiX174:5078 0 0.00 0 +phiX174:5079 0 0.00 0 +phiX174:5080 0 0.00 0 +phiX174:5081 0 0.00 0 +phiX174:5082 0 0.00 0 +phiX174:5083 0 0.00 0 +phiX174:5084 0 0.00 0 +phiX174:5085 0 0.00 0 +phiX174:5086 0 0.00 0 +phiX174:5087 0 0.00 0 +phiX174:5088 0 0.00 0 +phiX174:5089 0 0.00 0 +phiX174:5090 0 0.00 0 +phiX174:5091 0 0.00 0 +phiX174:5092 0 0.00 0 +phiX174:5093 0 0.00 0 +phiX174:5094 0 0.00 0 +phiX174:5095 0 0.00 0 +phiX174:5096 0 0.00 0 +phiX174:5097 0 0.00 0 +phiX174:5098 0 0.00 0 +phiX174:5099 0 0.00 0 +phiX174:5100 0 0.00 0 +phiX174:5101 0 0.00 0 +phiX174:5102 0 0.00 0 +phiX174:5103 0 0.00 0 +phiX174:5104 0 0.00 0 +phiX174:5105 0 0.00 0 +phiX174:5106 0 0.00 0 +phiX174:5107 0 0.00 0 +phiX174:5108 0 0.00 0 +phiX174:5109 0 0.00 0 +phiX174:5110 0 0.00 0 +phiX174:5111 0 0.00 0 +phiX174:5112 0 0.00 0 +phiX174:5113 0 0.00 0 +phiX174:5114 0 0.00 0 +phiX174:5115 0 0.00 0 +phiX174:5116 0 0.00 0 +phiX174:5117 0 0.00 0 +phiX174:5118 0 0.00 0 +phiX174:5119 0 0.00 0 +phiX174:5120 0 0.00 0 +phiX174:5121 0 0.00 0 +phiX174:5122 0 0.00 0 +phiX174:5123 0 0.00 0 +phiX174:5124 0 0.00 0 +phiX174:5125 0 0.00 0 +phiX174:5126 0 0.00 0 +phiX174:5127 0 0.00 0 +phiX174:5128 0 0.00 0 +phiX174:5129 0 0.00 0 +phiX174:5130 0 0.00 0 +phiX174:5131 0 0.00 0 +phiX174:5132 0 0.00 0 +phiX174:5133 0 0.00 0 +phiX174:5134 0 0.00 0 +phiX174:5135 0 0.00 0 +phiX174:5136 0 0.00 0 +phiX174:5137 0 0.00 0 +phiX174:5138 0 0.00 0 +phiX174:5139 0 0.00 0 +phiX174:5140 0 0.00 0 +phiX174:5141 0 0.00 0 +phiX174:5142 0 0.00 0 +phiX174:5143 0 0.00 0 +phiX174:5144 0 0.00 0 +phiX174:5145 0 0.00 0 +phiX174:5146 0 0.00 0 +phiX174:5147 0 0.00 0 +phiX174:5148 0 0.00 0 +phiX174:5149 0 0.00 0 +phiX174:5150 0 0.00 0 +phiX174:5151 0 0.00 0 +phiX174:5152 0 0.00 0 +phiX174:5153 0 0.00 0 +phiX174:5154 0 0.00 0 +phiX174:5155 0 0.00 0 +phiX174:5156 0 0.00 0 +phiX174:5157 0 0.00 0 +phiX174:5158 0 0.00 0 +phiX174:5159 0 0.00 0 +phiX174:5160 0 0.00 0 +phiX174:5161 0 0.00 0 +phiX174:5162 0 0.00 0 +phiX174:5163 0 0.00 0 +phiX174:5164 0 0.00 0 +phiX174:5165 0 0.00 0 +phiX174:5166 0 0.00 0 +phiX174:5167 0 0.00 0 +phiX174:5168 0 0.00 0 +phiX174:5169 0 0.00 0 +phiX174:5170 0 0.00 0 +phiX174:5171 0 0.00 0 +phiX174:5172 0 0.00 0 +phiX174:5173 0 0.00 0 +phiX174:5174 0 0.00 0 +phiX174:5175 0 0.00 0 +phiX174:5176 0 0.00 0 +phiX174:5177 0 0.00 0 +phiX174:5178 0 0.00 0 +phiX174:5179 0 0.00 0 +phiX174:5180 0 0.00 0 +phiX174:5181 0 0.00 0 +phiX174:5182 0 0.00 0 +phiX174:5183 0 0.00 0 +phiX174:5184 0 0.00 0 +phiX174:5185 0 0.00 0 +phiX174:5186 0 0.00 0 +phiX174:5187 0 0.00 0 +phiX174:5188 0 0.00 0 +phiX174:5189 0 0.00 0 +phiX174:5190 0 0.00 0 +phiX174:5191 0 0.00 0 +phiX174:5192 0 0.00 0 +phiX174:5193 0 0.00 0 +phiX174:5194 0 0.00 0 +phiX174:5195 0 0.00 0 +phiX174:5196 0 0.00 0 +phiX174:5197 0 0.00 0 +phiX174:5198 0 0.00 0 +phiX174:5199 0 0.00 0 +phiX174:5200 0 0.00 0 +phiX174:5201 0 0.00 0 +phiX174:5202 0 0.00 0 +phiX174:5203 0 0.00 0 +phiX174:5204 0 0.00 0 +phiX174:5205 0 0.00 0 +phiX174:5206 0 0.00 0 +phiX174:5207 0 0.00 0 +phiX174:5208 0 0.00 0 +phiX174:5209 0 0.00 0 +phiX174:5210 0 0.00 0 +phiX174:5211 0 0.00 0 +phiX174:5212 0 0.00 0 +phiX174:5213 0 0.00 0 +phiX174:5214 0 0.00 0 +phiX174:5215 0 0.00 0 +phiX174:5216 0 0.00 0 +phiX174:5217 0 0.00 0 +phiX174:5218 0 0.00 0 +phiX174:5219 0 0.00 0 +phiX174:5220 0 0.00 0 +phiX174:5221 0 0.00 0 +phiX174:5222 0 0.00 0 +phiX174:5223 0 0.00 0 +phiX174:5224 0 0.00 0 +phiX174:5225 0 0.00 0 +phiX174:5226 0 0.00 0 +phiX174:5227 0 0.00 0 +phiX174:5228 0 0.00 0 +phiX174:5229 0 0.00 0 +phiX174:5230 0 0.00 0 +phiX174:5231 0 0.00 0 +phiX174:5232 0 0.00 0 +phiX174:5233 0 0.00 0 +phiX174:5234 0 0.00 0 +phiX174:5235 0 0.00 0 +phiX174:5236 0 0.00 0 +phiX174:5237 0 0.00 0 +phiX174:5238 0 0.00 0 +phiX174:5239 0 0.00 0 +phiX174:5240 0 0.00 0 +phiX174:5241 0 0.00 0 +phiX174:5242 0 0.00 0 +phiX174:5243 0 0.00 0 +phiX174:5244 0 0.00 0 +phiX174:5245 0 0.00 0 +phiX174:5246 0 0.00 0 +phiX174:5247 0 0.00 0 +phiX174:5248 0 0.00 0 +phiX174:5249 0 0.00 0 +phiX174:5250 0 0.00 0 +phiX174:5251 0 0.00 0 +phiX174:5252 0 0.00 0 +phiX174:5253 0 0.00 0 +phiX174:5254 0 0.00 0 +phiX174:5255 0 0.00 0 +phiX174:5256 0 0.00 0 +phiX174:5257 0 0.00 0 +phiX174:5258 0 0.00 0 +phiX174:5259 0 0.00 0 +phiX174:5260 0 0.00 0 +phiX174:5261 0 0.00 0 +phiX174:5262 0 0.00 0 +phiX174:5263 0 0.00 0 +phiX174:5264 0 0.00 0 +phiX174:5265 0 0.00 0 +phiX174:5266 0 0.00 0 +phiX174:5267 0 0.00 0 +phiX174:5268 0 0.00 0 +phiX174:5269 0 0.00 0 +phiX174:5270 0 0.00 0 +phiX174:5271 0 0.00 0 +phiX174:5272 0 0.00 0 +phiX174:5273 0 0.00 0 +phiX174:5274 0 0.00 0 +phiX174:5275 0 0.00 0 +phiX174:5276 0 0.00 0 +phiX174:5277 0 0.00 0 +phiX174:5278 0 0.00 0 +phiX174:5279 0 0.00 0 +phiX174:5280 0 0.00 0 +phiX174:5281 0 0.00 0 +phiX174:5282 0 0.00 0 +phiX174:5283 0 0.00 0 +phiX174:5284 0 0.00 0 +phiX174:5285 0 0.00 0 +phiX174:5286 0 0.00 0 +phiX174:5287 0 0.00 0 +phiX174:5288 0 0.00 0 +phiX174:5289 0 0.00 0 +phiX174:5290 0 0.00 0 +phiX174:5291 0 0.00 0 +phiX174:5292 0 0.00 0 +phiX174:5293 0 0.00 0 +phiX174:5294 0 0.00 0 +phiX174:5295 0 0.00 0 +phiX174:5296 0 0.00 0 +phiX174:5297 0 0.00 0 +phiX174:5298 0 0.00 0 +phiX174:5299 0 0.00 0 +phiX174:5300 0 0.00 0 +phiX174:5301 0 0.00 0 +phiX174:5302 0 0.00 0 +phiX174:5303 0 0.00 0 +phiX174:5304 0 0.00 0 +phiX174:5305 0 0.00 0 +phiX174:5306 0 0.00 0 +phiX174:5307 0 0.00 0 +phiX174:5308 0 0.00 0 +phiX174:5309 0 0.00 0 +phiX174:5310 0 0.00 0 +phiX174:5311 0 0.00 0 +phiX174:5312 0 0.00 0 +phiX174:5313 0 0.00 0 +phiX174:5314 0 0.00 0 +phiX174:5315 0 0.00 0 +phiX174:5316 0 0.00 0 +phiX174:5317 0 0.00 0 +phiX174:5318 0 0.00 0 +phiX174:5319 0 0.00 0 +phiX174:5320 0 0.00 0 +phiX174:5321 0 0.00 0 +phiX174:5322 0 0.00 0 +phiX174:5323 0 0.00 0 +phiX174:5324 0 0.00 0 +phiX174:5325 0 0.00 0 +phiX174:5326 0 0.00 0 +phiX174:5327 0 0.00 0 +phiX174:5328 0 0.00 0 +phiX174:5329 0 0.00 0 +phiX174:5330 0 0.00 0 +phiX174:5331 0 0.00 0 +phiX174:5332 0 0.00 0 +phiX174:5333 0 0.00 0 +phiX174:5334 0 0.00 0 +phiX174:5335 0 0.00 0 +phiX174:5336 0 0.00 0 +phiX174:5337 0 0.00 0 +phiX174:5338 0 0.00 0 +phiX174:5339 0 0.00 0 +phiX174:5340 0 0.00 0 +phiX174:5341 0 0.00 0 +phiX174:5342 0 0.00 0 +phiX174:5343 0 0.00 0 +phiX174:5344 0 0.00 0 +phiX174:5345 0 0.00 0 +phiX174:5346 0 0.00 0 +phiX174:5347 0 0.00 0 +phiX174:5348 0 0.00 0 +phiX174:5349 0 0.00 0 +phiX174:5350 0 0.00 0 +phiX174:5351 0 0.00 0 +phiX174:5352 0 0.00 0 +phiX174:5353 0 0.00 0 +phiX174:5354 0 0.00 0 +phiX174:5355 0 0.00 0 +phiX174:5356 0 0.00 0 +phiX174:5357 0 0.00 0 +phiX174:5358 0 0.00 0 +phiX174:5359 0 0.00 0 +phiX174:5360 0 0.00 0 +phiX174:5361 0 0.00 0 +phiX174:5362 0 0.00 0 +phiX174:5363 0 0.00 0 +phiX174:5364 0 0.00 0 +phiX174:5365 0 0.00 0 +phiX174:5366 0 0.00 0 +phiX174:5367 0 0.00 0 +phiX174:5368 0 0.00 0 +phiX174:5369 0 0.00 0 +phiX174:5370 0 0.00 0 +phiX174:5371 0 0.00 0 +phiX174:5372 0 0.00 0 +phiX174:5373 0 0.00 0 +phiX174:5374 0 0.00 0 +phiX174:5375 0 0.00 0 +phiX174:5376 0 0.00 0 +phiX174:5377 0 0.00 0 +phiX174:5378 0 0.00 0 +phiX174:5379 0 0.00 0 +phiX174:5380 0 0.00 0 +phiX174:5381 0 0.00 0 +phiX174:5382 0 0.00 0 +phiX174:5383 0 0.00 0 +phiX174:5384 0 0.00 0 +phiX174:5385 0 0.00 0 +phiX174:5386 0 0.00 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_statistics_sample.tabular Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,2 @@ +Source_of_reads from_0_to_1) from_1_to_2) from_2_to_3) from_3_to_4) from_4_to_5) from_5_to_6) from_6_to_7) from_7_to_8) from_8_to_9) from_9_to_10) from_10_to_11) from_11_to_12) from_12_to_13) from_13_to_14) from_14_to_15) from_15_to_16) from_16_to_17) from_17_to_18) from_18_to_19) from_19_to_20) from_20_to_21) from_21_to_22) from_22_to_23) from_23_to_24) from_24_to_25) from_25_to_26) from_26_to_27) from_27_to_28) from_28_to_29) from_29_to_30) from_30_to_31) from_31_to_32) from_32_to_33) from_33_to_34) from_34_to_35) from_35_to_36) from_36_to_37) from_37_to_38) from_38_to_39) from_39_to_40) from_40_to_41) from_41_to_42) from_42_to_43) from_43_to_44) from_44_to_45) from_45_to_46) from_46_to_47) from_47_to_48) from_48_to_49) from_49_to_50) from_50_to_51) from_51_to_52) from_52_to_53) from_53_to_54) from_54_to_55) from_55_to_56) from_56_to_57) from_57_to_58) from_58_to_59) from_59_to_60) from_60_to_61) from_61_to_62) from_62_to_63) from_63_to_64) from_64_to_65) from_65_to_66) from_66_to_67) from_67_to_68) from_68_to_69) from_69_to_70) from_70_to_71) from_71_to_72) from_72_to_73) from_73_to_74) from_74_to_75) from_75_to_76) from_76_to_77) from_77_to_78) from_78_to_79) from_79_to_80) from_80_to_81) from_81_to_82) from_82_to_83) from_83_to_84) from_84_to_85) from_85_to_86) from_86_to_87) from_87_to_88) from_88_to_89) from_89_to_90) from_90_to_91) from_91_to_92) from_92_to_93) from_93_to_94) from_94_to_95) from_95_to_96) from_96_to_97) from_97_to_98) from_98_to_99) from_99_to_100) from_100_to_101) from_101_to_102) from_102_to_103) from_103_to_104) from_104_to_105) from_105_to_106) from_106_to_107) from_107_to_108) from_108_to_109) from_109_to_110) from_110_to_111) from_111_to_112) from_112_to_113) from_113_to_114) from_114_to_115) from_115_to_116) from_116_to_117) from_117_to_118) from_118_to_119) from_119_to_120) from_120_to_121) from_121_to_122) from_122_to_123) from_123_to_124) from_124_to_125) from_125_to_126) from_126_to_127) from_127_to_128) from_128_to_129) from_129_to_130) from_130_to_131) from_131_to_132) from_132_to_133) from_133_to_134) from_134_to_135) from_135_to_136) from_136_to_137) from_137_to_138) from_138_to_139) from_139_to_140) from_140_to_141) from_141_to_142) from_142_to_143) from_143_to_144) from_144_to_145) from_145_to_146) from_146_to_147) from_147_to_148) from_148_to_149) from_149_to_150) from_150_to_151) from_151_to_152) from_152_to_153) from_153_to_154) from_154_to_155) from_155_to_156) from_156_to_157) from_157_to_158) from_158_to_159) from_159_to_160) from_160_to_161) from_161_to_162) from_162_to_163) from_163_to_164) from_164_to_165) from_165_to_166) from_166_to_167) from_167_to_168) from_168_to_169) from_169_to_170) from_170_to_171) from_171_to_172) from_172_to_173) from_173_to_174) from_174_to_175) from_175_to_176) from_176_to_177) from_177_to_178) from_178_to_179) from_179_to_180) from_180_to_181) from_181_to_182) from_182_to_183) from_183_to_184) from_184_to_185) from_185_to_186) from_186_to_187) from_187_to_188) from_188_to_189) from_189_to_190) from_190_to_191) from_191_to_192) from_192_to_193) from_193_to_194) from_194_to_195) from_195_to_196) from_196_to_197) from_197_to_198) from_198_to_199) from_199_to_200) from_200_to_201) from_201_to_202) from_202_to_203) from_203_to_204) from_204_to_205) from_205_to_206) from_206_to_207) from_207_to_208) from_208_to_209) from_209_to_210) from_210_to_211) from_211_to_212) from_212_to_213) from_213_to_214) from_214_to_215) from_215_to_216) from_216_to_217) from_217_to_218) from_218_to_219) from_219_to_220) from_220_to_221) from_221_to_222) from_222_to_223) from_223_to_224) from_224_to_225) from_225_to_226) from_226_to_227) from_227_to_228) from_228_to_229) from_229_to_230) from_230_to_231) from_231_to_232) from_232_to_233) from_233_to_234) from_234_to_235) from_235_to_236) from_236_to_237) from_237_to_238) from_238_to_239) from_239_to_240) from_240_to_241) from_241_to_242) from_242_to_243) from_243_to_244) from_244_to_245) from_245_to_246) from_246_to_247) from_247_to_248) from_248_to_249) from_249_to_250) from_250_to_251) from_251_to_252) from_252_to_253) from_253_to_254) from_254_to_255) from_255_to_256) from_256_to_257) from_257_to_258) from_258_to_259) from_259_to_260) from_260_to_261) from_261_to_262) from_262_to_263) from_263_to_264) from_264_to_265) from_265_to_266) from_266_to_267) from_267_to_268) from_268_to_269) from_269_to_270) from_270_to_271) from_271_to_272) from_272_to_273) from_273_to_274) from_274_to_275) from_275_to_276) from_276_to_277) from_277_to_278) from_278_to_279) from_279_to_280) from_280_to_281) from_281_to_282) from_282_to_283) from_283_to_284) from_284_to_285) from_285_to_286) from_286_to_287) from_287_to_288) from_288_to_289) from_289_to_290) from_290_to_291) from_291_to_292) from_292_to_293) from_293_to_294) from_294_to_295) from_295_to_296) from_296_to_297) from_297_to_298) from_298_to_299) from_299_to_300) from_300_to_301) from_301_to_302) from_302_to_303) from_303_to_304) from_304_to_305) from_305_to_306) from_306_to_307) from_307_to_308) from_308_to_309) from_309_to_310) from_310_to_311) from_311_to_312) from_312_to_313) from_313_to_314) from_314_to_315) from_315_to_316) from_316_to_317) from_317_to_318) from_318_to_319) from_319_to_320) from_320_to_321) from_321_to_322) from_322_to_323) from_323_to_324) from_324_to_325) from_325_to_326) from_326_to_327) from_327_to_328) from_328_to_329) from_329_to_330) from_330_to_331) from_331_to_332) from_332_to_333) from_333_to_334) from_334_to_335) from_335_to_336) from_336_to_337) from_337_to_338) from_338_to_339) from_339_to_340) from_340_to_341) from_341_to_342) from_342_to_343) from_343_to_344) from_344_to_345) from_345_to_346) from_346_to_347) from_347_to_348) from_348_to_349) from_349_to_350) from_350_to_351) from_351_to_352) from_352_to_353) from_353_to_354) from_354_to_355) from_355_to_356) from_356_to_357) from_357_to_358) from_358_to_359) from_359_to_360) from_360_to_361) from_361_to_362) from_362_to_363) from_363_to_364) from_364_to_365) from_365_to_366) from_366_to_367) from_367_to_368) from_368_to_369) from_369_to_370) from_370_to_371) from_371_to_372) from_372_to_373) from_373_to_374) from_374_to_375) from_375_to_376) from_376_to_377) from_377_to_378) from_378_to_379) from_379_to_380) from_380_to_381) from_381_to_382) from_382_to_383) from_383_to_384) from_384_to_385) from_385_to_386) from_386_to_387) from_387_to_388) from_388_to_389) from_389_to_390) from_390_to_391) from_391_to_392) from_392_to_393) from_393_to_394) from_394_to_395) from_395_to_396) from_396_to_397) from_397_to_398) from_398_to_399) from_399_to_400) from_400_to_401) from_401_to_402) from_402_to_403) from_403_to_404) from_404_to_405) from_405_to_406) from_406_to_407) from_407_to_408) from_408_to_409) from_409_to_410) from_410_to_411) from_411_to_412) from_412_to_413) from_413_to_414) from_414_to_415) from_415_to_416) from_416_to_417) from_417_to_418) from_418_to_419) from_419_to_420) from_420_to_421) from_421_to_422) from_422_to_423) from_423_to_424) from_424_to_425) from_425_to_426) from_426_to_427) from_427_to_428) from_428_to_429) from_429_to_430) from_430_to_431) from_431_to_432) from_432_to_433) from_433_to_434) from_434_to_435) from_435_to_436) from_436_to_437) from_437_to_438) from_438_to_439) from_439_to_440) from_440_to_441) from_441_to_442) from_442_to_443) from_443_to_444) from_444_to_445) from_445_to_446) from_446_to_447) from_447_to_448) from_448_to_449) from_449_to_450) from_450_to_451) from_451_to_452) from_452_to_453) from_453_to_454) from_454_to_455) from_455_to_456) from_456_to_457) from_457_to_458) from_458_to_459) from_459_to_460) from_460_to_461) from_461_to_462) from_462_to_463) from_463_to_464) from_464_to_465) from_465_to_466) from_466_to_467) from_467_to_468) from_468_to_469) from_469_to_470) from_470_to_471) from_471_to_472) from_472_to_473) from_473_to_474) from_474_to_475) from_475_to_476) from_476_to_477) from_477_to_478) from_478_to_479) from_479_to_480) from_480_to_481) from_481_to_482) from_482_to_483) from_483_to_484) from_484_to_485) from_485_to_486) from_486_to_487) from_487_to_488) from_488_to_489) from_489_to_490) from_490_to_491) from_491_to_492) from_492_to_493) from_493_to_494) from_494_to_495) from_495_to_496) from_496_to_497) from_497_to_498) from_498_to_499) from_499_to_500) from_500_to_inf +sample_A Fake phiX Sample 5343 2 1 2 1 1 2 2 2 1 29 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_summary_sample.tabular Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,3 @@ +sample_id total mean granular_third_quartile granular_median granular_first_quartile %_bases_above_15 +A Fake phiX Sample 360 0.07 1 1 1 0.0 +Total 360 0.07 N/A N/A N/A
