Mercurial > repos > mheinzl > fsd_bvsa

changeset 5:1eae0524b285 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/monikaheinzl/galaxyProject/tree/master/tools/fsd_beforevsafter commit f4eb0a7cd4fd5baaa9afe0c931afb57ac6abc0c1
author mheinzl
date Wed, 23 May 2018 14:59:33 -0400
parents 2c6cff101f49
children 92c80d62d8e2
files fsd_beforevsafter.py fsd_beforevsafter.xml
diffstat 2 files changed, 17 insertions(+), 17 deletions(-) [+]
line wrap: on
line diff
--- a/fsd_beforevsafter.py	Tue May 15 14:28:12 2018 -0400
+++ b/fsd_beforevsafter.py	Wed May 23 14:59:33 2018 -0400
@@ -121,7 +121,7 @@
         duplTags_double = quant[numpy.in1d(seq, d)]
         list1.append(duplTags_double)
         colors.append("#0000FF")
-        labels.append("before alignment\nto SSCS")
+        labels.append("before SSCS building")
 
         duplTags = duplTags_double[0::2]  # ab of DCS
         duplTagsBA = duplTags_double[1::2]  # ba of DCS
@@ -133,7 +133,7 @@
         seq_unique_FS = quant[seqUnique_index]
         seq_unique_FS3 = seq_unique_FS[seq_unique_FS >= 3]
 
-        legend1 = "\ntotal nr. of tags (unique, FS>=1):\nDCS (before alignment to SSCS, FS>=1):\ntotal nr. of tags (unique, FS>=3):\nDCS (before alignment to SSCS, FS>=3):"
+        legend1 = "\ntotal nr. of tags (unique, FS>=1):\nDCS (before SSCS building, FS>=1):\ntotal nr. of tags (unique, FS>=3):\nDCS (before SSCS building, FS>=3):"
         legend2 = "total numbers * \n{:,}\n{:,}\n{:,}\n{:,}".format(len(seq_unique_FS), len(duplTags),
                                                                     len(seq_unique_FS3), len(d2))
         plt.text(0.55, 0.14, legend1, size=11, transform=plt.gcf().transFigure)
@@ -146,8 +146,8 @@
         fs_consensus[bigFamilies] = 22
         list1.append(fs_consensus)
         colors.append("#298A08")
-        labels.append("make DCS")
-        legend3 = "make DCS:"
+        labels.append("after DCS building")
+        legend3 = "after DCS building:"
         legend4 = "{:,}".format(len(tag_consensus))
         plt.text(0.55, 0.11, legend3, size=11, transform=plt.gcf().transFigure)
         plt.text(0.88, 0.11, legend4, size=11, transform=plt.gcf().transFigure)
@@ -187,8 +187,8 @@
             quant_all_ref[bigFamilies] = 22
             list1.append(quant_all_ref)
             colors.append("#04cec7")
-            labels.append("after alignment\nto reference genome")
-            legend7 = "after alignment to reference genome:"
+            labels.append("after alignment\nto reference")
+            legend7 = "after alignment to reference:"
             length_DCS_ref = len(quant_ba_ref)  # count of duplex tags that were aligned to reference genome
             legend8 = "{:,}".format(length_DCS_ref)
             plt.text(0.55, 0.07, legend7, size=11, transform=plt.gcf().transFigure)
@@ -249,10 +249,10 @@
         if afterTrimming == str(None) and ref_genome == str(None):
             if afterTrimming == str(None):
                 output_file.write(
-                "{}before alignment to SSCS{}make DCS\n".format(sep, sep))
+                "{}before SSCS buidling{}after DCS building\n".format(sep, sep))
             elif ref_genome == str(None):
                 output_file.write(
-                    "{}before alignment to SSCS{}make DCS\n".format(sep, sep))
+                    "{}before SSCS building{}atfer DCS building\n".format(sep, sep))
 
