Mercurial > repos > nml > staramr

changeset 6:3c09557ac425 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/phac-nml/staramr commit 52535d98ad1e03c83c93f230abf966613b4b8fa2
author nml
date Tue, 30 Apr 2019 15:50:46 -0400
parents 930893c83a1a
children f1adc47e017a
files staramr_search.xml test-data/test1-detailed-summary.tsv test-data/test1-hits/pointfinder_16S-rc_gyrA-rc_beta-lactam.fsa test-data/test1-hits/resfinder_16S-rc_gyrA-rc_beta-lactam.fsa test-data/test1-plasmidfinder.tsv test-data/test1-summary.tsv test-data/test2-hits/resfinder_16S-rc_gyrA-rc_beta-lactam.fsa test-data/test2-summary.tsv test-data/test3-summary.tsv test-data/test4-summary.tsv test-data/test5-summary.tsv test-data/test6-summary.tsv
diffstat 12 files changed, 147 insertions(+), 54 deletions(-) [+]
line wrap: on
line diff
--- a/staramr_search.xml	Tue Feb 19 16:47:25 2019 -0500
+++ b/staramr_search.xml	Tue Apr 30 15:50:46 2019 -0400
@@ -1,7 +1,7 @@
 <tool id="staramr_search" name="staramr" version="@VERSION@">
-    <description>Scans genome assemblies against the ResFinder and PointFinder databases searching for AMR genes.</description>
+    <description>Scans genome assemblies against the ResFinder, PlasmidFinder, and PointFinder databases searching for AMR genes.</description>
     <macros>
-	    <token name="@VERSION@">0.4.0</token>
+	    <token name="@VERSION@">0.5.0</token>
     </macros>
     <requirements>
         <requirement type="package" version="@VERSION@">staramr</requirement>
@@ -26,6 +26,7 @@
 
         --pid-threshold $advanced.pid_threshold
         --percent-length-overlap-resfinder $advanced.plength_resfinder
+        --percent-length-overlap-plasmidfinder $advanced.plength_plasmidfinder
         --percent-length-overlap-pointfinder $advanced.plength_pointfinder
 
         $advanced.report_all_blast
@@ -38,9 +39,15 @@
             --no-exclude-genes
         #end if
 
+        #if str($advanced.plasmidfinder_type) != 'include_all'
+            --plasmidfinder-database-type '${advanced.plasmidfinder_type}'
+        #end if
+
         --output-summary $summary
+        --output-detailed-summary $detailed_summary
         --output-resfinder $resfinder
-        #if $use_pointfinder.enable
+        --output-plasmidfinder $plasmidfinder
+        #if str($use_pointfinder) != 'disabled'
             --output-pointfinder $pointfinder
         #end if
         --output-settings $settings
@@ -48,24 +55,19 @@
 
         --output-hits-dir staramr_hits
 
-        #if $use_pointfinder.enable
-            --pointfinder-organism $use_pointfinder.organism
+        #if str($use_pointfinder) != 'disabled'
+            --pointfinder-organism '${use_pointfinder}'
         #end if
 