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_indel_realigner/gatk_indel_realigner_out_1.log.contains Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,4 @@ +GenomeAnalysisEngine - Strictness is SILENT +TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING] +TraversalEngine - Total runtime +TraversalEngine - 0 reads were filtered out during traversal out of 10 total (0.00%) \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_print_reads/gatk_print_reads_out_1.log.contains Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,5 @@ +SAMDataSource$SAMReaders - Initializing SAMRecords in serial +TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING] +TraversalEngine - Location processed.reads runtime per.1M.reads completed total.runtime remaining +Walker - [REDUCE RESULT] Traversal result is: org.broadinstitute.sting.gatk.io.stubs.SAMFileWriterStub +TraversalEngine - 0 reads were filtered out during traversal out of 10 total (0.00%)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_realigner_target_creator/gatk_realigner_target_creator_out_1.gatk_interval Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,1 @@ +phiX174:1446-1447
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_realigner_target_creator/gatk_realigner_target_creator_out_1.log.contains Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,4 @@ +GenomeAnalysisEngine - Strictness is SILENT +TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING] +TraversalEngine - Total runtime +TraversalEngine - 0 reads were filtered out during traversal out of 10 total (0.00%) \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.log.contains Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,16 @@ +GenomeAnalysisEngine - Strictness is SILENT +TableRecalibrationWalker - Reading in the data from input csv file... +TableRecalibrationWalker - ...done! +TableRecalibrationWalker - The covariates being used here: +TableRecalibrationWalker - ReadGroupCovariate +TableRecalibrationWalker - QualityScoreCovariate +TableRecalibrationWalker - CycleCovariate +TableRecalibrationWalker - DinucCovariate +TableRecalibrationWalker - HomopolymerCovariate +TableRecalibrationWalker - MinimumNQSCovariate +TableRecalibrationWalker - PositionCovariate +TableRecalibrationWalker - Generating tables of empirical qualities for use in sequential calculation... +TableRecalibrationWalker - ...done! +TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING] +TraversalEngine - Total runtime +TraversalEngine - 0 reads were filtered out during traversal out of 10 total (0.00%) \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_unified_genotyper/gatk_unified_genotyper_out_1.log.contains Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,12 @@ +Program Args: -T UnifiedGenotyper +GenomeAnalysisEngine - Strictness is SILENT +TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING] +TraversalEngine - Location processed.sites runtime per.1M.sites completed total.runtime remaining +UnifiedGenotyper - Visited bases 5387 +UnifiedGenotyper - Callable bases 5344 +UnifiedGenotyper - Confidently called bases 5344 +UnifiedGenotyper - % callable bases of all loci 99.202 +UnifiedGenotyper - % confidently called bases of all loci 99.202 +UnifiedGenotyper - % confidently called bases of callable loci 100.000 +UnifiedGenotyper - Actual calls made 1 +TraversalEngine - Total runtime
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_unified_genotyper/gatk_unified_genotyper_out_1.metrics Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,7 @@ +Visited bases 5387 +Callable bases 5344 +Confidently called bases 5344 +% callable bases of all loci 99.202 +% confidently called bases of all loci 99.202 +% confidently called bases of callable loci 100.000 +Actual calls made 1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_unified_genotyper/gatk_unified_genotyper_out_1.vcf Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,28 @@ +##fileformat=VCFv4.1 +##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed"> +##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth (reads with MQ=255 or with bad mates are filtered)"> +##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality"> +##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype"> +##FORMAT=<ID=PL,Number=G,Type=Integer,Description="Normalized, Phred-scaled likelihoods for genotypes as defined in the VCF specification"> +##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes, for each ALT allele, in the same order as listed"> +##INFO=<ID=AF,Number=A,Type=Float,Description="Allele Frequency, for each ALT allele, in the same order as listed"> +##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes"> +##INFO=<ID=BaseQRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt Vs. Ref base qualities"> +##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP Membership"> +##INFO=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth; some reads may have been filtered"> +##INFO=<ID=DS,Number=0,Type=Flag,Description="Were any of the samples downsampled?"> +##INFO=<ID=Dels,Number=1,Type=Float,Description="Fraction of Reads Containing Spanning Deletions"> +##INFO=<ID=FS,Number=1,Type=Float,Description="Phred-scaled p-value using Fisher's exact test to detect strand bias"> +##INFO=<ID=HRun,Number=1,Type=Integer,Description="Largest Contiguous Homopolymer Run of Variant Allele In Either Direction"> +##INFO=<ID=HaplotypeScore,Number=1,Type=Float,Description="Consistency of the site with at most two segregating haplotypes"> +##INFO=<ID=InbreedingCoeff,Number=1,Type=Float,Description="Inbreeding coefficient as estimated from the genotype likelihoods per-sample when compared against the Hardy-Weinberg expectation"> +##INFO=<ID=MQ,Number=1,Type=Float,Description="RMS Mapping Quality"> +##INFO=<ID=MQ0,Number=1,Type=Integer,Description="Total Mapping Quality Zero Reads"> +##INFO=<ID=MQRankSum,Number=1,Type=Float,Description="Z-score From Wilcoxon rank sum test of Alt vs. Ref read mapping qualities"> +##INFO=<ID=QD,Number=1,Type=Float,Description="Variant Confidence/Quality by Depth"> +##INFO=<ID=ReadPosRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt vs. Ref read position bias"> +##UnifiedGenotyper="analysis_type=UnifiedGenotyper input_file=[/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/gatk_input_0.bam] sample_metadata=[] read_buffer_size=null phone_home=NO_ET read_filter=[] intervals=null excludeIntervals=null reference_sequence=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/gatk_input.fasta rodBind=[] rodToIntervalTrackName=null BTI_merge_rule=UNION nonDeterministicRandomSeed=false downsampling_type=null downsample_to_fraction=null downsample_to_coverage=null baq=OFF baqGapOpenPenalty=40.0 performanceLog=null useOriginalQualities=false defaultBaseQualities=-1 validation_strictness=SILENT unsafe=null num_threads=4 interval_merging=ALL read_group_black_list=null processingTracker=null restartProcessingTracker=false processingTrackerStatusFile=null processingTrackerID=-1 allow_intervals_with_unindexed_bam=false disable_experimental_low_memory_sharding=false logging_level=INFO log_to_file=null help=false genotype_likelihoods_model=BOTH p_nonref_model=EXACT heterozygosity=0.0010 pcr_error_rate=1.0E-4 genotyping_mode=DISCOVERY output_mode=EMIT_ALL_CONFIDENT_SITES standard_min_confidence_threshold_for_calling=0.0 standard_min_confidence_threshold_for_emitting=4.0 computeSLOD=false alleles=(RodBinding name= source=UNBOUND) assume_single_sample_reads=null abort_at_too_much_coverage=-1 min_base_quality_score=17 min_mapping_quality_score=20 max_deletion_fraction=-1.0 min_indel_count_for_genotyping=2 indel_heterozygosity=1.25E-4 indelGapContinuationPenalty=10.0 indelGapOpenPenalty=3.0 indelHaplotypeSize=80 doContextDependentGapPenalties=true getGapPenaltiesFromData=false indel_recal_file=indel.recal_data.csv indelDebug=false dovit=false GSA_PRODUCTION_ONLY=false exactCalculation=LINEAR_EXPERIMENTAL ignoreSNPAlleles=false output_all_callable_bases=false genotype=false dbsnp=(RodBinding name=dbsnp source=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/input_dbsnp_0.vcf) out=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub NO_HEADER=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub sites_only=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub debug_file=null annotation=[]" +##contig=<ID=phiX174,length=5386> +##reference=file:///var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/gatk_input.fasta +#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT A Fake phiX Sample +phiX174 1443 . AC . 0 . DB;DP=10;MQ=37.74;MQ0=0 GT ./.
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_validate_variants/gatk_validate_variants_out_1.log.contains Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,1 @@ +Found 1 records with failures.
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_variant_annotator/gatk_variant_annotator_out_1.log.contains Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,5 @@ +GenomeAnalysisEngine - Strictness is SILENT +TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING] +TraversalEngine - Location processed.sites runtime per.1M.sites completed total.runtime remaining +VariantAnnotator - Processed 1 loci. +TraversalEngine - 0 reads were filtered out during traversal out of 10 total (0.00%)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_variant_annotator/gatk_variant_annotator_out_1.vcf Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,31 @@ +##fileformat=VCFv4.1 +##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed"> +##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth (reads with MQ=255 or with bad mates are filtered)"> +##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality"> +##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype"> +##FORMAT=<ID=PL,Number=G,Type=Integer,Description="Normalized, Phred-scaled likelihoods for genotypes as defined in the VCF specification"> +##INFO=<ID=AB,Number=1,Type=Float,Description="Allele Balance for hets (ref/(ref+alt))"> +##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes, for each ALT allele, in the same order as listed"> +##INFO=<ID=AF,Number=A,Type=Float,Description="Allele Frequency, for each ALT allele, in the same order as listed"> +##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes"> +##INFO=<ID=BaseQRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt Vs. Ref base qualities"> +##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP Membership"> +##INFO=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth; some reads may have been filtered"> +##INFO=<ID=DS,Number=0,Type=Flag,Description="Were any of the samples downsampled?"> +##INFO=<ID=Dels,Number=1,Type=Float,Description="Fraction of Reads Containing Spanning Deletions"> +##INFO=<ID=FS,Number=1,Type=Float,Description="Phred-scaled p-value using Fisher's exact test to detect strand bias"> +##INFO=<ID=HRun,Number=1,Type=Integer,Description="Largest Contiguous Homopolymer Run of Variant Allele In Either Direction"> +##INFO=<ID=HaplotypeScore,Number=1,Type=Float,Description="Consistency of the site with at most two segregating haplotypes"> +##INFO=<ID=InbreedingCoeff,Number=1,Type=Float,Description="Inbreeding coefficient as estimated from the genotype likelihoods per-sample when compared against the Hardy-Weinberg expectation"> +##INFO=<ID=MQ,Number=1,Type=Float,Description="RMS Mapping Quality"> +##INFO=<ID=MQ0,Number=1,Type=Integer,Description="Total Mapping Quality Zero Reads"> +##INFO=<ID=MQRankSum,Number=1,Type=Float,Description="Z-score From Wilcoxon rank sum test of Alt vs. Ref read mapping qualities"> +##INFO=<ID=QD,Number=1,Type=Float,Description="Variant Confidence/Quality by Depth"> +##INFO=<ID=ReadPosRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt vs. Ref read position bias"> +##UnifiedGenotyper="analysis_type=UnifiedGenotyper input_file=[/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/gatk_input_0.bam] sample_metadata=[] read_buffer_size=null phone_home=NO_ET read_filter=[] intervals=null excludeIntervals=null reference_sequence=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/gatk_input.fasta rodBind=[] rodToIntervalTrackName=null BTI_merge_rule=UNION nonDeterministicRandomSeed=false downsampling_type=null downsample_to_fraction=null downsample_to_coverage=null baq=OFF baqGapOpenPenalty=40.0 performanceLog=null useOriginalQualities=false defaultBaseQualities=-1 validation_strictness=SILENT unsafe=null num_threads=4 interval_merging=ALL read_group_black_list=null processingTracker=null restartProcessingTracker=false processingTrackerStatusFile=null processingTrackerID=-1 allow_intervals_with_unindexed_bam=false disable_experimental_low_memory_sharding=false logging_level=INFO log_to_file=null help=false genotype_likelihoods_model=BOTH p_nonref_model=EXACT heterozygosity=0.0010 pcr_error_rate=1.0E-4 genotyping_mode=DISCOVERY output_mode=EMIT_ALL_CONFIDENT_SITES standard_min_confidence_threshold_for_calling=0.0 standard_min_confidence_threshold_for_emitting=4.0 computeSLOD=false alleles=(RodBinding name= source=UNBOUND) assume_single_sample_reads=null abort_at_too_much_coverage=-1 min_base_quality_score=17 min_mapping_quality_score=20 max_deletion_fraction=-1.0 min_indel_count_for_genotyping=2 indel_heterozygosity=1.25E-4 indelGapContinuationPenalty=10.0 indelGapOpenPenalty=3.0 indelHaplotypeSize=80 doContextDependentGapPenalties=true getGapPenaltiesFromData=false indel_recal_file=indel.recal_data.csv indelDebug=false dovit=false GSA_PRODUCTION_ONLY=false exactCalculation=LINEAR_EXPERIMENTAL ignoreSNPAlleles=false output_all_callable_bases=false genotype=false dbsnp=(RodBinding name=dbsnp source=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/input_dbsnp_0.vcf) out=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub NO_HEADER=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub sites_only=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub debug_file=null annotation=[]" +##VariantAnnotator="analysis_type=VariantAnnotator input_file=[/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/gatk_input.bam] sample_metadata=[] read_buffer_size=null phone_home=NO_ET read_filter=[] intervals=null excludeIntervals=null reference_sequence=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/gatk_input.fasta rodBind=[] rodToIntervalTrackName=null BTI_merge_rule=UNION nonDeterministicRandomSeed=false downsampling_type=null downsample_to_fraction=null downsample_to_coverage=null baq=OFF baqGapOpenPenalty=40.0 performanceLog=null useOriginalQualities=false defaultBaseQualities=-1 validation_strictness=SILENT unsafe=null num_threads=1 interval_merging=ALL read_group_black_list=null processingTracker=null restartProcessingTracker=false processingTrackerStatusFile=null processingTrackerID=-1 allow_intervals_with_unindexed_bam=false disable_experimental_low_memory_sharding=false logging_level=INFO log_to_file=null help=false variant=(RodBinding name=variant source=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/input_variant.vcf) snpEffFile=(RodBinding name= source=UNBOUND) dbsnp=(RodBinding name=dbsnp source=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/input_dbsnp_dbsnp.vcf) comp=[] resource=[] out=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub NO_HEADER=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub sites_only=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub annotation=[SpanningDeletions, MappingQualityZero, AlleleBalance, RMSMappingQuality, HaplotypeScore, HomopolymerRun, DepthOfCoverage, MappingQualityRankSumTest, BaseQualityRankSumTest, QualByDepth] group=[] expression=[] useAllAnnotations=false list=false assume_single_sample_reads=null vcfContainsOnlyIndels=false" +##contig=<ID=phiX174,length=5386> +##reference=file:///var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/gatk_input.fasta +##reference=file:///var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/gatk_input.fasta +#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT A Fake phiX Sample +phiX174 1443 . AC . 0 . DB;DP=10;MQ=37.74;MQ0=0 GT ./.
