Mercurial > repos > mheinzl > fsd_regions
view fsd_regions.xml @ 8:6c2608e8d094 draft
planemo upload for repository https://github.com/monikaheinzl/duplexanalysis_galaxy/tree/master/tools/fsd_regions commit 8833d1a8a49d7b6d4a9c849b0335d3260564b351-dirty
author | mheinzl |
---|---|
date | Tue, 20 Nov 2018 09:51:47 -0500 |
parents | b202c97deabe |
children | eabfdc012d7b |
line wrap: on
line source
<?xml version="1.0" encoding="UTF-8"?> <tool id="fsd_regions" name="Duplex Sequencing Analysis: fsd_regions" version="1.0.0"> <description>Family size distribution (FSD) of user-specified regions in the reference genome</description> <requirements> <requirement type="package" version="2.7">python</requirement> <requirement type="package" version="1.4.0">matplotlib</requirement> </requirements> <command> python2 '$__tool_directory__/fsd_regions.py' --inputFile '$file1' --inputName1 '$file1.name' --ref_genome '$file2' --output_pdf $output_pdf --output_tabular $output_tabular </command> <inputs> <param name="file1" type="data" format="tabular" label="Dataset 1: input tags of whole dataset" optional="false" help="Input in tabular format with the family size, tags and the direction of the strand ('ab' or 'ba') for each family."/> <param name="file2" type="data" format="txt" label="Dataset 2: input tags aligned to the reference genome" help="Input in txt format with the regions in the reference genome and the tags, which were aligned to the reference genome."/> </inputs> <outputs> <data name="output_pdf" format="pdf" /> <data name="output_tabular" format="tabular"/> </outputs> <tests> <test> <param name="file1" value="Test_data.tabular"/> <param name="file2" value="Test_data_regions.txt"/> <output name="output_pdf" file="output_file.pdf" lines_diff="136"/> <output name="output_tabular" file="output_file.tabular"/> </test> </tests> <help> <![CDATA[ **What it does** This tool will create a distribution of family sizes of all tags, which were aligned to the reference genome. The distribution is separated after the regions of the reference genome. **Input** This tools expects a tabular file with the tags of all families, their sizes and information about forward (ab) and reverse (ba) strands. +-----+----------------------------+----+ | 1 | AAAAAAAAAAAATGTTGGAATCTT | ba | +-----+----------------------------+----+ | 10 | AAAAAAAAAAAGGCGGTCCACCCC | ab | +-----+----------------------------+----+ | 28 | AAAAAAAAAAATGGTATGGACCGA | ab | +-----+----------------------------+----+ In addition, a TXT file with the regions and all tags that were aligned to the reference genome is required. This file can obtained from a different tool. +-----------+------------------------------+ | 87_636 | AAATCAAAGTATGAATGAAGTTGCCT | +-----------+------------------------------+ | 87_636 | AAATTCATAGCATTAATTTCAACGGG | +-----------+------------------------------+ | 656_1143 | GGGGCAGCCATATTGGCAATTATCAT | +-----------+------------------------------+ **Output** The output is a PDF file with the plot and a tabular file with the data of the plot. **About Author** Author: Monika Heinzl Department: Institute of Bioinformatics, Johannes Kepler University Linz, Austria Contact: monika.heinzl@edumail.at ]]> </help> <citations> <citation type="bibtex"> @misc{duplex, author = {Heinzl, Monika}, year = {2018}, title = {Development of algorithms for the analysis of duplex sequencing data} } </citation> </citations> </tool>