         $named_genomes
     ]]></command>
     <inputs>
         <param type="data" name="genomes" format="fasta" multiple="true"/>
-        <conditional name="use_pointfinder">
-            <param name="enable" type="boolean" label="Enable scanning for point mutations using the PointFinder database" />
-            <when value="true">
-                <param name="organism" type="select" label="Select a pointfinder organism">
-                    <option value="salmonella" selected="true">Salmonella</option>
-                    <option value="campylobacter">Campylobacter</option>
-                </param>
-            </when>
-            <when value="false" />
-        </conditional>
+        <param name="use_pointfinder" type="select" label="Enable scanning for point mutations using the PointFinder database">
+            <option value="disabled" selected="true">Disable PointFinder</option>
+            <option value="salmonella">Salmonella</option>
+            <option value="campylobacter">Campylobacter</option>
+        </param>
         <section name="advanced" title="Advanced options" expanded="false">
             <param name="pid_threshold" type="float" label="Percent identity threshold for BLAST" value="98.0"
                    min="0" max="100" help="(--pid-threshold)" />
@@ -73,6 +75,8 @@
                    min="0" max="100" help="(--percent-length-overlap-resfinder)" />
             <param name="plength_pointfinder" type="float" label="Percent length overlap of BLAST hit for PointFinder database" value="95.0"
                    min="0" max="100" help="(--percent-length-overlap-pointfinder)" />
+            <param name="plength_plasmidfinder" type="float" label="Percent length overlap of BLAST hit for PlasmidFinder database" value="60.0"
+                   min="0" max="100" help="(--percent-length-overlap-plasmidfinder)" />
             <param name="report_all_blast" type="boolean" label="Report all BLAST results" truevalue="--report-all-blast" falsevalue=""
                    help="Report all BLAST results (includes overlapping hits, mainly for debugging)" />
             <param name="exclude_negatives" type="boolean" label="Exclude negative (non-resistant) results" truevalue="--exclude-negatives" falsevalue="" />
@@ -89,13 +93,20 @@
                 </when>
                 <when value="none" />
             </conditional>
+            <param name="plasmidfinder_type" type="select" label="Specify PlasmidFinder Database type">
+                <option value="include_all" selected="true">Include all available database types</option>
+                <option value="gram_positive">Gram Positive</option>
+                <option value="enterobacteriaceae">Enterobacteriaceae</option>
+            </param>
         </section>
     </inputs>
     <outputs>
         <data format="tabular" name="summary" label="${tool.name} on ${on_string}: summary.tsv" />
+        <data format="tabular" name="detailed_summary" label="${tool.name} on ${on_string}: detailed_summary.tsv" />
         <data format="tabular" name="resfinder" label="${tool.name} on ${on_string}: resfinder.tsv" />
+        <data format="tabular" name="plasmidfinder" label="${tool.name} on ${on_string}: plasmidfinder.tsv" />
         <data format="tabular" name="pointfinder" label="${tool.name} on ${on_string}: pointfinder.tsv">
-            <filter>use_pointfinder['enable']</filter>
+            <filter>use_pointfinder != "disabled"</filter>
         </data>
         <data format="txt" name="settings" label="${tool.name} on ${on_string}: settings.txt" />
         <data format="xlsx" name="excel" label="${tool.name} on ${on_string}: results.xlsx" />
@@ -106,13 +117,12 @@
     <tests>
         <test>
             <param name="genomes" value="16S-rc_gyrA-rc_beta-lactam.fsa" />
-            <conditional name="use_pointfinder">
-                <param name="enable" value="true" />
-                <param name="organism" value="salmonella" />
-            </conditional>
+            <param name="use_pointfinder" value="salmonella" />
 
             <output name="summary" file="test1-summary.tsv" ftype="tabular" />
+            <output name="detailed_summary" file="test1-detailed-summary.tsv" ftype="tabular" />
             <output name="resfinder" file="test1-resfinder.tsv" ftype="tabular" />
+            <output name="plasmidfinder" file="test1-plasmidfinder.tsv" ftype="tabular" />
             <output name="pointfinder" file="test1-pointfinder.tsv" ftype="tabular" />
             <output_collection name="blast_hits" type="list">
                 <element name="resfinder_16S-rc_gyrA-rc_beta-lactam.fsa" file="test1-hits/resfinder_16S-rc_gyrA-rc_beta-lactam.fsa" />
@@ -163,7 +173,7 @@
 staramr
 =======
 
-staramr_ scans bacterial genome contigs against both the ResFinder_ and PointFinder_ databases (used by the ResFinder webservice_) and compiles a summary report of detected antimicrobial resistance genes.
+staramr_ scans bacterial genome contigs against both the ResFinder_, PlasmidFinder_ and PointFinder_ databases (used by the ResFinder webservice_) and compiles a summary report of detected antimicrobial resistance genes.
 
 Usage
 -----
@@ -189,6 +199,7 @@
 
     #gene_id
     aac(6')-Iaa_1_NC_003197
+    ColpVC_1__JX133088
 
 Output
 ------
@@ -200,13 +211,59 @@
 
 A summary of all detected AMR genes/mutations in each genome, one genome per line.
 