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_variant_combine/gatk_variant_combine_out_1.log.contains Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,5 @@ +HelpFormatter - Program Args: -T CombineVariants +GenomeAnalysisEngine - Strictness is SILENT +TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING] +TraversalEngine - Location processed.sites runtime per.1M.sites completed total.runtime remaining +TraversalEngine - Total runtime
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_variant_combine/gatk_variant_combine_out_1.vcf Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,33 @@ +##fileformat=VCFv4.1 +##CombineVariants="analysis_type=CombineVariants input_file=[] sample_metadata=[] read_buffer_size=null phone_home=NO_ET read_filter=[] intervals=null excludeIntervals=null reference_sequence=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-bFIpbp/gatk_input.fasta rodBind=[] rodToIntervalTrackName=null BTI_merge_rule=UNION nonDeterministicRandomSeed=false downsampling_type=null downsample_to_fraction=null downsample_to_coverage=null baq=OFF baqGapOpenPenalty=40.0 performanceLog=null useOriginalQualities=false defaultBaseQualities=-1 validation_strictness=SILENT unsafe=null num_threads=1 interval_merging=ALL read_group_black_list=null processingTracker=null restartProcessingTracker=false processingTrackerStatusFile=null processingTrackerID=-1 allow_intervals_with_unindexed_bam=false disable_experimental_low_memory_sharding=false logging_level=INFO log_to_file=null help=false variant=[(RodBinding name=from_variant_annotator source=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-bFIpbp/input_variant_from_variant_annotator.vcf)] out=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub NO_HEADER=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub sites_only=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub genotypemergeoption=PRIORITIZE filteredrecordsmergetype=KEEP_IF_ANY_UNFILTERED rod_priority_list=from_variant_annotator printComplexMerges=false filteredAreUncalled=false minimalVCF=false setKey=set assumeIdenticalSamples=false minimumN=1 mergeInfoWithMaxAC=false" +##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed"> +##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth (reads with MQ=255 or with bad mates are filtered)"> +##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality"> +##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype"> +##FORMAT=<ID=PL,Number=G,Type=Integer,Description="Normalized, Phred-scaled likelihoods for genotypes as defined in the VCF specification"> +##INFO=<ID=AB,Number=1,Type=Float,Description="Allele Balance for hets (ref/(ref+alt))"> +##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes, for each ALT allele, in the same order as listed"> +##INFO=<ID=AF,Number=A,Type=Float,Description="Allele Frequency, for each ALT allele, in the same order as listed"> +##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes"> +##INFO=<ID=BaseQRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt Vs. Ref base qualities"> +##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP Membership"> +##INFO=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth; some reads may have been filtered"> +##INFO=<ID=DS,Number=0,Type=Flag,Description="Were any of the samples downsampled?"> +##INFO=<ID=Dels,Number=1,Type=Float,Description="Fraction of Reads Containing Spanning Deletions"> +##INFO=<ID=FS,Number=1,Type=Float,Description="Phred-scaled p-value using Fisher's exact test to detect strand bias"> +##INFO=<ID=HRun,Number=1,Type=Integer,Description="Largest Contiguous Homopolymer Run of Variant Allele In Either Direction"> +##INFO=<ID=HaplotypeScore,Number=1,Type=Float,Description="Consistency of the site with at most two segregating haplotypes"> +##INFO=<ID=InbreedingCoeff,Number=1,Type=Float,Description="Inbreeding coefficient as estimated from the genotype likelihoods per-sample when compared against the Hardy-Weinberg expectation"> +##INFO=<ID=MQ,Number=1,Type=Float,Description="RMS Mapping Quality"> +##INFO=<ID=MQ0,Number=1,Type=Integer,Description="Total Mapping Quality Zero Reads"> +##INFO=<ID=MQRankSum,Number=1,Type=Float,Description="Z-score From Wilcoxon rank sum test of Alt vs. Ref read mapping qualities"> +##INFO=<ID=QD,Number=1,Type=Float,Description="Variant Confidence/Quality by Depth"> +##INFO=<ID=ReadPosRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt vs. Ref read position bias"> +##INFO=<ID=set,Number=1,Type=String,Description="Source VCF for the merged record in CombineVariants"> +##UnifiedGenotyper="analysis_type=UnifiedGenotyper input_file=[/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/gatk_input_0.bam] sample_metadata=[] read_buffer_size=null phone_home=NO_ET read_filter=[] intervals=null excludeIntervals=null reference_sequence=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/gatk_input.fasta rodBind=[] rodToIntervalTrackName=null BTI_merge_rule=UNION nonDeterministicRandomSeed=false downsampling_type=null downsample_to_fraction=null downsample_to_coverage=null baq=OFF baqGapOpenPenalty=40.0 performanceLog=null useOriginalQualities=false defaultBaseQualities=-1 validation_strictness=SILENT unsafe=null num_threads=4 interval_merging=ALL read_group_black_list=null processingTracker=null restartProcessingTracker=false processingTrackerStatusFile=null processingTrackerID=-1 allow_intervals_with_unindexed_bam=false disable_experimental_low_memory_sharding=false logging_level=INFO log_to_file=null help=false genotype_likelihoods_model=BOTH p_nonref_model=EXACT heterozygosity=0.0010 pcr_error_rate=1.0E-4 genotyping_mode=DISCOVERY output_mode=EMIT_ALL_CONFIDENT_SITES standard_min_confidence_threshold_for_calling=0.0 standard_min_confidence_threshold_for_emitting=4.0 computeSLOD=false alleles=(RodBinding name= source=UNBOUND) assume_single_sample_reads=null abort_at_too_much_coverage=-1 min_base_quality_score=17 min_mapping_quality_score=20 max_deletion_fraction=-1.0 min_indel_count_for_genotyping=2 indel_heterozygosity=1.25E-4 indelGapContinuationPenalty=10.0 indelGapOpenPenalty=3.0 indelHaplotypeSize=80 doContextDependentGapPenalties=true getGapPenaltiesFromData=false indel_recal_file=indel.recal_data.csv indelDebug=false dovit=false GSA_PRODUCTION_ONLY=false exactCalculation=LINEAR_EXPERIMENTAL ignoreSNPAlleles=false output_all_callable_bases=false genotype=false dbsnp=(RodBinding name=dbsnp source=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/input_dbsnp_0.vcf) out=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub NO_HEADER=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub sites_only=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub debug_file=null annotation=[]" +##VariantAnnotator="analysis_type=VariantAnnotator input_file=[/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/gatk_input.bam] sample_metadata=[] read_buffer_size=null phone_home=NO_ET read_filter=[] intervals=null excludeIntervals=null reference_sequence=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/gatk_input.fasta rodBind=[] rodToIntervalTrackName=null BTI_merge_rule=UNION nonDeterministicRandomSeed=false downsampling_type=null downsample_to_fraction=null downsample_to_coverage=null baq=OFF baqGapOpenPenalty=40.0 performanceLog=null useOriginalQualities=false defaultBaseQualities=-1 validation_strictness=SILENT unsafe=null num_threads=1 interval_merging=ALL read_group_black_list=null processingTracker=null restartProcessingTracker=false processingTrackerStatusFile=null processingTrackerID=-1 allow_intervals_with_unindexed_bam=false disable_experimental_low_memory_sharding=false logging_level=INFO log_to_file=null help=false variant=(RodBinding name=variant source=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/input_variant.vcf) snpEffFile=(RodBinding name= source=UNBOUND) dbsnp=(RodBinding name=dbsnp source=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/input_dbsnp_dbsnp.vcf) comp=[] resource=[] out=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub NO_HEADER=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub sites_only=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub annotation=[SpanningDeletions, MappingQualityZero, AlleleBalance, RMSMappingQuality, HaplotypeScore, HomopolymerRun, DepthOfCoverage, MappingQualityRankSumTest, BaseQualityRankSumTest, QualByDepth] group=[] expression=[] useAllAnnotations=false list=false assume_single_sample_reads=null vcfContainsOnlyIndels=false" +##contig=<ID=phiX174,length=5386> +##reference=file:///var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/gatk_input.fasta +##reference=file:///var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-bFIpbp/gatk_input.fasta +#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT A Fake phiX Sample +phiX174 1443 . AC . . PASS AC=0;AF=0.00;AN=0;DB;DP=10;MQ=37.74;MQ0=0;set=ReferenceInAll GT ./.
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_variant_eval/gatk_variant_eval_out_1.gatk_report Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,30 @@ +##:GATKReport.v0.2 CompOverlap : The overlap between eval and comp sites +CompOverlap CompRod EvalRod JexlExpression Novelty nEvalVariants novelSites nVariantsAtComp compRate nConcordant concordantRate +CompOverlap dbsnp input_0 none all 0 0 0 0.00 0 0.00 +CompOverlap dbsnp input_0 none known 0 0 0 0.00 0 0.00 +CompOverlap dbsnp input_0 none novel 0 0 0 0.00 0 0.00 + +##:GATKReport.v0.2 CountVariants : Counts different classes of variants in the sample +CountVariants CompRod EvalRod JexlExpression Novelty nProcessedLoci nCalledLoci nRefLoci nVariantLoci variantRate variantRatePerBp nSNPs nMNPs nInsertions nDeletions nComplex nSymbolic nMixed nNoCalls nHets nHomRef nHomVar nSingletons nHomDerived heterozygosity heterozygosityPerBp hetHomRatio indelRate indelRatePerBp deletionInsertionRatio +CountVariants dbsnp input_0 none all 5386 1 1 0 0.00000000 0.00000000 0 0 0 0 0 0 0 1 0 0 0 0 0 0.00e+00 0.00 0.00 0.00e+00 0.00 0.00 +CountVariants dbsnp input_0 none known 5386 1 1 0 0.00000000 0.00000000 0 0 0 0 0 0 0 1 0 0 0 0 0 0.00e+00 0.00 0.00 0.00e+00 0.00 0.00 +CountVariants dbsnp input_0 none novel 5386 0 0 0 0.00000000 0.00000000 0 0 0 0 0 0 0 0 0 0 0 0 0 0.00e+00 0.00 0.00 0.00e+00 0.00 0.00 + +##:GATKReport.v0.2 TiTvVariantEvaluator : Ti/Tv Variant Evaluator +TiTvVariantEvaluator CompRod EvalRod JexlExpression Novelty nTi nTv tiTvRatio nTiInComp nTvInComp TiTvRatioStandard nTiDerived nTvDerived tiTvDerivedRatio +TiTvVariantEvaluator dbsnp input_0 none all 0 0 0.00 0 0 0.00 0 0 0.00 +TiTvVariantEvaluator dbsnp input_0 none known 0 0 0.00 0 0 0.00 0 0 0.00 +TiTvVariantEvaluator dbsnp input_0 none novel 0 0 0.00 0 0 0.00 0 0 0.00 + +##:GATKReport.v0.2 ValidationReport : Assess site accuracy and sensitivity of callset against follow-up validation assay +ValidationReport CompRod EvalRod JexlExpression Novelty nComp TP FP FN TN sensitivity specificity PPV FDR CompMonoEvalNoCall CompMonoEvalFiltered CompMonoEvalMono CompMonoEvalPoly CompPolyEvalNoCall CompPolyEvalFiltered CompPolyEvalMono CompPolyEvalPoly CompFiltered nDifferentAlleleSites +ValidationReport dbsnp input_0 none all 43 0 0 0 43 NaN 100.00 NaN NaN 42 0 1 0 0 0 0 0 0 0 +ValidationReport dbsnp input_0 none known 1 0 0 0 1 NaN 100.00 NaN NaN 0 0 1 0 0 0 0 0 0 0 +ValidationReport dbsnp input_0 none novel 42 0 0 0 42 NaN 100.00 NaN NaN 42 0 0 0 0 0 0 0 0 0 + +##:GATKReport.v0.2 VariantSummary : 1000 Genomes Phase I summary of variants table +VariantSummary CompRod EvalRod JexlExpression Novelty nSamples nProcessedLoci nSNPs TiTvRatio SNPNoveltyRate nSNPsPerSample TiTvRatioPerSample SNPDPPerSample nIndels IndelNoveltyRate nIndelsPerSample IndelDPPerSample nSVs SVNoveltyRate nSVsPerSample +VariantSummary dbsnp input_0 none all 1 5386 0 0.00 NA 0 0.00 0.0 0 NA 0 0.0 0 NA 0 +VariantSummary dbsnp input_0 none known 1 5386 0 0.00 NA 0 0.00 0.0 0 NA 0 0.0 0 NA 0 +VariantSummary dbsnp input_0 none novel 1 5386 0 0.00 NA 0 0.00 0.0 0 NA 0 0.0 0 NA 0 +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_variant_eval/gatk_variant_eval_out_1.log.contains Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,5 @@ +HelpFormatter - Program Args: -T VariantEval +GenomeAnalysisEngine - Strictness is SILENT +TraversalEngine - Location processed.sites runtime per.1M.sites completed total.runtime remaining +VariantEvalWalker - Finalizing variant report +TraversalEngine - Total runtime \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_variant_filtration/gatk_variant_filtration_out_1.log.contains Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,4 @@ +GenomeAnalysisEngine - Strictness is SILENT +TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING] +TraversalEngine - Location processed.sites runtime per.1M.sites completed total.runtime remaining +TraversalEngine - Total runtime
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_variant_select/gatk_variant_select_out_1.log.contains Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,4 @@ +GenomeAnalysisEngine - Strictness is SILENT +SelectVariants - Including sample 'A Fake phiX Sample' +TraversalEngine - Location processed.sites runtime per.1M.sites completed total.runtime remaining +SelectVariants - 1 records processed.
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_variant_select/gatk_variant_select_out_1.vcf Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,32 @@ +##fileformat=VCFv4.1 +##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed"> +##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth (reads with MQ=255 or with bad mates are filtered)"> +##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality"> +##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype"> +##FORMAT=<ID=PL,Number=G,Type=Integer,Description="Normalized, Phred-scaled likelihoods for genotypes as defined in the VCF specification"> +##INFO=<ID=AB,Number=1,Type=Float,Description="Allele Balance for hets (ref/(ref+alt))"> +##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes, for each ALT allele, in the same order as listed"> +##INFO=<ID=AF,Number=A,Type=Float,Description="Allele Frequency, for each ALT allele, in the same order as listed"> +##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes"> +##INFO=<ID=BaseQRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt Vs. Ref base qualities"> +##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP Membership"> +##INFO=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth; some reads may have been filtered"> +##INFO=<ID=DS,Number=0,Type=Flag,Description="Were any of the samples downsampled?"> +##INFO=<ID=Dels,Number=1,Type=Float,Description="Fraction of Reads Containing Spanning Deletions"> +##INFO=<ID=FS,Number=1,Type=Float,Description="Phred-scaled p-value using Fisher's exact test to detect strand bias"> +##INFO=<ID=HRun,Number=1,Type=Integer,Description="Largest Contiguous Homopolymer Run of Variant Allele In Either Direction"> +##INFO=<ID=HaplotypeScore,Number=1,Type=Float,Description="Consistency of the site with at most two segregating haplotypes"> +##INFO=<ID=InbreedingCoeff,Number=1,Type=Float,Description="Inbreeding coefficient as estimated from the genotype likelihoods per-sample when compared against the Hardy-Weinberg expectation"> +##INFO=<ID=MQ,Number=1,Type=Float,Description="RMS Mapping Quality"> +##INFO=<ID=MQ0,Number=1,Type=Integer,Description="Total Mapping Quality Zero Reads"> +##INFO=<ID=MQRankSum,Number=1,Type=Float,Description="Z-score From Wilcoxon rank sum test of Alt vs. Ref read mapping qualities"> +##INFO=<ID=QD,Number=1,Type=Float,Description="Variant Confidence/Quality by Depth"> +##INFO=<ID=ReadPosRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt vs. Ref read position bias"> +##UnifiedGenotyper="analysis_type=UnifiedGenotyper input_file=[/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/gatk_input_0.bam] sample_metadata=[] read_buffer_size=null phone_home=NO_ET read_filter=[] intervals=null excludeIntervals=null reference_sequence=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/gatk_input.fasta rodBind=[] rodToIntervalTrackName=null BTI_merge_rule=UNION nonDeterministicRandomSeed=false downsampling_type=null downsample_to_fraction=null downsample_to_coverage=null baq=OFF baqGapOpenPenalty=40.0 performanceLog=null useOriginalQualities=false defaultBaseQualities=-1 validation_strictness=SILENT unsafe=null num_threads=4 interval_merging=ALL read_group_black_list=null processingTracker=null restartProcessingTracker=false processingTrackerStatusFile=null processingTrackerID=-1 allow_intervals_with_unindexed_bam=false disable_experimental_low_memory_sharding=false logging_level=INFO log_to_file=null help=false genotype_likelihoods_model=BOTH p_nonref_model=EXACT heterozygosity=0.0010 pcr_error_rate=1.0E-4 genotyping_mode=DISCOVERY output_mode=EMIT_ALL_CONFIDENT_SITES standard_min_confidence_threshold_for_calling=0.0 standard_min_confidence_threshold_for_emitting=4.0 computeSLOD=false alleles=(RodBinding name= source=UNBOUND) assume_single_sample_reads=null abort_at_too_much_coverage=-1 min_base_quality_score=17 min_mapping_quality_score=20 max_deletion_fraction=-1.0 min_indel_count_for_genotyping=2 indel_heterozygosity=1.25E-4 indelGapContinuationPenalty=10.0 indelGapOpenPenalty=3.0 indelHaplotypeSize=80 doContextDependentGapPenalties=true getGapPenaltiesFromData=false indel_recal_file=indel.recal_data.csv indelDebug=false dovit=false GSA_PRODUCTION_ONLY=false exactCalculation=LINEAR_EXPERIMENTAL ignoreSNPAlleles=false output_all_callable_bases=false genotype=false dbsnp=(RodBinding name=dbsnp source=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/input_dbsnp_0.vcf) out=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub NO_HEADER=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub sites_only=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub debug_file=null annotation=[]" +##VariantAnnotator="analysis_type=VariantAnnotator input_file=[/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/gatk_input.bam] sample_metadata=[] read_buffer_size=null phone_home=NO_ET read_filter=[] intervals=null excludeIntervals=null reference_sequence=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/gatk_input.fasta rodBind=[] rodToIntervalTrackName=null BTI_merge_rule=UNION nonDeterministicRandomSeed=false downsampling_type=null downsample_to_fraction=null downsample_to_coverage=null baq=OFF baqGapOpenPenalty=40.0 performanceLog=null useOriginalQualities=false defaultBaseQualities=-1 validation_strictness=SILENT unsafe=null num_threads=1 interval_merging=ALL read_group_black_list=null processingTracker=null restartProcessingTracker=false processingTrackerStatusFile=null processingTrackerID=-1 allow_intervals_with_unindexed_bam=false disable_experimental_low_memory_sharding=false logging_level=INFO log_to_file=null help=false variant=(RodBinding name=variant source=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/input_variant.vcf) snpEffFile=(RodBinding name= source=UNBOUND) dbsnp=(RodBinding name=dbsnp source=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/input_dbsnp_dbsnp.vcf) comp=[] resource=[] out=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub NO_HEADER=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub sites_only=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub annotation=[SpanningDeletions, MappingQualityZero, AlleleBalance, RMSMappingQuality, HaplotypeScore, HomopolymerRun, DepthOfCoverage, MappingQualityRankSumTest, BaseQualityRankSumTest, QualByDepth] group=[] expression=[] useAllAnnotations=false list=false assume_single_sample_reads=null vcfContainsOnlyIndels=false" +##contig=<ID=phiX174,length=5386> +##reference=file:///var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/gatk_input.fasta +##reference=file:///var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/gatk_input.fasta +##source=SelectVariants +#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT A Fake phiX Sample +phiX174 1443 . AC . 0 . AC=0;AF=0.00;AN=0;DB;DP=0;MQ=37.74;MQ0=0 GT ./.
