Mercurial > repos > mheinzl > fsd_regions

diff fsd_regions.xml @ 1:9ce2b4089c1b draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/monikaheinzl/galaxyProject/tree/master/tools/fsd_regions commit b9403b3ce2b7a41fa8ee1aa47909152de78cf641
author mheinzl
date Tue, 15 May 2018 13:50:29 -0400
parents b82fdb006304
children 2631864873d7
line wrap: on
line diff
--- a/fsd_regions.xml	Thu May 10 07:28:39 2018 -0400
+++ b/fsd_regions.xml	Tue May 15 13:50:29 2018 -0400
@@ -1,12 +1,12 @@
 <?xml version="1.0" encoding="UTF-8"?>
-<tool id="fsd_regions" name="Duplex Sequencing Analysis:" version="0.0.1">
+<tool id="fsd_regions" name="Duplex Sequencing Analysis:" version="0.0.2">
     <requirements>
         <requirement type="package" version="2.7">python</requirement>
         <requirement type="package" version="1.4">matplotlib</requirement>
     </requirements>
     <description>Family size distribution (FSD) of aligned tags to reference genome</description>
     <command>
-        python2 $__tool_directory__/fsd_regions.py --inputFile "$file1" --inputName1 "$file1.name" --ref_genome "$file2" --sep $separator --output_csv $output_csv --output_pdf $output_pdf
+        python2 $__tool_directory__/fsd_regions.py --inputFile "$file1" --inputName1 "$file1.name" --ref_genome "$file2" --sep $separator --output_pdf $output_pdf --output_csv $output_csv 
     </command>
     <inputs>
         <param name="file1" type="data" format="tabular" label="Dataset 1: input tags of whole dataset" optional="false" help="Input in tabular format with the family size, tags and the direction of the strand ('ab' or 'ba') for each family."/>
@@ -36,7 +36,8 @@
     | 28  | AAAAAAAAAAATGGTATGGACCGA   | ab |
     +-----+----------------------------+----+
     
-    In addition, a TXT file with the regions and all tags that were aligned to the reference genome is required. This file can obtained from a different tool.
+    
+	In addition, a TXT file with the regions and all tags that were aligned to the reference genome is required. 	This file can obtained from a different tool.
     
     +-----------+------------------------------+
     | 87_636    | AAATCAAAGTATGAATGAAGTTGCCT   |