Mercurial > repos > mheinzl > fsd_regions
view fsd_regions.xml @ 1:9ce2b4089c1b draft
planemo upload for repository https://github.com/monikaheinzl/galaxyProject/tree/master/tools/fsd_regions commit b9403b3ce2b7a41fa8ee1aa47909152de78cf641
author | mheinzl |
---|---|
date | Tue, 15 May 2018 13:50:29 -0400 |
parents | b82fdb006304 |
children | 2631864873d7 |
line wrap: on
line source
<?xml version="1.0" encoding="UTF-8"?> <tool id="fsd_regions" name="Duplex Sequencing Analysis:" version="0.0.2"> <requirements> <requirement type="package" version="2.7">python</requirement> <requirement type="package" version="1.4">matplotlib</requirement> </requirements> <description>Family size distribution (FSD) of aligned tags to reference genome</description> <command> python2 $__tool_directory__/fsd_regions.py --inputFile "$file1" --inputName1 "$file1.name" --ref_genome "$file2" --sep $separator --output_pdf $output_pdf --output_csv $output_csv </command> <inputs> <param name="file1" type="data" format="tabular" label="Dataset 1: input tags of whole dataset" optional="false" help="Input in tabular format with the family size, tags and the direction of the strand ('ab' or 'ba') for each family."/> <param name="file2" type="data" format="txt" label="Dataset 2: input tags aligned to the reference genome" help="Input in txt format with the regions and the tags, which were aligned to the reference genome."/> <param name="separator" type="text" label="Separator of the CSV file." help="can be a single character" value=","/> </inputs> <outputs> <data name="output_pdf" format="pdf" /> <data name="output_csv" format="csv"/> </outputs> <help> <![CDATA[ **What it does** This tool will create a distribution of family sizes of all tags, which were aligned to the reference genome. The distribution is separated after the regions of the reference genome. **Input** This tools expects a tabular file with the tags of all families, their sizes and information about forward (ab) and reverse (ba) strands. +-----+----------------------------+----+ | 1 | AAAAAAAAAAAATGTTGGAATCTT | ba | +-----+----------------------------+----+ | 10 | AAAAAAAAAAAGGCGGTCCACCCC | ab | +-----+----------------------------+----+ | 28 | AAAAAAAAAAATGGTATGGACCGA | ab | +-----+----------------------------+----+ In addition, a TXT file with the regions and all tags that were aligned to the reference genome is required. This file can obtained from a different tool. +-----------+------------------------------+ | 87_636 | AAATCAAAGTATGAATGAAGTTGCCT | +-----------+------------------------------+ | 87_636 | AAATTCATAGCATTAATTTCAACGGG | +-----------+------------------------------+ | 656_1143 | GGGGCAGCCATATTGGCAATTATCAT | +-----------+------------------------------+ **Output** The output is a PDF file with the plot and a CSV with the data of the plot. **About Author** Author: Monika Heinzl Department: Institute of Bioinformatics, Johannes Kepler University Linz, Austria Contact: monika.heinzl@edumail.at ]]> </help> <citations> <citation type="bibtex"> @misc{duplex, author = {Heinzl, Monika}, year = {2018}, title = {Development of algorithms for the analysis of duplex sequencing data} } </citation> </citations> </tool>