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/phiX.fasta Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,79 @@ +>phiX174 +GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT +GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA +ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG +TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA +GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC +TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT +TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT +CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT +TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG +TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC +GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA +CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG +TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT +AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC +CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA +TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC +TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA +CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA +GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT +GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA +ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC +TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT +TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC +ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC +CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT +GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC +CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC +TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG +TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT +TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA +AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT +TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT +ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC +GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC +TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT +TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA +TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG +TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC +CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG +AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC +CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT +TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG +CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA +AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT +GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG +GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA +TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT +CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG +TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA +GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC +CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA +TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA +AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC +TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT +CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA +TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG +TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT +CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT +TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC +ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG +TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA +ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG +GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC +CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT +GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG +GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT +ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG +CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC +CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC +GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT +CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG +CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA +TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT +TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG +TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC +AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC +TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.sample Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,12 @@ +<tables> + <!-- Location of Picard dict files valid for GATK --> + <table name="gatk2_picard_indexes" comment_char="#" allow_duplicate_entries="False"> + <columns>value, dbkey, name, path</columns> + <file path="tool-data/gatk2_picard_index.loc" /> + </table> + <!-- Available of GATK references --> + <table name="gatk2_annotations" comment_char="#" allow_duplicate_entries="False"> + <columns>value, name, gatk_value, tools_valid_for</columns> + <file path="tool-data/gatk2_annotations.txt" /> + </table> +</tables>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_dependencies.xml Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,26 @@ +<?xml version="1.0"?> +<tool_dependency> + <set_environment version="1.0"> + <environment_variable action="set_to" name="GATK2_PATH">/please set the path to your GATK2 dir in the corresponding env.sh file/</environment_variable> + </set_environment> + <!-- + Use GATK2_SITE_OPTIONS to set additional parameters that should be inserted in every GATK2 call. + The intended use case was to prohibit GATK2 to collect and send data. + For example: + + -et "NO_ET" -K "/data/gatk2_key_file" ##ET no phone home + --> + <set_environment version="1.0"> + <environment_variable action="set_to" name="GATK2_SITE_OPTIONS"> </environment_variable> + </set_environment> + + <package name="samtools" version="0.1.19"> + <repository changeset_revision="c9bd782f5342" name="package_samtools_0_1_19" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> + </package> + <package name="picard" version="1.56.0"> + <repository changeset_revision="99a28567c3a3" name="package_picard_1_56_0" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" /> + </package> + <package name="ggplot2" version="0.9.3"> + <repository changeset_revision="07de191649b4" name="package_r_ggplot2_0_9_3" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> + </package> +</tool_dependency>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/unified_genotyper.xml Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,289 @@ +<tool id="gatk2_unified_genotyper" name="Unified Genotyper" version="@VERSION@.2"> + <description>SNP and indel caller</description> + <macros> + <import>gatk2_macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="version_command" /> + <command interpreter="python"> + gatk2_wrapper.py + --stdout "${output_log}" + @BAM_INPUTS@ + -p ' + @JAR_PATH@ + -T "UnifiedGenotyper" + @THREADS@ + --out "${output_vcf}" + --metrics_file "${output_metrics}" + \$GATK2_SITE_OPTIONS + + ## according to http://www.broadinstitute.org/gatk/guide/article?id=1975 + --num_cpu_threads_per_data_thread 1 + + #if $reference_source.reference_source_selector != "history": + -R "${reference_source.ref_file.fields.path}" + #end if + --genotype_likelihoods_model "${genotype_likelihoods_model}" + --standard_min_confidence_threshold_for_calling "${standard_min_confidence_threshold_for_calling}" + --standard_min_confidence_threshold_for_emitting "${standard_min_confidence_threshold_for_emitting}" + ' + @DBSNP_OPTIONS@ + $allow_n_cigar_reads + #include source=$standard_gatk_options# + ##start analysis specific options + #if $analysis_param_type.analysis_param_type_selector == "advanced": + -p ' + --heterozygosity "${analysis_param_type.heterozygosity}" + --pcr_error_rate "${analysis_param_type.pcr_error_rate}" + --genotyping_mode "${analysis_param_type.genotyping_mode_type.genotyping_mode}" + #if str( $analysis_param_type.genotyping_mode_type.genotyping_mode ) == 'GENOTYPE_GIVEN_ALLELES': + --alleles "${analysis_param_type.genotyping_mode_type.input_alleles_rod}" + #end if + --output_mode "${analysis_param_type.output_mode}" + ${analysis_param_type.compute_SLOD} + --min_base_quality_score "${analysis_param_type.min_base_quality_score}" + --max_deletion_fraction "${analysis_param_type.max_deletion_fraction}" + --max_alternate_alleles "${analysis_param_type.max_alternate_alleles}" + --min_indel_count_for_genotyping "${analysis_param_type.min_indel_count_for_genotyping}" + --indel_heterozygosity "${analysis_param_type.indel_heterozygosity}" + --indelGapContinuationPenalty "${analysis_param_type.indelGapContinuationPenalty}" + --indelGapOpenPenalty "${analysis_param_type.indelGapOpenPenalty}" + --indelHaplotypeSize "${analysis_param_type.indelHaplotypeSize}" + ${analysis_param_type.doContextDependentGapPenalties} + #if str( $analysis_param_type.annotation ) != "None": + #for $annotation in str( $analysis_param_type.annotation.fields.gatk_value ).split( ','): + --annotation "${annotation}" + #end for + #end if + #for $additional_annotation in $analysis_param_type.additional_annotations: + --annotation "${additional_annotation.additional_annotation_name}" + #end for + #if str( $analysis_param_type.group ) != "None": + #for $group in str( $analysis_param_type.group ).split( ','): + --group "${group}" + #end for + #end if + #if str( $analysis_param_type.exclude_annotations ) != "None": + #for $annotation in str( $analysis_param_type.exclude_annotations.fields.gatk_value ).split( ','): + --excludeAnnotation "${annotation}" + #end for + #end if + #if str( $analysis_param_type.sample_ploidy ) != '': + --sample_ploidy "$analysis_param_type.sample_ploidy" + #end if + ' +## #if str( $analysis_param_type.snpEff_rod_bind_type.snpEff_rod_bind_type_selector ) == 'set_snpEff': +## -p '--annotation "SnpEff"' +## -d "--snpEffFile:${analysis_param_type.snpEff_rod_bind_type.snpEff_rod_name},%(file_type)s" "${analysis_param_type.snpEff_rod_bind_type.snpEff_input_rod}" "${analysis_param_type.snpEff_rod_bind_type.snpEff_input_rod.ext}" "input_snpEff_${analysis_param_type.snpEff_rod_bind_type.snpEff_rod_name}" +## #else: +## -p '--excludeAnnotation "SnpEff"' +## #end if + #end if + </command> + <inputs> + <conditional name="reference_source"> + <expand macro="reference_source_selector_param" /> + <when value="cached"> + <expand macro="input_bams_cached" /> + <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &lt;reference_sequence&gt;"> + <options from_data_table="gatk2_picard_indexes"> + <!-- <filter type="data_meta" key="dbkey" ref="input_bam" column="dbkey"/> does not yet work in a repeat...--> + </options> + <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> + </param> + </when> + <when value="history"> <!-- FIX ME!!!! --> + <expand macro="input_bams_history" /> + <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &lt;reference_sequence&gt;" /> + </when> + </conditional> + <expand macro="dbsnp_param" /> + + <param name="genotype_likelihoods_model" type="select" label="Genotype likelihoods calculation model to employ" help="-glm,--genotype_likelihoods_model &lt;genotype_likelihoods_model&gt;"> + <option value="BOTH" selected="True">BOTH</option> + <option value="SNP">SNP</option> + <option value="INDEL">INDEL</option> + </param> + + <param name="standard_min_confidence_threshold_for_calling" type="float" value="30.0" label="The minimum phred-scaled confidence threshold at which variants not at 'trigger' track sites should be called" help="-stand_call_conf,--standard_min_confidence_threshold_for_calling &lt;standard_min_confidence_threshold_for_calling&gt;" /> + <param name="standard_min_confidence_threshold_for_emitting" type="float" value="30.0" label="The minimum phred-scaled confidence threshold at which variants not at 'trigger' track sites should be emitted (and filtered if less than the calling threshold)" help="-stand_emit_conf,--standard_min_confidence_threshold_for_emitting &lt;standard_min_confidence_threshold_for_emitting&gt;" /> + + <expand macro="allow_n_cigar_reads" /> + <expand macro="gatk_param_type_conditional" /> + + <expand macro="analysis_type_conditional"> + <param name="heterozygosity" type="float" value="1e-3" label="Heterozygosity value used to compute prior likelihoods for any locus" + help="-hets,--heterozygosity &lt;heterozygosity&gt;" /> + <param name="pcr_error_rate" type="float" value="1e-4" label="The PCR error rate to be used for computing fragment-based likelihoods" + help="-pcr_error,--pcr_error_rate &lt;pcr_error_rate&gt;" /> + <conditional name="genotyping_mode_type"> + <param name="genotyping_mode" type="select" label="How to determine the alternate allele to use for genotyping" help="-gt_mode,--genotyping_mode &lt;genotyping_mode&gt;"> + <option value="DISCOVERY" selected="True">DISCOVERY</option> + <option value="GENOTYPE_GIVEN_ALLELES">GENOTYPE_GIVEN_ALLELES</option> + </param> + <when value="DISCOVERY"> + <!-- Do nothing here --> + </when> + <when value="GENOTYPE_GIVEN_ALLELES"> + <param name="input_alleles_rod" type="data" format="vcf" label="Alleles ROD file" help="-alleles,--alleles &lt;alleles&gt;" /> + </when> + </conditional> + <param name="output_mode" type="select" label="Should we output confident genotypes (i.e. including ref calls) or just the variants?" help="-out_mode,--output_mode &lt;output_mode&gt;"> + <option value="EMIT_VARIANTS_ONLY" selected="True">EMIT_VARIANTS_ONLY</option> + <option value="EMIT_ALL_CONFIDENT_SITES">EMIT_ALL_CONFIDENT_SITES</option> + <option value="EMIT_ALL_SITES">EMIT_ALL_SITES</option> + </param> + <param name="compute_SLOD" type="boolean" truevalue="--computeSLOD" falsevalue="" label="Compute the SLOD" help="--computeSLOD" /> + <param name="min_base_quality_score" type="integer" value="17" label="Minimum base quality required to consider a base for calling" help="-mbq,--min_base_quality_score &lt;min_base_quality_score&gt;" /> + <param name="max_deletion_fraction" type="float" value="0.05" label="Maximum fraction of reads with deletions spanning this locus for it to be callable" help="to disable, set to < 0 or > 1 (-deletions,--max_deletion_fraction &lt;max_deletion_fraction&gt;)" /> + <param name="max_alternate_alleles" type="integer" value="6" label="Maximum number of alternate alleles to genotype" help="-maxAlleles,--max_alternate_alleles &lt;max_alternate_alleles&gt;" /> + <param name="min_indel_count_for_genotyping" type="integer" value="5" label="Minimum number of consensus indels required to trigger genotyping run" help="-minIndelCnt,--min_indel_count_for_genotyping &lt;min_indel_count_for_genotyping&gt;" /> + <param name="indel_heterozygosity" type="float" value="0.000125" label="Heterozygosity for indel calling" help="1.0/8000==0.000125 (-indelHeterozygosity,--indel_heterozygosity &lt;indel_heterozygosity&gt;)"/> + <param name="indelGapContinuationPenalty" type="integer" value="10" label="Indel gap continuation penalty" help="As Phred-scaled probability, i.e. 30 => 10^-30/10 (--indelGapContinuationPenalty)"> + <validator type="in_range" message="value between 0 and 255" min="0" max="255" /> + </param> + <param name="indelGapOpenPenalty" type="integer" value="45" label="Indel gap open penalty" help="As Phred-scaled probability, i.e. 30 => 10^-30/10 (--indelGapOpenPenalty)"> + <validator type="in_range" message="value between 0 and 255" min="0" max="255" /> + </param> + <!-- indelHaplotypeSize - Gone in GATK 2.4? --> + <param name="indelHaplotypeSize" type="integer" value="80" label="Indel haplotype size" help="--indelHaplotypeSize" /> + <param name="doContextDependentGapPenalties" type="boolean" truevalue="--doContextDependentGapPenalties" falsevalue="" label="Vary gap penalties by context" help="--doContextDependentGapPenalties" /> + <param name="annotation" type="select" multiple="True" display="checkboxes" label="Annotation Types" help="-A,--annotation &lt;annotation&gt;"> + <!-- load the available annotations from an external configuration file, since additional ones can be added to local installs --> + <options from_data_table="gatk2_annotations"> + <filter type="multiple_splitter" column="tools_valid_for" separator=","/> + <filter type="static_value" value="UnifiedGenotyper" column="tools_valid_for"/> + </options> + </param> + <repeat name="additional_annotations" title="Additional annotation" help="-A,--annotation &lt;annotation&gt;"> + <param name="additional_annotation_name" type="text" value="" label="Annotation name" /> + </repeat> +<!-- + <conditional name="snpEff_rod_bind_type"> + <param name="snpEff_rod_bind_type_selector" type="select" label="Provide a snpEff reference-ordered data file"> + <option value="set_snpEff">Set snpEff</option> + <option value="exclude_snpEff" selected="True">Don't set snpEff</option> + </param> + <when value="exclude_snpEff"> + </when> + <when value="set_snpEff"> + <param name="snpEff_input_rod" type="data" format="vcf" label="ROD file" /> + <param name="snpEff_rod_name" type="hidden" value="snpEff" label="ROD Name"/> + </when> + </conditional> +--> + <param name="group" type="select" multiple="True" display="checkboxes" label="Annotation Interfaces/Groups" help="-G,--group &lt;group&gt;"> + <option value="RodRequiringAnnotation">RodRequiringAnnotation</option> + <option value="Standard">Standard</option> + <option value="Experimental">Experimental</option> + <option value="WorkInProgress">WorkInProgress</option> + <option value="RankSumTest">RankSumTest</option> + <!-- <option value="none">none</option> --> + </param> + <!-- <param name="family_string" type="text" value="" label="Family String"/> --> + <param name="exclude_annotations" type="select" multiple="True" display="checkboxes" label="Annotations to exclude" + help="-XA,--excludeAnnotation &lt;excludeAnnotation&gt;" > + <!-- load the available annotations from an external configuration file, since additional ones can be added to local installs --> + <options from_data_table="gatk2_annotations"> + <filter type="multiple_splitter" column="tools_valid_for" separator=","/> + <filter type="static_value" value="UnifiedGenotyper" column="tools_valid_for"/> + </options> + </param> + <param name="sample_ploidy" type="integer" value="2" + label="Ploidy (number of chromosomes) per sample. For pooled data, set to (Number of samples in each pool * Sample Ploidy)" help="-ploidy,--sample_ploidy" /> + </expand> + </inputs> + <outputs> + <data format="vcf" name="output_vcf" label="${tool.name} on ${on_string} (VCF)" /> + <data format="txt" name="output_metrics" label="${tool.name} on ${on_string} (metrics)" /> + <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" /> + </outputs> + <trackster_conf/> + <tests> + <test> + <param name="reference_source_selector" value="history" /> + <param name="ref_file" value="phiX.fasta" ftype="fasta" /> + <param name="input_bam" value="gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.bam" ftype="bam" /> + <param name="dbsnp_rod_bind_type_selector" value="set_dbsnp" /> + <param name="dbsnp_input_rod" value="gatk/fake_phiX_variant_locations.vcf" ftype="vcf" /> + <param name="dbsnp_rod_name" value="dbsnp" /> + <param name="standard_min_confidence_threshold_for_calling" value="0" /> + <param name="standard_min_confidence_threshold_for_emitting" value="4" /> + <param name="gatk_param_type_selector" value="basic" /> + <param name="analysis_param_type_selector" value="advanced" /> + <param name="genotype_likelihoods_model" value="BOTH" /> + <param name="heterozygosity" value="0.001" /> + <param name="pcr_error_rate" value="0.0001" /> + <param name="genotyping_mode" value="DISCOVERY" /> + <param name="output_mode" value="EMIT_ALL_CONFIDENT_SITES" /> + <param name="compute_SLOD" /> + <param name="min_base_quality_score" value="17" /> + <param name="max_deletion_fraction" value="-1" /> + <param name="min_indel_count_for_genotyping" value="2" /> + <param name="indel_heterozygosity" value="0.000125" /> + <param name="indelGapContinuationPenalty" value="10" /> + <param name="indelGapOpenPenalty" value="3" /> + <param name="indelHaplotypeSize" value="80" /> + <param name="doContextDependentGapPenalties" /> + <!