-+------------+-----------------------------------------------------------+-----------------------------------------------------------------------------------------------------------+
-| Isolate ID | Genotype                                                  | Predicted Phenotype                                                                                       |
-+============+===========================================================+===========================================================================================================+
-| SRR1952908 | aadA1, aadA2, blaTEM-57, cmlA1, gyrA (S83Y), sul3, tet(A) | streptomycin, ampicillin, chloramphenicol, ciprofloxacin I/R, nalidixic acid, sulfisoxazole, tetracycline |
-+------------+-----------------------------------------------------------+-----------------------------------------------------------------------------------------------------------+
-| SRR1952926 | blaTEM-57, gyrA (S83Y), tet(A)                            | ampicillin, ciprofloxacin I/R, nalidixic acid, tetracycline                                               |
-+------------+-----------------------------------------------------------+-----------------------------------------------------------------------------------------------------------+
++------------+-----------------------------------------------------------+-----------------------------------------------------------------------------------------------------------+-------------------------------------+
+| Isolate ID | Genotype                                                  | Predicted Phenotype                                                                                       | Plasmid Genes                       |
++============+===========================================================+===========================================================================================================+=====================================+
+| SRR1952908 | aadA1, aadA2, blaTEM-57, cmlA1, gyrA (S83Y), sul3, tet(A) | streptomycin, ampicillin, chloramphenicol, ciprofloxacin I/R, nalidixic acid, sulfisoxazole, tetracycline | ColpVC, IncFIB(S), IncFII(S), IncI1 |
++------------+-----------------------------------------------------------+-----------------------------------------------------------------------------------------------------------+-------------------------------------+
+| SRR1952926 | blaTEM-57, gyrA (S83Y), tet(A)                            | ampicillin, ciprofloxacin I/R, nalidixic acid, tetracycline                                               | ColpVC, IncFIB(S), IncFII(S), IncI1 |
++------------+-----------------------------------------------------------+-----------------------------------------------------------------------------------------------------------+-------------------------------------+
+
+detailed_summary.tsv
+````````````````````
+
+A detailed summary of all detected AMR genes/mutations/plasmids in each genome, one gene per line.
+
++------------+-------------+-----------------------------------+-----------+----------+-------------------------+-------------+--------+--------+-----------+------------+
+| Isolate ID | Gene        | Predicted Phenotype               | %Identity | %Overlap | HSP Length/Total Length | Contig      | Start  | End    | Accession | Data Type  |
++============+=============+===================================+===========+==========+=========================+=============+========+========+===========+============+
+| SRR1952908 | ColpVC      |                                   | 98.96     | 100      | 193/193                 | contig00038 | 1618   | 1426   | JX133088  | Plasmid    |
++------------+-------------+-----------------------------------+-----------+----------+-------------------------+-------------+--------+--------+-----------+------------+
+| SRR1952908 | IncFIB(S)   |                                   | 98.91     | 100      | 643/643                 | contig00024 | 10302  | 9660   | FN432031  | Plasmid    |
++------------+-------------+-----------------------------------+-----------+----------+-------------------------+-------------+--------+--------+-----------+------------+
+| SRR1952908 | IncFII(S)   |                                   | 100       | 100      | 262/262                 | contig00024 | 54294  | 54555  | CP000858  | Plasmid    |
++------------+-------------+-----------------------------------+-----------+----------+-------------------------+-------------+--------+--------+-----------+------------+
+| SRR1952908 | IncI1       |                                   | 100       | 100      | 142/142                 | contig00020 | 3907   | 3766   | AP005147  | Plasmid    |
++------------+-------------+-----------------------------------+-----------+----------+-------------------------+-------------+--------+--------+-----------+------------+
+| SRR1952908 | aadA1       | streptomycin                      | 100       | 100      | 792/792                 | contig00030 | 5355   | 4564   | JQ414041  | Resistance |
++------------+-------------+-----------------------------------+-----------+----------+-------------------------+-------------+--------+--------+-----------+------------+
+| SRR1952908 | aadA2       | streptomycin                      | 100       | 100      | 780/780                 | contig00030 | 7748   | 6969   | X68227    | Resistance |
++------------+-------------+-----------------------------------+-----------+----------+-------------------------+-------------+--------+--------+-----------+------------+
+| SRR1952908 | blaTEM-57   | ampicillin                        | 99.88     | 100      | 861/861                 | contig00032 | 6247   | 5387   | FJ405211  | Resistance |
++------------+-------------+-----------------------------------+-----------+----------+-------------------------+-------------+--------+--------+-----------+------------+
+| SRR1952908 | cmlA1       | chloramphenicol                   | 99.92     | 100      | 1260/1260               | contig00030 | 6707   | 5448   | M64556    | Resistance |
++------------+-------------+-----------------------------------+-----------+----------+-------------------------+-------------+--------+--------+-----------+------------+
+| SRR1952908 | gyrA (S83Y) | ciprofloxacin I/R, nalidixic acid | 99.96     | 100      | 2637/2637               | contig00008 | 22801  | 20165  |           | Resistance |
++------------+-------------+-----------------------------------+-----------+----------+-------------------------+-------------+--------+--------+-----------+------------+
+| SRR1952908 | sul3        | sulfisoxazole                     | 100       | 100      | 792/792                 | contig00030 | 2091   | 2882   | AJ459418  | Resistance |
++------------+-------------+-----------------------------------+-----------+----------+-------------------------+-------------+--------+--------+-----------+------------+
+| SRR1952908 | tet(A)      | tetracycline                      | 99.92     | 97.8     | 1247/1275               | contig00032 | 1476   | 2722   | AF534183  | Resistance |
++------------+-------------+-----------------------------------+-----------+----------+-------------------------+-------------+--------+--------+-----------+------------+
+| SRR1952926 | ColpVC      |                                   | 98.96     | 100      | 193/193                 | contig00037 | 657    | 849    | JX133088  | Plasmid    |
++------------+-------------+-----------------------------------+-----------+----------+-------------------------+-------------+--------+--------+-----------+------------+
+| SRR1952926 | IncFIB(S)   |                                   | 98.91     | 100      | 643/643                 | contig00021 | 10302  | 9660   | FN432031  | Plasmid    |
++------------+-------------+-----------------------------------+-----------+----------+-------------------------+-------------+--------+--------+-----------+------------+
+| SRR1952926 | IncFII(S)   |                                   | 100       | 100      | 262/262                 | contig00021 | 54294  | 54555  | CP000858  | Plasmid    |
++------------+-------------+-----------------------------------+-----------+----------+-------------------------+-------------+--------+--------+-----------+------------+
+| SRR1952926 | IncI1       |                                   | 100       | 100      | 142/142                 | contig00017 | 3907   | 3766   | AP005147  | Plasmid    |
++------------+-------------+-----------------------------------+-----------+----------+-------------------------+-------------+--------+--------+-----------+------------+
+| SRR1952926 | blaTEM-57   | ampicillin                        | 99.88     | 100      | 861/861                 | contig00027 | 6176   | 5316   | FJ405211  | Resistance |
++------------+-------------+-----------------------------------+-----------+----------+-------------------------+-------------+--------+--------+-----------+------------+
+| SRR1952926 | gyrA (S83Y) | ciprofloxacin I/R, nalidixic acid | 99.96     | 100      | 2637/2637               | contig00011 | 157768 | 160404 |           | Resistance |
++------------+-------------+-----------------------------------+-----------+----------+-------------------------+-------------+--------+--------+-----------+------------+
+| SRR1952926 | tet(A)      | tetracycline                      | 99.92     | 97.8     | 1247/1275               | contig00027 | 1405   | 2651   | AF534183  | Resistance |
++------------+-------------+-----------------------------------+-----------+----------+-------------------------+-------------+--------+--------+-----------+------------+
+
 
