Mercurial > repos > mheinzl > fsd_bvsa

diff fsd_beforevsafter.xml @ 5:1eae0524b285 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/monikaheinzl/galaxyProject/tree/master/tools/fsd_beforevsafter commit f4eb0a7cd4fd5baaa9afe0c931afb57ac6abc0c1
author mheinzl
date Wed, 23 May 2018 14:59:33 -0400
parents 2c6cff101f49
children 92c80d62d8e2
line wrap: on
line diff
--- a/fsd_beforevsafter.xml	Tue May 15 14:28:12 2018 -0400
+++ b/fsd_beforevsafter.xml	Wed May 23 14:59:33 2018 -0400
@@ -1,5 +1,5 @@
 <?xml version="1.0" encoding="UTF-8"?>
-<tool id="fsd_beforevsafter" name="Duplex Sequencing Analysis:" version="0.0.5">
+<tool id="fsd_beforevsafter" name="Duplex Sequencing Analysis: fsd_beforevsafter" version="0.0.7">
     <requirements>
 		<!-- galaxy version 16.04 -->
         <requirement type="package" version="2.7">python</requirement>
@@ -59,7 +59,7 @@
     
     
 	
-    **Dataset 4 (optional):** Finally, a TXT file with the regions and all tags that were aligned to the reference genome can be given as input. This file can obtained from a different tool.
+    **Dataset 4 (optional):** Finally, a TXT file with the regions and all tags that were aligned to the reference genome can be given as input. This file can obtained from "Duplex Sequencing Analysis: range2tag"
 
     +-----------+------------------------------+
     | 87_636    | AAATCAAAGTATGAATGAAGTTGCCT   |