-- <param name="annotation" value="" /> + <param name="group" value="" /> --> + <output name="output_vcf" file="gatk/gatk_unified_genotyper/gatk_unified_genotyper_out_1.vcf" lines_diff="4" /> + <output name="output_metrics" file="gatk/gatk_unified_genotyper/gatk_unified_genotyper_out_1.metrics" /> + <output name="output_log" file="gatk/gatk_unified_genotyper/gatk_unified_genotyper_out_1.log.contains" compare="contains" /> + </test> + </tests> + <help> +**What it does** + +A variant caller which unifies the approaches of several disparate callers. Works for single-sample and multi-sample data. The user can choose from several different incorporated calculation models. + +For more information on the GATK Unified Genotyper, see this `tool specific page <http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_genotyper_UnifiedGenotyper.html>`_. + +To learn about best practices for variant detection using GATK, see this `overview <http://www.broadinstitute.org/gatk/guide/topic?name=best-practices>`_. + +If you encounter errors, please view the `GATK FAQ <http://www.broadinstitute.org/gatk/guide/topic?name=faqs>`_. + +------ + +**Inputs** + +GenomeAnalysisTK: UnifiedGenotyper accepts an aligned BAM input file. + + +**Outputs** + +The output is in VCF format. + + +Go `here <http://www.broadinstitute.org/gatk/guide/topic?name=intro>`_ for details on GATK file formats. + +------- + +**Settings**:: + + genotype_likelihoods_model Genotype likelihoods calculation model to employ -- BOTH is the default option, while INDEL is also available for calling indels and SNP is available for calling SNPs only (SNP|INDEL|BOTH) + heterozygosity Heterozygosity value used to compute prior likelihoods for any locus + pcr_error_rate The PCR error rate to be used for computing fragment-based likelihoods + genotyping_mode Should we output confident genotypes (i.e. including ref calls) or just the variants? (DISCOVERY|GENOTYPE_GIVEN_ALLELES) + output_mode Should we output confident genotypes (i.e. including ref calls) or just the variants? (EMIT_VARIANTS_ONLY|EMIT_ALL_CONFIDENT_SITES|EMIT_ALL_SITES) + standard_min_confidence_threshold_for_calling The minimum phred-scaled confidence threshold at which variants not at 'trigger' track sites should be called + standard_min_confidence_threshold_for_emitting The minimum phred-scaled confidence threshold at which variants not at 'trigger' track sites should be emitted (and filtered if less than the calling threshold) + noSLOD If provided, we will not calculate the SLOD + min_base_quality_score Minimum base quality required to consider a base for calling + max_deletion_fraction Maximum fraction of reads with deletions spanning this locus for it to be callable [to disable, set to < 0 or > 1; default:0.05] + min_indel_count_for_genotyping Minimum number of consensus indels required to trigger genotyping run + indel_heterozygosity Heterozygosity for indel calling + indelGapContinuationPenalty Indel gap continuation penalty + indelGapOpenPenalty Indel gap open penalty + indelHaplotypeSize Indel haplotype size + doContextDependentGapPenalties Vary gap penalties by context + indel_recal_file Filename for the input covariates table recalibration .csv file - EXPERIMENTAL, DO NO USE + indelDebug Output indel debug info + out File to which variants should be written + annotation One or more specific annotations to apply to variant calls + group One or more classes/groups of annotations to apply to variant calls + +@CITATION_SECTION@ + </help> + <expand macro="citations" /> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/variant_annotator.xml Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,249 @@ +<tool id="gatk2_variant_annotator" name="Variant Annotator" version="@VERSION@.0"> + <description></description> + <macros> + <import>gatk2_macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="version_command" /> + <command interpreter="python"> + gatk2_wrapper.py + --stdout "${output_log}" + #if str( $reference_source.input_bam ) != "None": + -d "-I" "${reference_source.input_bam}" "${reference_source.input_bam.ext}" "gatk_input" + #if str( $reference_source.input_bam.metadata.bam_index ) != "None": + -d "" "${reference_source.input_bam.metadata.bam_index}" "bam_index" "gatk_input" ##hardcode galaxy ext type as bam_index + #end if + #end if + -d "--variant" "${reference_source.input_variant}" "${reference_source.input_variant.ext}" "input_variant" + -p ' + @JAR_PATH@ + -T "VariantAnnotator" + \$GATK2_SITE_OPTIONS + + @THREADS@ + + #if $reference_source.reference_source_selector != "history": + -R "${reference_source.ref_file.fields.path}" + #end if + -o "${output_vcf}" + #if str( $annotations_type.annotations_type_selector ) == "use_all_annotations": + --useAllAnnotations + #else: + #if $annotations_type.annotations: + #for $annotation in str( $annotations_type.annotations.fields.gatk_value ).split( ',' ): + --annotation "${annotation}" + #end for + #end if + #end if + #if $exclude_annotations: + #for $annotation in str( $exclude_annotations.fields.gatk_value ).split( ',' ): + --excludeAnnotation "${annotation}" + #end for + #end if + #for $additional_annotation in $additional_annotations: + --annotation "${additional_annotation.additional_annotation_name}" + #end for + ' + #if $reference_source.input_variant_bti: + -d "--intervals" "${reference_source.input_variant}" "${reference_source.input_variant.ext}" "input_variant_bti" + #end if + + #for $rod_binding in $comp_rod_bind: + -d "--comp:${rod_binding.comp_rod_name},%(file_type)s" "${rod_binding.comp_input_rod}" "${rod_binding.comp_input_rod.ext}" "input_comp_${rod_binding.comp_rod_name}" + #end for + + @DBSNP_OPTIONS@ + + #for $rod_binding in $resource_rod_bind: + -d "--resource:${rod_binding.resource_rod_name},%(file_type)s" "${rod_binding.resource_input_rod}" "${rod_binding.resource_input_rod.ext}" "input_resource_${rod_binding.resource_rod_name}" + #end for + + #if str( $snpEff_rod_bind_type.snpEff_rod_bind_type_selector ) == 'set_snpEff': + -p '--annotation "SnpEff"' + -d "--snpEffFile:${snpEff_rod_bind_type.snpEff_rod_name},%(file_type)s" "${snpEff_rod_bind_type.snpEff_input_rod}" "${snpEff_rod_bind_type.snpEff_input_rod.ext}" "input_snpEff_${snpEff_rod_bind_type.snpEff_rod_name}" + #else: + -p '--excludeAnnotation "SnpEff"' + #end if + + #for $expression in $expressions: + -p '--expression "${expression.expression}"' + #end for + + #include source=$standard_gatk_options# + + -p ' + #if str( $annotation_group ) != "None": + #for $group in str( $annotation_group ).split( ',' ): + --group "${group}" + #end for + #end if + #if str( $family_string ) != "": + --family_string "${family_string}" + #end if + --MendelViolationGenotypeQualityThreshold "${mendel_violation_genotype_quality_threshold}" + ' + </command> + <inputs> + <conditional name="reference_source"> + <expand macro="reference_source_selector_param" /> + <when value="cached"> + <param name="input_variant" type="data" format="vcf" label="Variant file to annotate" help="-V,--variant &lt;variant&gt;"/> + <param name="input_variant_bti" type="boolean" truevalue="-BTI variant" falsevalue="" label="Increase efficiency for small variant files." help="-BTI variant"/> + <param name="input_bam" type="data" format="bam" label="BAM file" optional="True" help="Not needed for all annotations. (-I,--input_file &lt;input_file&gt;)" > + <validator type="unspecified_build" /> + <validator type="dataset_metadata_in_data_table" table_name="gatk2_picard_indexes" metadata_name="dbkey" metadata_column="dbkey" message="Sequences are not currently available for the specified build." /> <!-- fixme!!! this needs to be a select --> + </param> + <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &lt;reference_sequence&gt;"> + <options from_data_table="gatk2_picard_indexes"> + <filter type="data_meta" key="dbkey" ref="input_variant" column="dbkey"/> + </options> + <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> + </param> + </when> + <when value="history"> <!-- FIX ME!!!! --> + <param name="input_variant" type="data" format="vcf" label="Variant file to annotate" help="-V,--variant &lt;variant&gt;"/> + <param name="input_variant_bti" type="boolean" truevalue="-BTI variant" falsevalue="" label="Increase efficiency for small variant files." help="-BTI variant"/> + <param name="input_bam" type="data" format="bam" label="BAM file" optional="True" help="Not needed for all annotations. (-I,--input_file &lt;input_file&gt;)" /> + <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &lt;reference_sequence&gt;" /> + </when> + </conditional> + <conditional name="annotations_type"> + <param name="annotations_type_selector" type="select" label="Use all possible annotations"> + <option value="use_all_annotations">Use all</option> + <option value="choose" selected="True">Use selected</option> + </param> + <when value="use_all_annotations"> + <!-- no extra options here --> + </when> + <when value="choose"> + <param name="annotations" type="select" multiple="True" display="checkboxes" label="Annotations to apply" help="-A,--annotation &lt;annotation&gt;" > + <!-- load the available annotations from an external configuration file, since additional ones can be added to local installs --> + <options from_data_table="gatk2_annotations"> + <filter type="multiple_splitter" column="tools_valid_for" separator=","/> + <filter type="static_value" value="VariantAnnotator" column="tools_valid_for"/> + </options> + </param> + </when> + </conditional> + + <repeat name="additional_annotations" title="Additional annotation" help="-A,--annotation &lt;annotation&gt;"> + <param name="additional_annotation_name" type="text" value="" label="Annotation name" /> + </repeat> + + <repeat name="comp_rod_bind" title="Binding for reference-ordered comparison data" help="-comp,--comp &lt;comp&gt;"> + <param name="comp_input_rod" type="data" format="vcf" label="ROD file" /> + <param name="comp_rod_name" type="text" value="Unnamed" label="ROD Name"/> + </repeat> + <expand macro="dbsnp_param" /> + + <repeat name="resource_rod_bind" title="Binding for reference-ordered resource data" help="-resource,--resource &lt;resource&gt;"> + <param name="resource_input_rod" type="data" format="vcf" label="ROD file" /> + <param name="resource_rod_name" type="text" value="Unnamed" label="ROD Name"/> + </repeat> + + <conditional name="snpEff_rod_bind_type"> + <param name="snpEff_rod_bind_type_selector" type="select" label="Provide a snpEff reference-ordered data file (VCF)" help="-snpEffFile,--snpEffFile &lt;snpEffFile&gt;"> + <option value="set_snpEff">Set snpEff</option> + <option value="exclude_snpEff" selected="True">Don't set snpEff</option> + </param> + <when value="exclude_snpEff"> + <!-- Do nothing here --> + </when> + <when value="set_snpEff"> + <param name="snpEff_input_rod" type="data" format="vcf" label="ROD file" /> + <param name="snpEff_rod_name" type="hidden" value="snpEff" label="ROD Name"/> + </when> + </conditional> + + <repeat name="expressions" title="Expression" help="-E,--expression &lt;expression&gt;"> + <param name="expression" type="text" value="" label="Expression"/> + </repeat> + + <expand macro="gatk_param_type_conditional" /> + + <param name="annotation_group" type="select" multiple="True" display="checkboxes" label="annotation interfaces/groups to apply to variant calls" help="-G,--group &lt;group&gt;"> + <option value="RodRequiringAnnotation">RodRequiringAnnotation</option> + <option value="Standard">Standard</option> + <option value="Experimental">Experimental</option> + <option value="WorkInProgress">WorkInProgress</option> + <option value="RankSumTest">RankSumTest</option> + </param> + <param name="family_string" type="text" value="" label="Family String" help="--family_string"/> + <param name="mendel_violation_genotype_quality_threshold" type="float" value="0.0" label="genotype quality treshold in order to annotate mendelian violation ratio." help="-mvq,--MendelViolationGenotypeQualityThreshold &lt;MendelViolationGenotypeQualityThreshold&gt;"/> + <param name="exclude_annotations" type="select" multiple="True" display="checkboxes" label="Annotations to exclude" help="-XA,--excludeAnnotation &lt;excludeAnnotation&gt;" > + <!-- load the available annotations from an external configuration file, since additional ones can be added to local installs --> + <options from_data_table="gatk2_annotations"> + <filter type="multiple_splitter" column="tools_valid_for" separator=","/> + <filter type="static_value" value="VariantAnnotator" column="tools_valid_for"/> + </options> + </param> + + </inputs> + <outputs> + <data format="vcf" name="output_vcf" label="${tool.name} on ${on_string} (Variant File)" /> + <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" /> + </outputs> + <tests> + <test> + <param name="reference_source_selector" value="history" /> + <param name="ref_file" value="phiX.fasta" ftype="fasta" /> + <param name="input_bam" value="gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.bam" ftype="bam" /> + <param name="input_variant" value="gatk/gatk_unified_genotyper/gatk_unified_genotyper_out_1.vcf" ftype="vcf" /> + <param name="input_variant_bti" /> + <param name="annotations_type_selector" value="choose" /> + <param name="annotations" value="AlleleBalance,BaseQualityRankSumTest,DepthOfCoverage,HomopolymerRun,MappingQualityRankSumTest,MappingQualityZero,QualByDepth,RMSMappingQuality,SpanningDeletions,HaplotypeScore" /> + <param name="additional_annotations" value="0" /> + <param name="dbsnp_rod_bind_type_selector" value="set_dbsnp" /> + <param name="dbsnp_input_rod" value="gatk/fake_phiX_variant_locations.vcf" ftype="vcf" /> + <param name="dbsnp_rod_name" value="dbsnp" /> + <param name="snpEff_rod_bind_type_selector" value="exclude_snpEff" /> + <param name="gatk_param_type_selector" value="basic" /> + <output name="output_vcf" file="gatk/gatk_variant_annotator/gatk_variant_annotator_out_1.vcf" lines_diff="4" /> + <output name="output_log" file="gatk/gatk_variant_annotator/gatk_variant_annotator_out_1.log.contains" compare="contains" /> + <param name="comp_rod_bind" value="0" /> + <param name="resource_rod_bind" value="0" /> + <param name="expressions" value="0" /> + <!-- <param name="annotation_group" /> --> + </test> + </tests> + <help> +**What it does** + +Annotates variant calls with context information. Users can specify which of the available annotations to use. + +For more information on using the VariantAnnotator, see this `tool specific page <http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_annotator_VariantAnnotator.html>`_. + +To learn about best practices for variant detection using GATK, see this `overview <http://www.broadinstitute.org/gatk/guide/topic?name=best-practices>`_. + +If you encounter errors, please view the `GATK FAQ <http://www.broadinstitute.org/gatk/guide/topic?name=faqs>`_. + +------ + + +**Inputs** + +GenomeAnalysisTK: VariantAnnotator accepts a variant input file. + + +**Outputs** + +The output is in VCF format. + + +Go `here <http://www.broadinstitute.org/gatk/guide/topic?name=intro>`_ for details on GATK file formats. + +------- + +**Settings**:: + + + sampleName The sample (NA-ID) corresponding to the variant input (for non-VCF input only) + annotation One or more specific annotations to apply to variant calls + group One or more classes/groups of annotations to apply to variant calls + expression One or more specific expressions to apply to variant calls; see documentation for more details + useAllAnnotations Use all possible annotations (not for the faint of heart) + +@CITATION_SECTION@ + </help> + <expand macro="citations" /> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/variant_apply_recalibration.xml Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,136 @@ +<tool id="gatk2_variant_apply_recalibration" name="Apply Variant Recalibration" version="@VERSION@.1"> + <description></description> + <macros> + <import>gatk2_macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="version_command" /> + <command interpreter="python"> + gatk2_wrapper.py + --stdout "${output_log}" + #for $var_count, $variant in enumerate( $reference_source.input_variants ): + -d "--input:input_${var_count},%(file_type)s" "${variant}" "${variant.ext}" "input_variants_${var_count}" + #end for + -p ' + @JAR_PATH@ + -T "ApplyRecalibration" + \$GATK2_SITE_OPTIONS + + @THREADS@ + + #if $reference_source.reference_source_selector != "history": + -R "${reference_source.ref_file.fields.path}" + #end if + --recal_file "${reference_source.input_recal}" + --tranches_file "${reference_source.input_tranches}" + --out "${output_variants}" + ' + + #include source=$standard_gatk_options# + + ##start analysis specific options + -p ' + --mode "${mode}" + + #for $ignore_filter in $ignore_filters: + #set $ignore_filter_name = str( $ignore_filter.ignore_filter_type.ignore_filter_type_selector ) + #if $ignore_filter_name == "custom": + #set $ignore_filter_name = str( $ignore_filter.ignore_filter_type.filter_name ) + #end if + --ignore_filter "${ignore_filter_name}" + #end for + --ts_filter_level "${ts_filter_level}" + ' + </command> + <inputs> + <conditional name="reference_source"> + <expand macro="reference_source_selector_param" /> + <when value="cached"> + <expand macro="input_variants" /> + <param name="input_recal" type="data" format="gatk_recal" label="Variant Recalibration file" help="-recalFile,--recal_file &lt;recal_file&gt;" /> + <param name="input_tranches" type="data" format="gatk_tranche" label="Variant Tranches file" help="-tranchesFile,--tranches_file &lt;tranches_file&gt;" /> + <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &lt;reference_sequence&gt;"> + <options from_data_table="gatk2_picard_indexes"> + <!-- <filter type="data_meta" key="dbkey" ref="variants[0].input_variants" column="dbkey"/> --> + </options> + <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> + </param> + </when> + <when value="history"> <!-- FIX ME!!!! --> + <expand macro="input_variants" /> + <param name="input_recal" type="data" format="gatk_recal" label="Variant Recalibration file" help="-recalFile,--recal_file &lt;recal_file&gt;" /> + <param name="input_tranches" type="data" format="gatk_tranche" label="Variant Tranches file" help="-tranchesFile,--tranches_file &lt;tranches_file&gt;" /> + <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &lt;reference_sequence&gt;" /> + </when> + </conditional> + + <expand macro="gatk_param_type_conditional" /> + + <param name="mode" type="select" label="Recalibration mode" help="-mode,--mode &lt;mode&gt;"> + <option value="SNP" selected="True">SNP</option> + <option value="INDEL">INDEL</option> + <option value="BOTH">BOTH</option> + </param> + <repeat name="ignore_filters" title="Ignore Filter" help="-ignoreFilter,--ignore_filter &lt;ignore_filter&gt;"> + <conditional name="ignore_filter_type"> + <param name="ignore_filter_type_selector" type="select" label="Filter Type"> + <option value="HARD_TO_VALIDATE">HARD_TO_VALIDATE</option> + <option value="LowQual" >LowQual</option> + <option value="custom" selected="True">Other</option> + </param> + <when value="custom"> + <param name="filter_name" type="text" value="" label="Filter name"/> + </when> + <when value="HARD_TO_VALIDATE" /> + <when value="LowQual" /> + </conditional> + </repeat> + <param name="ts_filter_level" type="float" label="truth sensitivity level at which to start filtering, used here to indicate filtered variants in plots" value="99.0" help="-ts_filter_level,--ts_filter_level &lt;ts_filter_level&gt;"/> + </inputs> + <outputs> + <data format="vcf" name="output_variants" label="${tool.name} on ${on_string} (Variants File)" /> + <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" /> + </outputs> + <tests> + <!-- ADD TESTS --> + </tests> + <help> +**What it does** + +Applies cuts to the input vcf file (by adding filter lines) to achieve the desired novel FDR levels which were specified during VariantRecalibration + +For more information on using the ApplyRecalibration module, see this `tool specific page <http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_variantrecalibration_ApplyRecalibration.html>`_. + +To learn about best practices for variant detection using GATK, see this `overview <http://www.broadinstitute.org/gatk/guide/topic?name=best-practices>`_. + +If you encounter errors, please view the `GATK FAQ <http://www.broadinstitute.org/gatk/guide/topic?name=faqs>`_. + +------ + +**Inputs** + +GenomeAnalysisTK: ApplyRecalibration accepts a variant input file, a recalibration file and a tranches file. + + +**Outputs** + +The output is in VCF format. + +Go `here <http://www.broadinstitute.org/gatk/guide/topic?name=intro>`_ for details on GATK file formats. + +------- + +**Settings**:: + + + recal_file The output recal file used by ApplyRecalibration + tranches_file The input tranches file describing where to cut the data + out The output filtered, recalibrated VCF file + ts_filter_level The truth sensitivity level at which to start filtering + ignore_filter If specified the optimizer will use variants even if the specified filter name is marked in the input VCF file + mode Recalibration mode to employ: 1.) SNP for recalibrating only SNPs (emitting indels untouched in the output VCF); 2.) INDEL for indels; and 3.) BOTH for recalibrating both SNPs and indels simultaneously. (SNP|INDEL|BOTH) + +@CITATION_SECTION@ + </help> + <expand macro="citations" /> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/variant_combine.xml Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,168 @@ +<tool id="gatk2_variant_combine" name="Combine Variants" version="@VERSION@.0"> + <description></description> + <macros> + <import>gatk2_macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="version_command" /> + <command interpreter="python"> + gatk2_wrapper.py + --stdout "${output_log}" + + #set $priority_order = [] + #for $input_variant in $reference_source.input_variants: + -d "--variant:${input_variant.input_variant_name},%(file_type)s" "${input_variant.input_variant}" "${input_variant.input_variant.ext}" "input_variant_${input_variant.input_variant_name}" + #set $input_variant_name = str( $input_variant.input_variant_name ) + #assert $input_variant_name not in $priority_order, "Variant Names must be unique" ##this should be handled by a validator + #silent $priority_order.append( $input_variant_name ) + #end for + -p ' + @JAR_PATH@ + -T "CombineVariants" + --out "${output_variants}" + \$GATK2_SITE_OPTIONS + + @THREADS@ + + #if $reference_source.reference_source_selector != "history": + -R "${reference_source.ref_file.fields.path}" + #end if + --genotypemergeoption "${genotype_merge_option}" + --rod_priority_list "${ ','.join( $priority_order ) }" + ' + + #include source=$standard_gatk_options# + + ##start analysis specific options + #if $analysis_param_type.analysis_param_type_selector == "advanced": + -p ' + --filteredrecordsmergetype "${analysis_param_type.filtered_records_merge_type}" + ${analysis_param_type.print_complex_merges} + ${analysis_param_type.filtered_are_uncalled} + ${analysis_param_type.minimal_vcf} + ${analysis_param_type.assume_identical_samples} + + #if str( $analysis_param_type.set_key ): + --setKey "${analysis_param_type.set_key}" + #end if + + --minimumN "${analysis_param_type.minimum_n}" + ' + #end if + </command> + <inputs> + + <conditional name="reference_source"> + <expand macro="reference_source_selector_param" /> + <when value="cached"> + <repeat min="1" name="input_variants" title="Variants to Merge" help="Records will be prioritized in the order that you list them here (-V,--variant &lt;variant&gt;)"> + <param name="input_variant" type="data" format="vcf" label="Input variant file" /> + <param name="input_variant_name" type="text" value="" label="Variant name" help="Names must be unique"> + <validator type="length" min="1" message="You must provide a unique name for this set of variants" /> + </param> + </repeat> + <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &lt;reference_sequence&gt;"> + <options from_data_table="gatk2_picard_indexes"> + <!-- <filter type="data_meta" key="dbkey" ref="input_variants.input_variant" column="dbkey"/> --> + </options> + <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> + </param> + </when> + <when value="history"> <!