Mercurial > repos > mheinzl > fsd_regions
changeset 1:9ce2b4089c1b draft
planemo upload for repository https://github.com/monikaheinzl/galaxyProject/tree/master/tools/fsd_regions commit b9403b3ce2b7a41fa8ee1aa47909152de78cf641
| author | mheinzl |
|---|---|
| date | Tue, 15 May 2018 13:50:29 -0400 |
| parents | b82fdb006304 |
| children | 2631864873d7 |
| files | fsd_regions.py fsd_regions.xml |
| diffstat | 2 files changed, 10 insertions(+), 9 deletions(-) [+] |
line wrap: on
line diff
--- a/fsd_regions.py Thu May 10 07:28:39 2018 -0400 +++ b/fsd_regions.py Tue May 15 13:50:29 2018 -0400 @@ -108,8 +108,8 @@ ### PLOT ### plt.rc('figure', figsize=(11.69, 8.27)) # A4 format plt.rcParams['axes.facecolor'] = "E0E0E0" # grey background color - plt.rcParams['xtick.labelsize'] = 12 - plt.rcParams['ytick.labelsize'] = 12 + plt.rcParams['xtick.labelsize'] = 14 + plt.rcParams['ytick.labelsize'] = 14 plt.rcParams['patch.edgecolor'] = "black" fig = plt.figure() plt.subplots_adjust(bottom=0.3) @@ -156,9 +156,9 @@ plt.text(0.75, 0.05 + s, "{:,}\n".format(len(count) / 2), size=11, transform=plt.gcf().transFigure) plt.legend(loc='upper right', fontsize=14, bbox_to_anchor=(0.9, 1), frameon=True) - plt.title(name1, fontsize=14) - plt.xlabel("No. of Family Members", fontsize=12) - plt.ylabel("Absolute Frequency", fontsize=12) + #plt.title(name1, fontsize=14) + plt.xlabel("Family size", fontsize=14) + plt.ylabel("Absolute Frequency", fontsize=14) plt.grid(b=True, which="major", color="#424242", linestyle=":") plt.margins(0.01, None) @@ -166,7 +166,7 @@ pdf.savefig(fig, bbox_inch="tight") plt.close() - output_file.write("Dataset:{}{}\n".format(sep, firstFile)) + output_file.write("Dataset:{}{}\n".format(sep, name1)) output_file.write("{}AB{}BA\n".format(sep, sep)) output_file.write("max. family size:{}{}{}{}\n".format(sep, max(map(int, quant_ab)), sep, max(map(int, quant_ba)))) output_file.write("absolute frequency:{}{}{}{}\n".format(sep, count[len(count) - 1], sep, count2[len(count2) - 1]))
--- a/fsd_regions.xml Thu May 10 07:28:39 2018 -0400 +++ b/fsd_regions.xml Tue May 15 13:50:29 2018 -0400 @@ -1,12 +1,12 @@ <?xml version="1.0" encoding="UTF-8"?> -<tool id="fsd_regions" name="Duplex Sequencing Analysis:" version="0.0.1"> +<tool id="fsd_regions" name="Duplex Sequencing Analysis:" version="0.0.2"> <requirements> <requirement type="package" version="2.7">python</requirement> <requirement type="package" version="1.4">matplotlib</requirement> </requirements> <description>Family size distribution (FSD) of aligned tags to reference genome</description> <command> - python2 $__tool_directory__/fsd_regions.py --inputFile "$file1" --inputName1 "$file1.name" --ref_genome "$file2" --sep $separator --output_csv $output_csv --output_pdf $output_pdf + python2 $__tool_directory__/fsd_regions.py --inputFile "$file1" --inputName1 "$file1.name" --ref_genome "$file2" --sep $separator --output_pdf $output_pdf --output_csv $output_csv </command> <inputs> <param name="file1" type="data" format="tabular" label="Dataset 1: input tags of whole dataset" optional="false" help="Input in tabular format with the family size, tags and the direction of the strand ('ab' or 'ba') for each family."/> @@ -36,7 +36,8 @@ | 28 | AAAAAAAAAAATGGTATGGACCGA | ab | +-----+----------------------------+----+ - In addition, a TXT file with the regions and all tags that were aligned to the reference genome is required. This file can obtained from a different tool. + + In addition, a TXT file with the regions and all tags that were aligned to the reference genome is required. This file can obtained from a different tool. +-----------+------------------------------+ | 87_636 | AAATCAAAGTATGAATGAAGTTGCCT |