 resfinder.tsv
 `````````````
@@ -233,6 +290,31 @@
 | SRR1952926 | blaTEM-57  | ampicillin           | 99.88      | 100.00    | 861/861                  | contig00027  | 6176   | 5316  | FJ405211  |
 +------------+------------+----------------------+------------+-----------+--------------------------+--------------+--------+-------+-----------+
 
+plasmidfinder.tsv
+`````````````````
+
+A tabular file of each AMR plasmid gene and additional BLAST information from the **PlasmidFinder** database, one plasmid gene per line.
+
++------------+-----------+-----------+----------+-------------------------+-------------+-------+-------+-----------+
+| Isolate ID | Gene      | %Identity | %Overlap | HSP Length/Total Length | Contig      | Start | End   | Accession |
++============+===========+===========+==========+=========================+=============+=======+=======+===========+
+| SRR1952908 | ColpVC    | 98.96     | 100      | 193/193                 | contig00038 | 1618  | 1426  | JX133088  |
++------------+-----------+-----------+----------+-------------------------+-------------+-------+-------+-----------+
+| SRR1952908 | IncFIB(S) | 98.91     | 100      | 643/643                 | contig00024 | 10302 | 9660  | FN432031  |
++------------+-----------+-----------+----------+-------------------------+-------------+-------+-------+-----------+
+| SRR1952908 | IncFII(S) | 100       | 100      | 262/262                 | contig00024 | 54294 | 54555 | CP000858  |
++------------+-----------+-----------+----------+-------------------------+-------------+-------+-------+-----------+
+| SRR1952908 | IncI1     | 100       | 100      | 142/142                 | contig00020 | 3907  | 3766  | AP005147  |
++------------+-----------+-----------+----------+-------------------------+-------------+-------+-------+-----------+
+| SRR1952926 | ColpVC    | 98.96     | 100      | 193/193                 | contig00037 | 657   | 849   | JX133088  |
++------------+-----------+-----------+----------+-------------------------+-------------+-------+-------+-----------+
+| SRR1952926 | IncFIB(S) | 98.91     | 100      | 643/643                 | contig00021 | 10302 | 9660  | FN432031  |
++------------+-----------+-----------+----------+-------------------------+-------------+-------+-------+-----------+
+| SRR1952926 | IncFII(S) | 100       | 100      | 262/262                 | contig00021 | 54294 | 54555 | CP000858  |
++------------+-----------+-----------+----------+-------------------------+-------------+-------+-------+-----------+
+| SRR1952926 | IncI1     | 100       | 100      | 142/142                 | contig00017 | 3907  | 3766  | AP005147  |
++------------+-----------+-----------+----------+-------------------------+-------------+-------+-------+-----------+
+
 pointfinder.tsv
 ```````````````
 