-- FIX ME!!!! --> + <repeat min="1" name="input_variants" title="Variants to Merge" help="Records will be prioritized in the order that you list them here (-V,--variant &lt;variant&gt;)"> + <param name="input_variant" type="data" format="vcf" label="Input variant file" /> + <param name="input_variant_name" type="text" value="" label="Variant name" help="Names must be unique"> + <validator type="length" min="1" message="You must provide a unique name for this set of variants" /> + </param> + </repeat> + <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &lt;reference_sequence&gt;" /> + </when> + </conditional> + + <param name="genotype_merge_option" type="select" label="How should we merge genotype records across records for samples shared across the ROD files" help="-genotypeMergeOptions,--genotypemergeoption &lt;genotypemergeoption&gt;" > + <option value="UNIQUIFY" /> + <option value="PRIORITIZE" selected="true"/> + <option value="UNSORTED" /> + <option value="REQUIRE_UNIQUE" /> + </param> + + <expand macro="gatk_param_type_conditional" /> + + <expand macro="analysis_type_conditional"> + <param name="filtered_records_merge_type" type="select" label="How should we deal with records seen at the same site in the VCF, but with different FILTER fields?" help="-filteredRecordsMergeType,--filteredrecordsmergetype &lt;filteredrecordsmergetype&gt;" > + <option value="KEEP_IF_ANY_UNFILTERED" selected="true"/> + <option value="KEEP_IF_ALL_UNFILTERED" /> + </param> + + <param name="print_complex_merges" checked="false" type="boolean" truevalue="--printComplexMerges" falsevalue="" label="Print out interesting sites requiring complex compatibility merging" help="-printComplexMerges,--printComplexMerges" /> + <param name="filtered_are_uncalled" checked="false" type="boolean" truevalue="--filteredAreUncalled" falsevalue="" label="If true, then filtered VCFs are treated as uncalled, so that filtered set annotation don't appear in the combined VCF" help="-filteredAreUncalled,--filteredAreUncalled" /> + <param name="minimal_vcf" checked="false" type="boolean" truevalue="--minimalVCF" falsevalue="" label="If true, then the output VCF will contain no INFO or genotype INFO field" help="-minimalVCF,--minimalVCF" /> + + <param name="set_key" type="text" value="" label="Key, by default set, in the INFO key=value tag emitted describing which set the combined VCF record came from." help="-setKey,--setKey &lt;setKey&gt;"/> + <param name="assume_identical_samples" checked="false" type="boolean" truevalue="--assumeIdenticalSamples" falsevalue="" label="If true, assume input VCFs have identical sample sets and disjoint calls so that one can simply perform a merge sort to combine the VCFs into one, drastically reducing the runtime." help="-assumeIdenticalSamples,--assumeIdenticalSamples" /> + <param name="minimum_n" type="integer" value="1" label="Combine variants and output site only if variant is present in at least N input files." help="-minN,--minimumN &lt;minimumN&gt;"/> + </expand> + + </inputs> + <outputs> + <data format="vcf" name="output_variants" label="${tool.name} on ${on_string} (variants)" /> + <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" /> + </outputs> + <tests> + <test> + <param name="reference_source_selector" value="history" /> + <param name="ref_file" value="phiX.fasta" ftype="fasta" /> + <param name="input_variant" value="gatk/gatk_variant_annotator/gatk_variant_annotator_out_1.vcf" ftype="vcf" /> + <param name="input_variant_name" value="from_variant_annotator" /> + <param name="genotype_merge_option" value="PRIORITIZE" /> + <param name="gatk_param_type_selector" value="basic" /> + <param name="analysis_param_type_selector" value="basic" /> + <output name="output_variants" file="gatk/gatk_variant_combine/gatk_variant_combine_out_1.vcf" lines_diff="4" /> + <output name="output_log" file="gatk/gatk_variant_combine/gatk_variant_combine_out_1.log.contains" compare="contains" /> + </test> + </tests> + <help> +**What it does** + +Combines VCF records from different sources; supports both full merges and set unions. Merge: combines multiple records into a single one; if sample names overlap then they are uniquified. Union: assumes each rod represents the same set of samples (although this is not enforced); using the priority list (if provided), emits a single record instance at every position represented in the rods. + +For more information on using the CombineVariants module, see this `tool specific page <http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_variantutils_CombineVariants.html>`_. + +To learn about best practices for variant detection using GATK, see this `overview <http://www.broadinstitute.org/gatk/guide/topic?name=best-practices>`_. + +If you encounter errors, please view the `GATK FAQ <http://www.broadinstitute.org/gatk/guide/topic?name=faqs>`_. + +------ + +**Inputs** + +GenomeAnalysisTK: CombineVariants accepts variant files as input. + +------ + +**Outputs** + +The output is a combined vcf file. + + +Go `here <http://www.broadinstitute.org/gatk/guide/topic?name=intro>`_ for details on GATK file formats. + +------- + +**Settings**:: + + out File to which variants should be written + genotypemergeoption How should we merge genotype records for samples shared across the ROD files? (UNIQUIFY|PRIORITIZE|UNSORTED|REQUIRE_UNIQUE) + filteredrecordsmergetype How should we deal with records seen at the same site in the VCF, but with different FILTER fields? KEEP_IF_ANY_UNFILTERED PASSes the record if any record is unfiltered, KEEP_IF_ALL_UNFILTERED requires all records to be unfiltered (KEEP_IF_ANY_UNFILTERED|KEEP_IF_ALL_UNFILTERED) + rod_priority_list When taking the union of variants containing genotypes: a comma-separated string describing the priority ordering for the genotypes as far as which record gets emitted; a complete priority list MUST be provided + printComplexMerges Print out interesting sites requiring complex compatibility merging + filteredAreUncalled If true, then filtered VCFs are treated as uncalled, so that filtered set annotation don't appear in the combined VCF + minimalVCF If true, then the output VCF will contain no INFO or genotype INFO field + setKey Key, by default set, in the INFO key=value tag emitted describing which set the combined VCF record came from. Set to null if you don't want the set field emitted. + assumeIdenticalSamples If true, assume input VCFs have identical sample sets and disjoint calls so that one can simply perform a merge sort to combine the VCFs into one, drastically reducing the runtime. + minimumN Combine variants and output site only if variant is present in at least N input files. + +@CITATION_SECTION@ + </help> + <expand macro="citations" /> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/variant_eval.xml Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,276 @@ +<tool id="gatk2_variant_eval" name="Eval Variants" version="@VERSION@.1"> + <description></description> + <macros> + <import>gatk2_macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="version_command" /> + <command interpreter="python"> + #from binascii import hexlify + + gatk2_wrapper.py + --stdout "${output_log}" + #for $var_count, $variant in enumerate( $reference_source.input_variants ): + -d "--eval:input_${var_count},%(file_type)s" "${variant}" "${variant.ext}" "input_variants_${var_count}" + #end for + -p ' + @JAR_PATH@ + -T "VariantEval" + --out "${output_report}" + \$GATK2_SITE_OPTIONS + + @THREADS@ + + #if $reference_source.reference_source_selector != "history": + -R "${reference_source.ref_file.fields.path}" + #end if + ' + + #for $rod_binding in $comp_rod_bind: + -d "--comp:${rod_binding.comp_rod_name},%(file_type)s" "${rod_binding.comp_input_rod}" "${rod_binding.comp_input_rod.ext}" "input_comp_${rod_binding.comp_rod_name}" + #if str( $rod_binding.comp_known_names ): + -p '--known_names "${rod_binding.comp_rod_name}"' + #end if + #end for + + #if $dbsnp_rod_bind_type.dbsnp_rod_bind_type_selector == 'set_dbsnp' + -d "--dbsnp:${dbsnp_rod_bind_type.dbsnp_rod_name},%(file_type)s" "${dbsnp_rod_bind_type.dbsnp_input_rod}" "${dbsnp_rod_bind_type.dbsnp_input_rod.ext}" "input_dbsnp_${dbsnp_rod_bind_type.dbsnp_rod_name}" + #if $dbsnp_rod_bind_type.dbsnp_known_names + -p '--known_names "${dbsnp_rod_bind_type.dbsnp_rod_name}"' + #end if + #end if + + #include source=$standard_gatk_options# + + ##start analysis specific options + #if $analysis_param_type.analysis_param_type_selector == "advanced": + #for $stratification in $analysis_param_type.stratifications: + #set $select_string = "--select_exps '%s' --select_names '%s'" % ( str( $stratification.select_exps ), str( $stratification.select_name ) ) + -o '${ hexlify( $select_string ) }' + #end for + -p ' + + #for $sample in $analysis_param_type.samples: + --sample "${sample.sample}" + #end for + + #if str( $analysis_param_type.stratification_modules ) != "None": + #for $stratification_module in str( $analysis_param_type.stratification_modules).split( ',' ): + --stratificationModule "${stratification_module}" + #end for + #end if + + ${analysis_param_type.do_not_use_all_standard_stratifications} + + #for $variant_type in $analysis_param_type.only_variants_of_type: + --onlyVariantsOfType "${variant_type.variant_type}" + #end for + + #if str( $analysis_param_type.eval_modules ) != "None": + #for $eval_module in str( $analysis_param_type.eval_modules).split( ',' ): + --evalModule "${eval_module}" + #end for + #end if + + ${analysis_param_type.do_not_use_all_standard_modules} + + #if str( $analysis_param_type.num_samples ) != "0": + --numSamples "${analysis_param_type.num_samples}" + #end if + + --minPhaseQuality "${analysis_param_type.min_phase_quality}" + + --mendelianViolationQualThreshold "${analysis_param_type.mendelian_violation_qual_threshold}" + + #if str( $analysis_param_type.ancestral_alignments ) != "None": + --ancestralAlignments "${analysis_param_type.ancestral_alignments}" + #end if + ' + #if str( $analysis_param_type.known_cnvs ) != "None": + -d "--knownCNVs" "${analysis_param_type.known_cnvs}" "${analysis_param_type.known_cnvs.ext}" "input_known_cnvs" + #end if + + #if str( $analysis_param_type.strat_intervals ) != "None": + -d "--stratIntervals" "${analysis_param_type.strat_intervals}" "${analysis_param_type.strat_intervals.ext}" "input_strat_intervals" + #end if + #end if + </command> + <inputs> + + <conditional name="reference_source"> + <expand macro="reference_source_selector_param" /> + <when value="cached"> + <expand macro="input_variants" help="-eval,--eval &lt;eval&gt;"/> + <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &lt;reference_sequence&gt;"> + <options from_data_table="gatk2_picard_indexes"> + <!-- <filter type="data_meta" key="dbkey" ref="input_variant" column="dbkey"/> --> + </options> + <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> + </param> + </when> + <when value="history"> <!-- FIX ME!!!! --> + <expand macro="input_variants" help="-eval,--eval &lt;eval&gt;" /> + <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &lt;reference_sequence&gt;" /> + </when> + </conditional> + + <repeat name="comp_rod_bind" title="Comparison Reference-Ordered Data (ROD) file" help="-comp,--comp &lt;comp&gt;"> + <param name="comp_input_rod" type="data" format="vcf" label="Comparison ROD file" /> + <param name="comp_rod_name" type="text" value="" label="Comparison ROD name"> + <validator type="regex" message="Value must be a not empty string composed by alphanumeric characters and underscores">^\w+$</validator> + </param> + <param name="comp_known_names" type="boolean" label="Use comparison ROD file as known_names" help="-knownName,--known_names &lt;known_names&gt;"/> + </repeat> + <conditional name="dbsnp_rod_bind_type"> + <param name="dbsnp_rod_bind_type_selector" type="select" label="Provide a dbSNP Reference-Ordered Data (ROD) file" help="-D,--dbsnp &lt;dbsnp&gt;"> + <option value="set_dbsnp" selected="True">Set dbSNP</option> + <option value="exclude_dbsnp">Don't set dbSNP</option> + </param> + <when value="exclude_dbsnp" /> + <when value="set_dbsnp"> + <param name="dbsnp_input_rod" type="data" format="vcf" label="dbSNP ROD file" /> + <param name="dbsnp_rod_name" type="text" value="dbsnp" label="dbsnp ROD name"> + <validator type="regex" message="Value must be a not empty string composed by alphanumeric characters and underscores">^\w+$</validator> + </param> + <param name="dbsnp_known_names" type="boolean" label="Use dbSNP ROD file as known_names" help="-knownName,--known_names &lt;known_names&gt;" /> + </when> + </conditional> + + <expand macro="gatk_param_type_conditional" /> + + <expand macro="analysis_type_conditional"> + <repeat name="stratifications" title="Stratification"> + <param name="select_exps" value="" type="text" label="Stratification Expression" help="-select,--select_exps &lt;select_exps&gt;"> + <sanitizer> + <valid initial="string.printable"> + <remove value="'"/> + </valid> + <mapping initial="none"/> + </sanitizer> + </param> + <param name="select_name" value="" type="text" label="Name" help="-selectName,--select_names &lt;select_names&gt;"/> + </repeat> + + <repeat name="samples" title="Sample" help="-sn,--sample &lt;sample&gt;"> + <param name="sample" value="" type="text" label="Derive eval and comp contexts using only these sample genotypes, when genotypes are available in the original context"/> + </repeat> + + <param name="stratification_modules" type="select" multiple="True" display="checkboxes" label="Stratification modules to apply to the eval track(s)" help="-ST,--stratificationModule &lt;stratificationModule&gt;" > + <option value="AlleleCount" /> + <option value="AlleleFrequency" /> + <option value="CompRod" /> + <option value="Contig" /> + <option value="CpG" /> + <option value="Degeneracy" /> + <option value="EvalRod" /> + <option value="Filter" /> + <option value="FunctionalClass" /> + <option value="IndelSize" /> + <option value="IntervalStratification" /> + <option value="JexlExpression" /> + <option value="Novelty" /> + <option value="OneBPIndel" /> + <option value="Sample" /> + <option value="SnpEffPositionModifier" /> + <option value="TandemRepeat" /> + <option value="VariantType" /> + </param> + <param name="do_not_use_all_standard_stratifications" checked="false" type="boolean" truevalue="--doNotUseAllStandardStratifications" falsevalue="" label="Do not use the standard stratification modules by default" help="-noST,--doNotUseAllStandardStratifications" /> + + <repeat name="only_variants_of_type" title="only Variants Of Type" help="--onlyVariantsOfType"> + <param name="variant_type" type="text" value="" label="only variants of these types will be considered during the evaluation"/> + </repeat> + + <param name="eval_modules" type="select" multiple="True" display="checkboxes" label="Eval modules to apply to the eval track(s)" help="-EV,--evalModule &lt;evalModule&gt;" > + <option value="CompOverlap" /> + <option value="CountVariants" /> + <option value="IndelLengthHistogram" /> + <option value="IndelSummary" /> + <option value="MendelianViolationEvaluator" /> + <option value="MultiallelicSummary" /> + <option value="PrintMissingComp" /> + <option value="ThetaVariantEvaluator" /> + <option value="TiTvVariantEvaluator" /> + <option value="ValidationReport" /> + <option value="VariantSummary" /> + </param> + <param name="do_not_use_all_standard_modules" checked="false" type="boolean" truevalue="--doNotUseAllStandardModules" falsevalue="" label="Do not use the standard eval modules by default" help="-noEV,--doNotUseAllStandardModules" /> + + <param name="num_samples" type="integer" label="Number of samples (used if no samples are available in the VCF file" value="0" help="-ns,--numSamples &lt;numSamples&gt;"/> + <param name="min_phase_quality" type="float" label="Minimum phasing quality " value="10.0" help="-mpq,--minPhaseQuality &lt;minPhaseQuality&gt;"/> + <param name="mendelian_violation_qual_threshold" type="integer" label="Minimum genotype QUAL score for each trio member required to accept a site as a violation" value="50" help="-mvq,--mendelianViolationQualThreshold &lt;mendelianViolationQualThreshold&gt;"/> + <param name="ancestral_alignments" type="data" format="fasta" optional="True" label="Fasta file with ancestral alleles" help="-aa,--ancestralAlignments &lt;ancestralAlignments&gt;" /> + <param name="known_cnvs" type="data" format="bed,gatk_interval,picard_interval_list" optional="True" label="File containing tribble-readable features describing a known list of copy number variants" help="-knownCNVs,--knownCNVs &lt;knownCNVs&gt;" /> + <param name="strat_intervals" type="data" format="bed,gatk_interval,picard_interval_list" optional="True" label="File containing tribble-readable features for the IntervalStratificiation" help="-stratIntervals,--stratIntervals &lt;stratIntervals&gt;" /> + </expand> + + </inputs> + <outputs> + <data format="gatk_report" name="output_report" label="${tool.name} on ${on_string} (report)" /> + <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" /> + </outputs> + <tests> + <test> + <param name="reference_source_selector" value="history" /> + <param name="ref_file" value="phiX.fasta" ftype="fasta" /> + <param name="input_variant" value="gatk/gatk_variant_annotator/gatk_variant_annotator_out_1.vcf" ftype="vcf" /> + <param name="dbsnp_rod_bind_type_selector" value="set_dbsnp" /> + <param name="dbsnp_input_rod" value="gatk/fake_phiX_variant_locations.vcf" ftype="vcf" /> + <param name="dbsnp_rod_name" value="dbsnp" /> + <param name="dbsnp_known_names" value="True"/> + <param name="comp_rod_bind" value="0" /> + <param name="gatk_param_type_selector" value="basic" /> + <param name="analysis_param_type_selector" value="basic" /> + <output name="output_report" file="gatk/gatk_variant_eval/gatk_variant_eval_out_1.gatk_report" /> + <output name="output_log" file="gatk/gatk_variant_eval/gatk_variant_eval_out_1.log.contains" compare="contains" /> + </test> + </tests> + <help> +**What it does** + +General-purpose tool for variant evaluation (% in dbSNP, genotype concordance, Ti/Tv ratios, and a lot more) + +For more information on using the VariantEval module, see this `tool specific page <http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_varianteval_VariantEval.html>`_. + +To learn about best practices for variant detection using GATK, see this `overview <http://www.broadinstitute.org/gatk/guide/topic?name=best-practices>`_. + +If you encounter errors, please view the `GATK FAQ <http://www.broadinstitute.org/gatk/guide/topic?name=faqs>`_. + +------ + +**Inputs** + +GenomeAnalysisTK: VariantEval accepts variant files as input. + + +**Outputs** + +The output is a table of variant evaluation. + + +Go `here <http://www.broadinstitute.org/gatk/guide/topic?name=intro>`_ for details on GATK file formats. + +------- + +**Settings**:: + + out An output file presented to the walker. Will overwrite contents if file exists. + list List the available eval modules and exit + select_exps One or more stratifications to use when evaluating the data + select_names Names to use for the list of stratifications (must be a 1-to-1 mapping) + sample Derive eval and comp contexts using only these sample genotypes, when genotypes are available in the original context + known_names Name of ROD bindings containing variant sites that should be treated as known when splitting eval rods into known and novel subsets + stratificationModule One or more specific stratification modules to apply to the eval track(s) (in addition to the standard stratifications, unless -noS is specified) + doNotUseAllStandardStratifications Do not use the standard stratification modules by default (instead, only those that are specified with the -S option) + onlyVariantsOfType If provided, only variants of these types will be considered during the evaluation, in + evalModule One or more specific eval modules to apply to the eval track(s) (in addition to the standard modules, unless -noE is specified) + doNotUseAllStandardModules Do not use the standard modules by default (instead, only those that are specified with the -E option) + numSamples Number of samples (used if no samples are available in the VCF file + minPhaseQuality Minimum phasing quality + mendelianViolationQualThreshold Minimum genotype QUAL score for each trio member required to accept a site as a violation + ancestralAlignments Fasta file with ancestral alleles + +@CITATION_SECTION@ + </help> + <expand macro="citations" /> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/variant_filtration.xml Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,178 @@ +<tool id="gatk2_variant_filtration" name="Variant Filtration" version="@VERSION@.0"> + <description>on VCF files</description> + <macros> + <import>gatk2_macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="version_command" /> + <command interpreter="python"> + #from binascii import hexlify + + gatk2_wrapper.py + --stdout "${output_log}" + -d "--variant:variant,%(file_type)s" "${reference_source.input_variant}" "${reference_source.input_variant.ext}" "input_variant" + -p ' + @JAR_PATH@ + -T "VariantFiltration" + \$GATK2_SITE_OPTIONS + + -o "${output_vcf}" + + #if $reference_source.reference_source_selector != "history": + -R "${reference_source.ref_file.fields.path}" + #end if + ' + #for $variant_filter in $variant_filters: + #set $variant_filter = "--%sExpression '%s' --%sName '%s'" % ( str( $variant_filter.is_genotype_filter ), str( $variant_filter.filter_expression ), str( $variant_filter.is_genotype_filter ), str( $variant_filter.filter_name ) ) + -o '${ hexlify( $variant_filter ) }' + #end for + + #if str( $mask_rod_bind_type.mask_rod_bind_type_selector ) == 'set_mask': + -d "--mask:${mask_rod_bind_type.mask_rod_name},%(file_type)s" "${mask_rod_bind_type.input_mask_rod}" "${mask_rod_bind_type.input_mask_rod.ext}" "input_mask_${mask_rod_bind_type.mask_rod_name}" + -p ' + --maskExtension "${mask_rod_bind_type.mask_extension}" + --maskName "${mask_rod_bind_type.mask_rod_name}" + ' + #end if + + #include source=$standard_gatk_options# + + ##start analysis specific options + #if $cluster_snp_type.cluster_snp_type_selector == "cluster_snp": + -p ' + --clusterSize "${cluster_snp_type.cluster_size}" + --clusterWindowSize "${cluster_snp_type.cluster_window_size}" + ' + #end if + -p '${missing_values_in_expressions_should_evaluate_as_failing}' + </command> + <inputs> + <conditional name="reference_source"> + <expand macro="reference_source_selector_param" /> + <when value="cached"> + <param name="input_variant" type="data" format="vcf" label="Variant file to annotate" help="-V,--variant &lt;variant&gt;" /> + <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &lt;reference_sequence&gt;"> + <options from_data_table="gatk2_picard_indexes"> + <filter type="data_meta" key="dbkey" ref="input_variant" column="dbkey"/> + </options> + <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> + </param> + </when> + <when value="history"> <!-- FIX ME!!!! --> + <param name="input_variant" type="data" format="vcf" label="Variant file to annotate" help="-V,--variant &lt;variant&gt;" /> + <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &lt;reference_sequence&gt;" /> + </when> + </conditional> + + <repeat name="variant_filters" title="Variant Filters"> + <param name="filter_expression" value="AB < 0.2 || MQ0 > 50" type="text" label="Filter expression" help="JEXL formatted expressions (-filter,--filterExpression &lt;filterExpression&gt;)"> + <sanitizer> + <valid initial="string.printable"> + <remove value="'"/> + </valid> + <mapping initial="none"/> + </sanitizer> + </param> + <param name="filter_name" value="custom_filter" type="text" label="Filter name" help="-filterName,--filterName &lt;filterName&gt;"/> + <param name="is_genotype_filter" type="boolean" truevalue="genotypeFilter" falsevalue="filter" label="Use filter at the individual sample level" help="Use -G_filter,--genotypeFilterExpression &lt;genotypeFilterExpression&gt; and -G_filterName,--genotypeFilterName &lt;genotypeFilterName&gt; for filter type" /> + </repeat> + + <conditional name="mask_rod_bind_type"> + <param name="mask_rod_bind_type_selector" type="select" label="Provide a Mask reference-ordered data file"> + <option value="set_mask" selected="True">Set mask</option> + <option value="exclude_mask">Don't set mask</option> + </param> + <when value="exclude_mask"> + <!-- Do nothing here --> + </when> + <when value="set_mask"> + <param name="input_mask_rod" type="data" format="bed,gatk_dbsnp,vcf" label="Mask ROD file" help="--mask &lt;mask&gt;" /> + <param name="mask_rod_name" type="text" value="Mask" label="Mask Name" help="-maskName,--maskName &lt;maskName&gt;"/> + <param name="mask_extension" type="integer" value="0" label="Mask Extension" help="-maskExtend,--maskExtension &lt;maskExtension&gt;"/> + </when> + </conditional> + + <expand macro="gatk_param_type_conditional" /> + + <conditional name="cluster_snp_type"> + <param name="cluster_snp_type_selector" type="select" label="Cluster SNPs"> + <option value="cluster_snp">Cluster SNPs</option> + <option value="do_not_cluster_snp" selected="True">Do not cluster SNPs</option> + </param> + <when value="do_not_cluster_snp"> + <!