             for fs, sscs, dcs in zip(counts[1][2:len(counts[1])], counts[0][0][2:len(counts[0][0])],
                                                       counts[0][1][2:len(counts[0][1])]):
@@ -268,10 +268,10 @@
         elif afterTrimming == str(None) or ref_genome == str(None):
             if afterTrimming == str(None):
                 output_file.write(
-                "{}before alignment to SSCS{}make DCS{}after alignment to reference genome\n".format(sep, sep, sep))
+                "{}before SSCS buidling{}after DCS building{}after alignment to reference\n".format(sep, sep, sep))
             elif ref_genome == str(None):
                 output_file.write(
-                    "{}before alignment to SSCS{}make DCS{}after trimming\n".format(sep, sep, sep))
+                    "{}before SSCS building{}atfer DCS building{}after trimming\n".format(sep, sep, sep))
 
             for fs, sscs, dcs, reference in zip(counts[1][2:len(counts[1])], counts[0][0][2:len(counts[0][0])],
                                                       counts[0][1][2:len(counts[0][1])],counts[0][2][2:len(counts[0][2])]):
@@ -286,7 +286,7 @@
 
         else:
             output_file.write(
-                "{}before alignment to SSCS{}make DCS{}after trimming{}after alignment to reference genome\n".format(
+                "{}before SSCS building{}after DCS building{}after trimming{}after alignment to reference\n".format(
                     sep, sep, sep, sep))
             for fs, sscs, dcs, trim, reference in zip(counts[1][2:len(counts[1])], counts[0][0][2:len(counts[0][0])],
                                                       counts[0][1][2:len(counts[0][1])],
@@ -305,14 +305,14 @@
 
         output_file.write("\n\nIn the plot, the family sizes of ab and ba strands and of both duplex tags were used.\nWhereas the total numbers indicate only the single count of the formed duplex tags.\n")
         output_file.write("total nr. of tags (unique, FS>=1){}{}\n".format(sep, len(seq_unique_FS)))
-        output_file.write("DCS (before alignment to SSCS, FS>=1){}{}\n".format(sep, len(duplTags)))
+        output_file.write("DCS (before SSCS building, FS>=1){}{}\n".format(sep, len(duplTags)))
         output_file.write("total nr. of tags (unique, FS>=3){}{}\n".format(sep, len(seq_unique_FS3)))
-        output_file.write("DCS (before alignment to SSCS, FS>=3){}{}\n".format(sep, len(d2)))
-        output_file.write("make DCS{}{}\n".format(sep, len(tag_consensus)))
+        output_file.write("DCS (before SSCS building, FS>=3){}{}\n".format(sep, len(d2)))
+        output_file.write("after DCS building{}{}\n".format(sep, len(tag_consensus)))
         if afterTrimming != str(None):
             output_file.write("after trimming{}{}\n".format(sep, len(tag_trimming)))
         if ref_genome != str(None):
-            output_file.write("after alignment to reference genome{}{}\n".format(sep, length_DCS_ref))
+            output_file.write("after alignment to reference{}{}\n".format(sep, length_DCS_ref))
 
         print("Files successfully created!")
 
--- a/fsd_beforevsafter.xml	Tue May 15 14:28:12 2018 -0400
+++ b/fsd_beforevsafter.xml	Wed May 23 14:59:33 2018 -0400
@@ -1,5 +1,5 @@
 <?xml version="1.0" encoding="UTF-8"?>
-<tool id="fsd_beforevsafter" name="Duplex Sequencing Analysis:" version="0.0.5">
+<tool id="fsd_beforevsafter" name="Duplex Sequencing Analysis: fsd_beforevsafter" version="0.0.7">
     <requirements>
 		<!-- galaxy version 16.04 -->
         <requirement type="package" version="2.7">python</requirement>
@@ -59,7 +59,7 @@
     
     
 	
-    **Dataset 4 (optional):** Finally, a TXT file with the regions and all tags that were aligned to the reference genome can be given as input. This file can obtained from a different tool.
+    **Dataset 4 (optional):** Finally, a TXT file with the regions and all tags that were aligned to the reference genome can be given as input. This file can obtained from "Duplex Sequencing Analysis: range2tag"
 
     +-----------+------------------------------+
     | 87_636    | AAATCAAAGTATGAATGAAGTTGCCT   |