-- Do nothing here --> + </when> + <when value="cluster_snp"> + <param name="cluster_size" type="integer" value="3" label="The number of SNPs which make up a cluster" help="-cluster,--clusterSize &lt;clusterSize&gt;"/> + <param name="cluster_window_size" type="integer" value="0" label="The window size (in bases) in which to evaluate clustered SNPs" help="-window,--clusterWindowSize &lt;clusterWindowSize&gt;"/> + </when> + </conditional> + + <param name="missing_values_in_expressions_should_evaluate_as_failing" type="boolean" truevalue="--missingValuesInExpressionsShouldEvaluateAsFailing" falsevalue="" label="Should missing values be considered failing the expression" help="--missingValuesInExpressionsShouldEvaluateAsFailing" /> + + </inputs> + <outputs> + <data format="vcf" name="output_vcf" label="${tool.name} on ${on_string} (Variant File)" /> + <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" /> + </outputs> + <tests> + <test> + <param name="reference_source_selector" value="history" /> + <param name="ref_file" value="phiX.fasta" ftype="fasta" /> + <param name="input_variant" value="gatk/gatk_variant_annotator/gatk_variant_annotator_out_1.vcf" ftype="vcf" /> + <param name="filter_expression" value="MQ < 37.74 || MQ0 > 50" /> + <param name="filter_name" value="Galaxy_filter" /> + <param name="is_genotype_filter" /> + <param name="mask_rod_bind_type_selector" value="set_mask" /> + <param name="input_mask_rod" value="gatk/fake_phiX_variant_locations.bed" ftype="bed" /> + <param name="mask_rod_name" value="." /> + <param name="mask_extension" value="0" /> + <param name="gatk_param_type_selector" value="basic" /> + <param name="cluster_snp_type_selector" value="do_not_cluster_snp" /> + <param name="missing_values_in_expressions_should_evaluate_as_failing" /> + <output name="output_vcf" file="gatk/gatk_variant_annotator/gatk_variant_annotator_out_1.vcf" lines_diff="4" /> + <output name="output_log" file="gatk/gatk_variant_filtration/gatk_variant_filtration_out_1.log.contains" compare="contains" /> + </test> + </tests> + <help> +**What it does** + +Filters variant calls using a number of user-selectable, parameterizable criteria. + +For more information on using the VariantFiltration module, see this `tool specific page <http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_filters_VariantFiltration.html>`_. + +To learn about best practices for variant detection using GATK, see this `overview <http://www.broadinstitute.org/gatk/guide/topic?name=best-practices>`_. + +If you encounter errors, please view the `GATK FAQ <http://www.broadinstitute.org/gatk/guide/topic?name=faqs>`_. + +------ + +**Inputs** + +GenomeAnalysisTK: VariantFiltration accepts a VCF input file. + + +**Outputs** + +The output is in VCF format. + +Go `here <http://www.broadinstitute.org/gatk/guide/topic?name=intro>`_ for details on GATK file formats. + +------- + +**Settings**:: + + + filterExpression One or more expression used with INFO fields to filter (see wiki docs for more info) + filterName Names to use for the list of filters (must be a 1-to-1 mapping); this name is put in the FILTER field for variants that get filtered + genotypeFilterExpression One or more expression used with FORMAT (sample/genotype-level) fields to filter (see wiki docs for more info) + genotypeFilterName Names to use for the list of sample/genotype filters (must be a 1-to-1 mapping); this name is put in the FILTER field for variants that get filtered + clusterSize The number of SNPs which make up a cluster (see also --clusterWindowSize); [default:3] + clusterWindowSize The window size (in bases) in which to evaluate clustered SNPs (to disable the clustered SNP filter, set this value to less than 1); [default:0] + maskName The text to put in the FILTER field if a 'mask' rod is provided and overlaps with a variant call; [default:'Mask'] + missingValuesInExpressionsShouldEvaluateAsFailing When evaluating the JEXL expressions, should missing values be considered failing the expression (by default they are considered passing)? + +@CITATION_SECTION@ + </help> + <expand macro="citations" /> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/variant_recalibrator.xml Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,411 @@ +<tool id="gatk2_variant_recalibrator" name="Variant Recalibrator" version="@VERSION@.1"> + <description></description> + <macros> + <import>gatk2_macros.xml</import> + </macros> + <expand macro="requirements"> + <requirement type="package" version="0.9.3">ggplot2</requirement> + </expand> + <expand macro="version_command" /> + <command interpreter="python"> + gatk2_wrapper.py + --stdout "${output_log}" + #for $var_count, $variant in enumerate( $reference_source.input_variants ): + -d "--input:input_${var_count},%(file_type)s" "${variant}" "${variant.ext}" "input_variants_${var_count}" + #end for + -p ' + @JAR_PATH@ + -T "VariantRecalibrator" + \$GATK2_SITE_OPTIONS + + @THREADS@ + + #if $reference_source.reference_source_selector != "history": + -R "${reference_source.ref_file.fields.path}" + #end if + --recal_file "${output_recal}" + --tranches_file "${output_tranches}" + --rscript_file "${output_rscript}" + ' + + #set $rod_binding_names = dict() + #for $rod_binding in $rod_bind: + #if str( $rod_binding.rod_bind_type.rod_bind_type_selector ) == 'custom': + #set $rod_bind_name = $rod_binding.rod_bind_type.custom_rod_name + #elif str( $rod_binding.rod_bind_type.rod_bind_type_selector ) == 'comp': + #set $rod_bind_name = "comp" + $rod_binding.rod_bind_type.custom_rod_name + #else + #set $rod_bind_name = $rod_binding.rod_bind_type.rod_bind_type_selector + #end if + #set $rod_binding_names[$rod_bind_name] = $rod_binding_names.get( $rod_bind_name, -1 ) + 1 + #if $rod_binding.rod_bind_type.rod_training_type.rod_training_type_selector == "not_training_truth_known": + -d "--resource:${rod_bind_name},%(file_type)s" "${rod_binding.rod_bind_type.input_rod}" "${rod_binding.rod_bind_type.input_rod.ext}" "input_${rod_bind_name}_${rod_binding_names[$rod_bind_name]}" + #else: + -d "--resource:${rod_bind_name},%(file_type)s,known=${rod_binding.rod_bind_type.rod_training_type.known},training=${rod_binding.rod_bind_type.rod_training_type.training},truth=${rod_binding.rod_bind_type.rod_training_type.truth},bad=${rod_binding.rod_bind_type.rod_training_type.bad},prior=${rod_binding.rod_bind_type.rod_training_type.prior}" "${rod_binding.rod_bind_type.input_rod}" "${rod_binding.rod_bind_type.input_rod.ext}" "input_${rod_bind_name}_${rod_binding_names[$rod_bind_name]}" + #end if + #end for + + #include source=$standard_gatk_options# + + ##start analysis specific options + -p ' + #if str( $annotations ) != "None": + #for $annotation in str( $annotations.fields.gatk_value ).split( ',' ): + --use_annotation "${annotation}" + #end for + #end if + #for $additional_annotation in $additional_annotations: + --use_annotation "${additional_annotation.additional_annotation_name}" + #end for + --mode "${mode}" + ' + + #if $analysis_param_type.analysis_param_type_selector == "advanced": + -p ' + --maxGaussians "${analysis_param_type.max_gaussians}" + --maxIterations "${analysis_param_type.max_iterations}" + --numKMeans "${analysis_param_type.num_k_means}" + --stdThreshold "${analysis_param_type.std_threshold}" + --shrinkage "${analysis_param_type.shrinkage}" + --dirichlet "${analysis_param_type.dirichlet}" + --priorCounts "${analysis_param_type.prior_counts}" + + --minNumBadVariants "${analysis_param_type.min_num_bad_variants}" + + --target_titv "${analysis_param_type.target_titv}" + #for $tranche in [ $tranche.strip() for $tranche in str( $analysis_param_type.ts_tranche ).split( ',' ) if $tranche.strip() ] + --TStranche "${tranche}" + #end for + #for $ignore_filter in $analysis_param_type.ignore_filters: + #set $ignore_filter_name = str( $ignore_filter.ignore_filter_type.ignore_filter_type_selector ) + #if $ignore_filter_name == "custom": + #set $ignore_filter_name = str( $ignore_filter.ignore_filter_type.filter_name ) + #end if + --ignore_filter "${ignore_filter_name}" + #end for + ' + #end if + + && + mv "${output_rscript}.pdf" "${output_tranches_pdf}" + + </command> + <inputs> + <conditional name="reference_source"> + <expand macro="reference_source_selector_param" /> + <when value="cached"> + <expand macro="input_variants" /> + <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &lt;reference_sequence&gt;"> + <options from_data_table="gatk2_picard_indexes"> + <!-- <filter type="data_meta" key="dbkey" ref="variants[0].input_variants" column="dbkey"/> --> + </options> + <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> + </param> + </when> + <when value="history"> <!-- FIX ME!!!! --> + <expand macro="input_variants" /> + <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &lt;reference_sequence&gt;" /> + </when> + </conditional> + + <repeat name="rod_bind" title="Binding for reference-ordered data" help="-resource,--resource &lt;resource&gt;" min="2"> + <conditional name="rod_bind_type"> + <param name="rod_bind_type_selector" type="select" label="Binding Type"> + <option value="dbsnp" selected="True">dbSNP</option> + <option value="variant">Variants</option> + <option value="snps">SNPs</option> + <option value="indels">INDELs</option> + <option value="hapmap">HapMap</option> + <option value="omni">OMNI</option> + <option value="mask">Mask</option> + <option value="custom">Custom</option> + <option value="comp">Comp</option> + </param> + <when value="variant"> + <param name="input_rod" type="data" format="vcf" label="Variant ROD file" /> + <conditional name="rod_training_type"> + <param name="rod_training_type_selector" type="select" label="Use as training/truth/known sites"> + <option value="is_training_truth_known">Set training/truth/known sites</option> + <option value="not_training_truth_known" selected="True">Don't Set options</option> + </param> + <when value="not_training_truth_known"> + <!-- do nothing here --> + </when> + <when value="is_training_truth_known"> + <param name="known" type="boolean" label="Is Known Site" truevalue="true" falsevalue="false"/> + <param name="training" type="boolean" label="Is Training Site" truevalue="true" falsevalue="false"/> + <param name="truth" type="boolean" label="Is Truth Site" truevalue="true" falsevalue="false"/> + <param name="bad" type="boolean" label="Is Bad Site" truevalue="true" falsevalue="false"/> + <param name="prior" type="float" label="prior probability of being true" value="12.0"/> + </when> + </conditional> + </when> + <when value="comp"> + <param name="input_rod" type="data" format="vcf" label="ROD file" /> + <param name="custom_rod_name" type="text" value="Unnamed" label="ROD Name"/> + <conditional name="rod_training_type"> + <param name="rod_training_type_selector" type="select" label="Use as training/truth/known sites"> + <option value="is_training_truth_known">Set training/truth/known sites</option> + <option value="not_training_truth_known" selected="True">Don't Set options</option> + </param> + <when value="not_training_truth_known"> + <!-- do nothing here --> + </when> + <when value="is_training_truth_known"> + <param name="known" type="boolean" label="Is Known Site" truevalue="true" falsevalue="false"/> + <param name="training" type="boolean" label="Is Training Site" truevalue="true" falsevalue="false"/> + <param name="truth" type="boolean" label="Is Truth Site" truevalue="true" falsevalue="false"/> + <param name="bad" type="boolean" label="Is Bad Site" truevalue="true" falsevalue="false"/> + <param name="prior" type="float" label="prior probability of being true" value="12.0"/> + </when> + </conditional> + </when> + <when value="mask"> + <param name="input_rod" type="data" format="vcf" label="ROD file" /> + <conditional name="rod_training_type"> + <param name="rod_training_type_selector" type="select" label="Use as training/truth/known sites"> + <option value="is_training_truth_known">Set training/truth/known sites</option> + <option value="not_training_truth_known" selected="True">Don't Set options</option> + </param> + <when value="not_training_truth_known"> + <!-- do nothing here --> + </when> + <when value="is_training_truth_known"> + <param name="known" type="boolean" label="Is Known Site" truevalue="true" falsevalue="false"/> + <param name="training" type="boolean" label="Is Training Site" truevalue="true" falsevalue="false"/> + <param name="truth" type="boolean" label="Is Truth Site" truevalue="true" falsevalue="false"/> + <param name="bad" type="boolean" label="Is Bad Site" truevalue="true" falsevalue="false"/> + <param name="prior" type="float" label="prior probability of being true" value="12.0"/> + </when> + </conditional> + </when> + <when value="dbsnp"> + <param name="input_rod" type="data" format="vcf" label="ROD file" /> + <conditional name="rod_training_type"> + <param name="rod_training_type_selector" type="select" label="Use as training/truth/known sites"> + <option value="is_training_truth_known">Set training/truth/known sites</option> + <option value="not_training_truth_known" selected="True">Don't Set options</option> + </param> + <when value="not_training_truth_known"> + <!-- do nothing here --> + </when> + <when value="is_training_truth_known"> + <param name="known" type="boolean" label="Is Known Site" truevalue="true" falsevalue="false"/> + <param name="training" type="boolean" label="Is Training Site" truevalue="true" falsevalue="false"/> + <param name="truth" type="boolean" label="Is Truth Site" truevalue="true" falsevalue="false"/> + <param name="bad" type="boolean" label="Is Bad Site" truevalue="true" falsevalue="false"/> + <param name="prior" type="float" label="prior probability of being true" value="12.0"/> + </when> + </conditional> + </when> + <when value="snps"> + <param name="input_rod" type="data" format="vcf" label="ROD file" /> + <conditional name="rod_training_type"> + <param name="rod_training_type_selector" type="select" label="Use as training/truth/known sites"> + <option value="is_training_truth_known">Set training/truth/known sites</option> + <option value="not_training_truth_known" selected="True">Don't Set options</option> + </param> + <when value="not_training_truth_known"> + <!-- do nothing here --> + </when> + <when value="is_training_truth_known"> + <param name="known" type="boolean" label="Is Known Site" truevalue="true" falsevalue="false"/> + <param name="training" type="boolean" label="Is Training Site" truevalue="true" falsevalue="false"/> + <param name="truth" type="boolean" label="Is Truth Site" truevalue="true" falsevalue="false"/> + <param name="bad" type="boolean" label="Is Bad Site" truevalue="true" falsevalue="false"/> + <param name="prior" type="float" label="prior probability of being true" value="12.0"/> + </when> + </conditional> + </when> + <when value="hapmap"> + <param name="input_rod" type="data" format="vcf" label="ROD file" /> + <conditional name="rod_training_type"> + <param name="rod_training_type_selector" type="select" label="Use as training/truth/known sites"> + <option value="is_training_truth_known">Set training/truth/known sites</option> + <option value="not_training_truth_known" selected="True">Don't Set options</option> + </param> + <when value="not_training_truth_known"> + <!-- do nothing here --> + </when> + <when value="is_training_truth_known"> + <param name="known" type="boolean" label="Is Known Site" truevalue="true" falsevalue="false"/> + <param name="training" type="boolean" label="Is Training Site" truevalue="true" falsevalue="false"/> + <param name="truth" type="boolean" label="Is Truth Site" truevalue="true" falsevalue="false"/> + <param name="bad" type="boolean" label="Is Bad Site" truevalue="true" falsevalue="false"/> + <param name="prior" type="float" label="prior probability of being true" value="12.0"/> + </when> + </conditional> + </when> + <when value="omni"> + <param name="input_rod" type="data" format="vcf" label="ROD file" /> + <conditional name="rod_training_type"> + <param name="rod_training_type_selector" type="select" label="Use as training/truth/known sites"> + <option value="is_training_truth_known">Set training/truth/known sites</option> + <option value="not_training_truth_known" selected="True">Don't Set options</option> + </param> + <when value="not_training_truth_known"> + <!-- do nothing here --> + </when> + <when value="is_training_truth_known"> + <param name="known" type="boolean" label="Is Known Site" truevalue="true" falsevalue="false"/> + <param name="training" type="boolean" label="Is Training Site" truevalue="true" falsevalue="false"/> + <param name="truth" type="boolean" label="Is Truth Site" truevalue="true" falsevalue="false"/> + <param name="bad" type="boolean" label="Is Bad Site" truevalue="true" falsevalue="false"/> + <param name="prior" type="float" label="prior probability of being true" value="12.0"/> + </when> + </conditional> + </when> + <when value="indels"> + <param name="input_rod" type="data" format="vcf" label="ROD file" /> + <conditional name="rod_training_type"> + <param name="rod_training_type_selector" type="select" label="Use as training/truth/known sites"> + <option value="is_training_truth_known">Set training/truth/known sites</option> + <option value="not_training_truth_known" selected="True">Don't Set options</option> + </param> + <when value="not_training_truth_known"> + <!-- do nothing here --> + </when> + <when value="is_training_truth_known"> + <param name="known" type="boolean" label="Is Known Site" truevalue="true" falsevalue="false"/> + <param name="training" type="boolean" label="Is Training Site" truevalue="true" falsevalue="false"/> + <param name="truth" type="boolean" label="Is Truth Site" truevalue="true" falsevalue="false"/> + <param name="bad" type="boolean" label="Is Bad Site" truevalue="true" falsevalue="false"/> + <param name="prior" type="float" label="prior probability of being true" value="12.0"/> + </when> + </conditional> + </when> + <when value="custom"> + <param name="custom_rod_name" type="text" value="Unknown" label="ROD Name"/> + <param name="input_rod" type="data" format="vcf" label="ROD file" /> + <conditional name="rod_training_type"> + <param name="rod_training_type_selector" type="select" label="Use as training/truth/known sites"> + <option value="is_training_truth_known">Set training/truth/known sites</option> + <option value="not_training_truth_known" selected="True">Don't Set options</option> + </param> + <when value="not_training_truth_known"> + <!-- do nothing here --> + </when> + <when value="is_training_truth_known"> + <param name="known" type="boolean" label="Is Known Site" truevalue="true" falsevalue="false"/> + <param name="training" type="boolean" label="Is Training Site" truevalue="true" falsevalue="false"/> + <param name="truth" type="boolean" label="Is Truth Site" truevalue="true" falsevalue="false"/> + <param name="bad" type="boolean" label="Is Bad Site" truevalue="true" falsevalue="false"/> + <param name="prior" type="float" label="prior probability of being true" value="12.0"/> + </when> + </conditional> + </when> + </conditional> + </repeat> + + <param name="annotations" type="select" multiple="True" display="checkboxes" label="annotations which should used for calculations" help="-an,--use_annotation &lt;use_annotation&gt;"> + <!-- load the available annotations from an external configuration file, since additional ones can be added to local installs --> + <options from_data_table="gatk2_annotations"> + <filter type="multiple_splitter" column="tools_valid_for" separator=","/> + <filter type="static_value" value="VariantRecalibrator" column="tools_valid_for"/> + </options> + </param> + + <repeat name="additional_annotations" title="Additional annotation" help="-an,--use_annotation &lt;use_annotation&gt;"> + <param name="additional_annotation_name" type="text" value="" label="Annotation name" /> + </repeat> + + <param name="mode" type="select" label="Recalibration mode" help="-mode,--mode &lt;mode&gt;"> + <option value="SNP" selected="True">SNP</option> + <option value="INDEL">INDEL</option> + <option value="BOTH">BOTH</option> + </param> + + <expand macro="gatk_param_type_conditional" /> + + <expand macro="analysis_type_conditional"> + <param name="max_gaussians" type="integer" label="maximum number of Gaussians to try during variational Bayes Algorithm" value="8" help="-mG,--maxGaussians &lt;maxGaussians&gt;"/> + <param name="max_iterations" type="integer" label="maximum number of maximum number of VBEM iterations to be performed in variational Bayes Algorithm" value="150" help="-mI,--maxIterations &lt;maxIterations&gt;"/> + <param name="num_k_means" type="integer" label="number of k-means iterations to perform in order to initialize the means of the Gaussians in the Gaussian mixture model" value="100" help="-nKM,--numKMeans &lt;numKMeans&gt;"/> + <param name="std_threshold" type="float" label="If a variant has annotations more than -std standard deviations away from mean then don't use it for building the Gaussian mixture model." value="10.0" help="-std,--stdThreshold &lt;stdThreshold&gt;"/> + <param name="shrinkage" type="float" label="shrinkage parameter in variational Bayes algorithm" value="1.0" help="-shrinkage,--shrinkage &lt;shrinkage&gt;"/> + <param name="dirichlet" type="float" label="dirichlet parameter in variational Bayes algorithm" value="0.001" help="-dirichlet,--dirichlet &lt;dirichlet&gt;"/> + <param name="prior_counts" type="float" label="number of prior counts to use in variational Bayes algorithm" value="20.0" help="-priorCounts,--priorCounts &lt;priorCounts&gt;"/> + <!--<param name="trustAllPolymorphic" type="boolean" label="trustAllPolymorphic" truevalue="-/-trustAllPolymorphic=true" falsevalue="-/-trustAllPolymorphic=false" + help="Trust that all the input training sets' unfiltered records contain only polymorphic sites to drastically speed up the computation. -trustAllPolymorphic" />--> + <param name="min_num_bad_variants" type="integer" label="Minimum number of worst scoring variants to use when building the Gaussian mixture model of bad variants" value="1000" help="--minNumBadVariants &lt;minNumBadVariants&gt;"/> + <param name="target_titv" type="float" label="expected novel Ti/Tv ratio to use when calculating FDR tranches and for display on optimization curve output figures. (approx 2.15 for whole genome experiments). ONLY USED FOR PLOTTING PURPOSES!" value="2.15" help="-titv,--target_titv &lt;target_titv&gt;"/> + <param name="ts_tranche" type="text" label="levels of novel false discovery rate (FDR, implied by ti/tv) at which to slice the data. (in percent, that is 1.0 for 1 percent)" value="100.0, 99.9, 99.0, 90.0" help="-tranche,--TStranche &lt;TStranche&gt;"/> + <repeat name="ignore_filters" title="Ignore Filter" help="-ignoreFilter,--ignore_filter &lt;ignore_filter&gt;"> + <conditional name="ignore_filter_type"> + <param name="ignore_filter_type_selector" type="select" label="Filter Type"> + <option value="HARD_TO_VALIDATE">HARD_TO_VALIDATE</option> + <option value="LowQual" >LowQual</option> + <option value="custom" selected="True">Other</option> + </param> + <when value="custom"> + <param name="filter_name" type="text" value="" label="Filter name"/> + </when> + <when value="HARD_TO_VALIDATE" /> + <when value="LowQual" /> + </conditional> + </repeat> + </expand> + </inputs> + <outputs> + <data format="gatk_recal" name="output_recal" label="${tool.name} on ${on_string} (Recalibration File)" /> + <data format="gatk_tranche" name="output_tranches" label="${tool.name} on ${on_string} (Tranches File)" /> + <data format="txt" name="output_rscript" label="${tool.name} on ${on_string} (RScript File)" /> + <data format="pdf" name="output_tranches_pdf" label="${tool.name} on ${on_string} (PDF File)" /> + <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" /> + </outputs> + <tests> + <!-- ADD TESTS --> + </tests> + <help> +**What it does** + +Takes variant calls as .vcf files, learns a Gaussian mixture model over the variant annotations and evaluates the variant -- assigning an informative lod score + +For more information on using the VariantRecalibrator module, see this `tool specific page <http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_variantrecalibration_VariantRecalibrator.html>`_. + +To learn about best practices for variant detection using GATK, see this `overview <http://www.broadinstitute.org/gatk/guide/topic?name=best-practices>`_. + +If you encounter errors, please view the `GATK FAQ <http://www.broadinstitute.org/gatk/guide/topic?name=faqs>`_. + +------ + +**Inputs** + +GenomeAnalysisTK: VariantRecalibrator accepts a variant input file. + + +**Outputs** + +The output is in VCF format. + + +Go `here <http://www.broadinstitute.org/gatk/guide/topic?name=intro>`_ for details on GATK file formats. + +------- + +**Settings**:: + + + tranches_file The output tranches file used by ApplyRecalibration + use_annotation The names of the annotations which should used for calculations + mode Recalibration mode to employ: 1.) SNP for recalibrating only snps (emitting indels untouched in the output VCF); 2.) INDEL for indels; and 3.) BOTH for recalibrating both snps and indels simultaneously. (SNP|INDEL|BOTH) + maxGaussians The maximum number of Gaussians to try during variational Bayes algorithm + maxIterations The maximum number of VBEM iterations to be performed in variational Bayes algorithm. Procedure will normally end when convergence is detected. + numKMeans The number of k-means iterations to perform in order to initialize the means of the Gaussians in the Gaussian mixture model. + stdThreshold If a variant has annotations more than -std standard deviations away from mean then don't use it for building the Gaussian mixture model. + shrinkage The shrinkage parameter in variational Bayes algorithm. + dirichlet The dirichlet parameter in variational Bayes algorithm. + priorCounts The number of prior counts to use in variational Bayes algorithm. + minNumBadVariants The minimum amount of worst scoring variants to use when building the Gaussian mixture model of bad variants. + recal_file The output recal file used by ApplyRecalibration + target_titv The expected novel Ti/Tv ratio to use when calculating FDR tranches and for display on optimization curve output figures. (approx 2.15 for whole genome experiments). ONLY USED FOR PLOTTING PURPOSES! + TStranche The levels of novel false discovery rate (FDR, implied by ti/tv) at which to slice the data. (in percent, that is 1.0 for 1 percent) + ignore_filter If specified the optimizer will use variants even if the specified filter name is marked in the input VCF file + path_to_Rscript The path to your implementation of Rscript. For Broad users this is maybe /broad/tools/apps/R-2.6.0/bin/Rscript + rscript_file The output rscript file generated by the VQSR to aid in visualization of the input data and learned model + path_to_resources Path to resources folder holding the Sting R scripts. + +@CITATION_SECTION@ + </help> + <expand macro="citations" /> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/variant_select.xml Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,283 @@ +<tool id="gatk2_variant_select" name="Select Variants" version="@VERSION@.2"> + <description>from VCF files</description> + <macros> + <import>gatk2_macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="version_command" /> + <command interpreter="python"> + #from binascii import hexlify + + gatk2_wrapper.py + --stdout "${output_log}" + -d "--variant:variant,%(file_type)s" "${reference_source.input_variant}" "${reference_source.input_variant.ext}" "input_variant" + -p ' + @JAR_PATH@ + -T "SelectVariants" + \$GATK2_SITE_OPTIONS + + @THREADS@ + -o "${output_vcf}" + + #if $reference_source.reference_source_selector != "history": + -R "${reference_source.ref_file.fields.path}" + #end if + ' + -p ' + #if $input_concordance: + --concordance "${input_concordance}" + #end if + #if $input_discordance: + --discordance "${input_discordance}" + #end if + + #for $exclude_sample_name in $exclude_sample_name_repeat: + --exclude_sample_name "${exclude_sample_name.exclude_sample_name}" + #end for + + ${exclude_filtered} + + #for $sample_name in $sample_name_repeat: + --sample_name "${sample_name.sample_name}" + #end for + ' + + #for $select_expressions in $select_expressions_repeat: + #set $select_expression = "--select_expressions '%s'" % ( str( $select_expressions.select_expressions ) ) + -o '${ hexlify( $select_expression ) }' + #end for + + ##start tool specific options + #if str( $analysis_param_type.analysis_param_type_selector ) == 'advanced': + -p ' + #for $esf in $analysis_param_type.exclude_sample_file: + --exclude_sample_file "${esf}" + #end for + + #for $sf in $analysis_param_type.sample_file: + --sample_file "${sf}" + #end for + + #if $analysis_param_type.input_keep_ids: + --keepIDs "${analysis_param_type.input_keep_ids}" + #end if + + ${analysis_param_type.keep_original_AC} + + ${analysis_param_type.mendelian_violation} + + --mendelianViolationQualThreshold "${analysis_param_type.mendelian_violation_qual_threshold}" + + --remove_fraction_genotypes "${analysis_param_type.remove_fraction_genotypes}" + + --restrictAllelesTo "${analysis_param_type.restrict_alleles_to}" + + #if str( $analysis_param_type.select_random_type.select_random_type_selector ) == 'select_random_fraction': + --select_random_fraction "${analysis_param_type.select_random_type.select_random_fraction}" + #elif str( $analysis_param_type.select_random_type.select_random_type_selector ) == 'select_random_number': + --select_random_number "${analysis_param_type.select_random_type.select_random_number}" + #end if + + #if $analysis_param_type.select_type_to_include: + #for $type_to_include in str( $analysis_param_type.select_type_to_include ).split( ',' ): + --selectTypeToInclude "${type_to_include}" + #end for + #end if + + ${analysis_param_type.exclude_non_variants} + ' + + #for $sample_expressions in $analysis_param_type.sample_expressions_repeat: + #set $sample_expression = "--sample_expressions '%s'" % ( str( $sample_expressions.sample_expressions ) ) + -o '${ hexlify( $sample_expression ) }' + #end for + + #end if + ##end tool specific options + + #include source=$standard_gatk_options# + </command> + <inputs> + <conditional name="reference_source"> + <expand macro="reference_source_selector_param" /> + <when value="cached"> + <param name="input_variant" type="data" format="vcf" label="Variant file to select" help="-V,--variant &lt;variant&gt;" /> + <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &lt;reference_sequence&gt;"> + <options from_data_table="gatk2_picard_indexes"> + <filter type="data_meta" key="dbkey" ref="input_variant" column="dbkey"/> + </options> + <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> + </param> + </when> + <when value="history"> <!-- FIX ME!!!! --> + <param name="input_variant" type="data" format="vcf" label="Variant file to select" help="-V,--variant &lt;variant&gt;" /> + <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &lt;reference_sequence&gt;" /> + </when> + </conditional> + + <repeat name="select_expressions_repeat" title="Criteria to use when selecting the data" help="-select,--select_expressions &lt;select_expressions&gt;"> + <param name="select_expressions" type="text" label="JEXL expression"> + <sanitizer> + <valid initial="string.printable"> + <remove value="'"/> + </valid> + <mapping initial="none"/> + </sanitizer> + </param> + </repeat> + + <param name="input_concordance" type="data" format="vcf" label="Output variants that were also called in this comparison track" optional="True" help="-conc,--concordance &lt;concordance&gt;"/> + <param name="input_discordance" type="data" format="vcf" label="Output variants that were not called in this comparison track" optional="True" help="-disc,--discordance &lt;discordance&gt;"/> + + <repeat name="sample_name_repeat" title="Include Samples by name" help="-sn,--sample_name &lt;sample_name&gt;"> + <param name="sample_name" type="text" label="Include genotypes from this sample"/> + </repeat> + + <repeat name="exclude_sample_name_repeat" title="Exclude Samples by name" help="-xl_sn,--exclude_sample_name &lt;exclude_sample_name&gt;"> + <param name="exclude_sample_name" type="text" label="Exclude genotypes from this sample"/> + </repeat> + + <param name="exclude_filtered" type="boolean" truevalue="--excludeFiltered" falsevalue="" label="Don't include filtered loci in the analysis" help="-ef,--excludeFiltered" /> + + <expand macro="gatk_param_type_conditional" /> + + <expand macro="analysis_type_conditional"> + + <param name="exclude_sample_file" type="data" format="txt" multiple="True" label="Exclude Samples by file" help="File containing a list of samples (one per line) to exclude (-xl_sf,--exclude_sample_file &lt;exclude_sample_file&gt;)"/> + + <param name="sample_file" type="data" format="txt" multiple="True" label="Samples by file" help="File containing a list of samples (one per line) to include (-sf,--sample_file &lt;sample_file&gt;)"/> + + <param name="input_keep_ids" type="data" format="txt" label="Only emit sites whose ID is found in this file" optional="True" help="-IDs,--keepIDs &lt;keepIDs&gt;"/> + + <param name="keep_original_AC" type="boolean" truevalue="--keepOriginalAC" falsevalue="" label="Don't update the AC, AF, or AN values in the INFO field after selecting" help="-keepOriginalAC,--keepOriginalAC" /> + + <param name="mendelian_violation" type="boolean" truevalue="--mendelianViolation" falsevalue="" label="output mendelian violation sites only" help="-mv,--mendelianViolation" /> + + <param name="mendelian_violation_qual_threshold" type="float" label="Minimum genotype QUAL score for each trio member required to accept a site as a mendelian violation" value="0" help="-mvq,--mendelianViolationQualThreshold &lt;mendelianViolationQualThreshold&gt;" /> + + <param name="remove_fraction_genotypes" type="float" label="Selects a fraction (a number between 0 and 1) of the total genotypes at random from the variant track and sets them to nocall" value="0" min="0" max="1" help="-fractionGenotypes,--remove_fraction_genotypes &lt;remove_fraction_genotypes&gt;" /> + + <param name="restrict_alleles_to" type="select" label="Select only variants of a particular allelicity" help="-restrictAllelesTo,--restrictAllelesTo &lt;restrictAllelesTo&gt;"> + <option value="ALL" selected="True">ALL</option> + <option value="MULTIALLELIC">MULTIALLELIC</option> + <option value="BIALLELIC">BIALLELIC</option> + </param> + + <repeat name="sample_expressions_repeat" title="Regular expression to select many samples from the ROD tracks provided" help="-se,--sample_expressions &lt;sample_expressions&gt;"> + <param name="sample_expressions" type="text" label="Regular expression"> + <sanitizer> + <valid initial="string.printable"> + <remove value="'"/> + </valid> + <mapping initial="none"/> + </sanitizer> + </param> + </repeat> + + <conditional name="select_random_type"> + <param name="select_random_type_selector" type="select" label="Select a random subset of variants"> + <option value="select_all" selected="True">Use all variants</option> + <option value="select_random_fraction">Select random fraction</option> + <option value="select_random_number">Select random number</option> + </param> + <when value="select_all"> + <!-- Do nothing here --> + </when> + <when value="select_random_fraction"> + <param name="select_random_fraction" type="float" value="0" label="Fraction" min="0" max="1" help="-fraction,--select_random_fraction &lt;select_random_fraction&gt;"/> + </when> + <when value="select_random_number"> + <param name="select_random_number" type="integer" value="0" label="Count" help="-number,--select_random_number &lt;select_random_number&gt;" /> + </when> + </conditional> + + <param name="exclude_non_variants" type="boolean" truevalue="--excludeNonVariants" falsevalue="" label="Don't include loci found to be non-variant after the subsetting procedure" help="-env,--excludeNonVariants" /> + + <param name="select_type_to_include" type="select" label="Select only a certain type of variants from the input file" multiple="True" display="checkboxes" help="-selectType,--selectTypeToInclude &lt;selectTypeToInclude&gt;"> + <option value="INDEL">INDEL</option> + <option value="SNP">SNP</option> + <option value="MIXED">MIXED</option> + <option value="MNP">MNP</option> + <option value="SYMBOLIC">SYMBOLIC</option> + <option value="NO_VARIATION">NO_VARIATION</option> + </param> + </expand> + + </inputs> + <outputs> + <data format="vcf" name="output_vcf" label="${tool.name} on ${on_string} (Variant File)" /> + <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" /> + </outputs> + <tests> + <test> + <param name="reference_source_selector" value="history" /> + <param name="ref_file" value="phiX.fasta" ftype="fasta" /> + <param name="input_variant" value="gatk/gatk_variant_annotator/gatk_variant_annotator_out_1.vcf" ftype="vcf" /> + <param name="select_expressions_repeat" value="0" /> + <param name="input_concordance" /> + <param name="input_discordance" /> + <param name="exclude_sample_name_repeat" value="0" /> + <param name="exclude_filtered" /> + <param name="sample_name_repeat" value="0" /> + <param name="gatk_param_type_selector" value="basic" /> + <param name="analysis_param_type_selector" value="basic" /> + <output name="output_vcf" file="gatk/gatk_variant_select/gatk_variant_select_out_1.vcf" lines_diff="4" /> + <output name="output_log" file="gatk/gatk_variant_select/gatk_variant_select_out_1.log.contains" compare="contains" /> + </test> + </tests> + <help> +**What it does** + +Often, a VCF containing many samples and/or variants will need to be subset in order to facilitate certain analyses (e.g. comparing and contrasting cases vs. controls; extracting variant or non-variant loci that meet certain requirements, displaying just a few samples in a browser like IGV, etc.). SelectVariants can be used for this purpose. Given a single VCF file, one or more samples can be extracted from the file (based on a complete sample name or a pattern match). Variants can be further selected by specifying criteria for inclusion, i.e. "DP > 1000" (depth of coverage greater than 1000x), "AF < 0.25" (sites with allele frequency less than 0.25). These JEXL expressions are documented in the `Using JEXL expressions section <http://gatkforums.broadinstitute.org/discussion/1255/what-are-jexl-expressions-and-how-can-i-use-them-with-the-gatk>`_. One can optionally include concordance or discordance tracks for use in selecting overlapping variants. + +For more information on using the SelectVariants module, see this `tool specific page <http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_variantutils_SelectVariants.html>`_. + +To learn about best practices for variant detection using GATK, see this `overview <http://www.broadinstitute.org/gatk/guide/topic?name=best-practices>`_. + +If you encounter errors, please view the `GATK FAQ <http://www.broadinstitute.org/gatk/guide/topic?name=faqs>`_. + +------ + +**Inputs** + +GenomeAnalysisTK: SelectVariants accepts a VCF input file. + + +**Outputs** + +The output is in VCF format. + + +Go `here <http://www.broadinstitute.org/gatk/guide/topic?name=intro>`_ for details on GATK file formats. + +------- + +**Settings**:: + + + out VCFWriter stdout File to which variants should be written + variant RodBinding[VariantContext] NA Input VCF file + concordance RodBinding[VariantContext] none Output variants that were also called in this comparison track + discordance RodBinding[VariantContext] none Output variants that were not called in this comparison track + exclude_sample_file Set[File] [] File containing a list of samples (one per line) to exclude. Can be specified multiple times + exclude_sample_name Set[String] [] Exclude genotypes from this sample. Can be specified multiple times + excludeFiltered boolean false Don't include filtered loci in the analysis + excludeNonVariants boolean false Don't include loci found to be non-variant after the subsetting procedure + keepIDs File NA Only emit sites whose ID is found in this file (one ID per line) + keepOriginalAC boolean false Don't update the AC, AF, or AN values in the INFO field after selecting + mendelianViolation Boolean false output mendelian violation sites only + mvq double 0.0 Minimum genotype QUAL score for each trio member required to accept a site as a violation + remove_fraction_genotypes double 0.0 Selects a fraction (a number between 0 and 1) of the total genotypes at random from the variant track and sets them to nocall + restrictAllelesTo NumberAlleleRestriction ALL Select only variants of a particular allelicity. Valid options are ALL (default), MULTIALLELIC or BIALLELIC + sample_expressions Set[String] NA Regular expression to select many samples from the ROD tracks provided. Can be specified multiple times + sample_file Set[File] NA File containing a list of samples (one per line) to include. Can be specified multiple times + sample_name Set[String] [] Include genotypes from this sample. Can be specified multiple times + select_expressions ArrayList[String] [] One or more criteria to use when selecting the data + select_random_fraction double 0.0 Selects a fraction (a number between 0 and 1) of the total variants at random from the variant track + select_random_number int 0 Selects a number of variants at random from the variant track + selectTypeToInclude List[Type] [] Select only a certain type of variants from the input file. Valid types are INDEL, SNP, MIXED, MNP, SYMBOLIC, NO_VARIATION. Can be specified multiple times + +@CITATION_SECTION@ + </help> + <expand macro="citations" /> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/variant_validate.xml Sat Jun 01 07:20:41 2019 -0400 @@ -0,0 +1,106 @@ +<tool id="gatk2_variant_validate" name="Validate Variants" version="@VERSION@.0"> + <description></description> + <macros> + <import>gatk2_macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="version_command" /> + <command interpreter="python"> + gatk2_wrapper.py + --stdout "${output_log}" + -d "--variant:variant,%(file_type)s" "${reference_source.input_variant}" "${reference_source.input_variant.ext}" "input_variant" + -p ' + @JAR_PATH@ + -T "ValidateVariants" + + \$GATK2_SITE_OPTIONS + + #if $reference_source.reference_source_selector != "history": + -R "${reference_source.ref_file.fields.path}" + #end if + ${warn_on_errors} + ${do_not_validate_filtered_records} + ' + @DBSNP_OPTIONS@ + + #include source=$standard_gatk_options# + </command> + <inputs> + + <conditional name="reference_source"> + <expand macro="reference_source_selector_param" /> + <when value="cached"> + <param name="input_variant" type="data" format="vcf" label="Input variant file" help="-V,--variant &lt;variant&gt;" /> + <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &lt;reference_sequence&gt;"> + <options from_data_table="gatk2_picard_indexes"> + <filter type="data_meta" key="dbkey" ref="input_variant" column="dbkey"/> + </options> + <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> + </param> + </when> + <when value="history"> <!-- FIX ME!!!! --> + <param name="input_variant" type="data" format="vcf" label="Input variant file" help="-V,--variant &lt;variant&gt;" /> + <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &lt;reference_sequence&gt;" /> + </when> + </conditional> + <expand macro="dbsnp_param" /> + + <param name="warn_on_errors" type="boolean" checked="False" truevalue="-warnOnErrors" falsevalue="" label="instead of terminating the run at the first error, print warning messages for each error seen." help="-warnOnErrors,--warnOnErrors"/> + <param name="do_not_validate_filtered_records" type="boolean" checked="False" truevalue="-doNotValidateFilteredRecords" falsevalue="" label="do not try to validate records that are FILTERed." help="-doNotValidateFilteredRecords,--doNotValidateFilteredRecords"/> + + <expand macro="gatk_param_type_conditional" /> + + </inputs> + <outputs> + <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" /> + </outputs> + <tests> + <test> + <param name="reference_source_selector" value="history" /> + <param name="ref_file" value="phiX.fasta" ftype="fasta" /> + <param name="input_variant" value="gatk/gatk_variant_annotator/gatk_variant_annotator_out_1.vcf" ftype="vcf" /> + <param name="dbsnp_rod_bind_type_selector" value="set_dbsnp" /> + <param name="dbsnp_input_rod" value="gatk/fake_phiX_variant_locations.vcf" ftype="vcf" /> + <param name="dbsnp_rod_name" value="dbsnp" /> + <param name="warn_on_errors" value="True"/> + <param name="do_not_validate_filtered_records" /> + <param name="gatk_param_type_selector" value="basic" /> + <output name="output_log" file="gatk/gatk_validate_variants/gatk_validate_variants_out_1.log.contains" compare="contains" /> + </test> + </tests> + <help> +**What it does** + +Validates a variants file. + +For more information on using the ValidateVariants module, see this `tool specific page <http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_variantutils_ValidateVariants.html>`_. + +To learn about best practices for variant detection using GATK, see this `overview <http://www.broadinstitute.org/gatk/guide/topic?name=best-practices>`_. + +If you encounter errors, please view the `GATK FAQ <http://www.broadinstitute.org/gatk/guide/topic?name=faqs>`_. + +------ + +**Inputs** + +GenomeAnalysisTK: ValidateVariants accepts variant files as input. + + +**Outputs** + +The output is a log of variant validation. + + +Go `here <http://www.broadinstitute.org/gatk/guide/topic?name=intro>`_ for details on GATK file formats. + +------- + +**Settings**:: + + doNotValidateFilteredRecords should we skip validation on filtered records? + warnOnErrors should we just emit warnings on errors instead of terminating the run? + +@CITATION_SECTION@ + </help> + <expand macro="citations" /> +</tool>