@@ -254,25 +336,29 @@
 ::
 
     command_line                  = staramr search -o out --pointfinder-organism salmonella SRR1952908.fasta SRR1952926.fasta
-    version                       = 0.2.0
-    start_time                    = 2018-06-05 14:41:44
-    end_time                      = 2018-06-05 14:41:47
-    total_minutes                 = 0.05
+    version                       = 0.5.0
+    start_time                    = 2019-04-25 16:01:32
+    end_time                      = 2019-04-25 16:01:34
+    total_minutes                 = 0.04
     resfinder_db_dir              = staramr/databases/data/dist/resfinder
     resfinder_db_url              = https://bitbucket.org/genomicepidemiology/resfinder_db.git
-    resfinder_db_commit           = dc33e2f9ec2c420f99f77c5c33ae3faa79c999f2
-    resfinder_db_date             = Tue, 20 Mar 2018 16:49
+    resfinder_db_commit           = e8f1eb2585cd9610c4034a54ce7fc4f93aa95535
+    resfinder_db_date             = Mon, 16 Jul 2018 16:58
     pointfinder_db_dir            = staramr/databases/data/dist/pointfinder
     pointfinder_db_url            = https://bitbucket.org/genomicepidemiology/pointfinder_db.git
-    pointfinder_db_commit         = ba65c4d175decdc841a0bef9f9be1c1589c0070a
-    pointfinder_db_date           = Fri, 06 Apr 2018 09:02
+    pointfinder_db_commit         = 8706a6363bb29e47e0e398c53043b037c24b99a7
+    pointfinder_db_date           = Wed, 04 Jul 2018 14:27
+    plasmidfinder_db_dir          = staramr/databases/data/dist/plasmidfinder
+    plasmidfinder_db_url          = https://bitbucket.org/genomicepidemiology/plasmidfinder_db.git
+    plasmidfinder_db_commit       = 81919954cbedaff39056610ab584ab4c06011ed8
+    plasmidfinder_db_date         = Tue, 20 Nov 2018 08:51
     pointfinder_gene_drug_version = 050218
-    resfinder_gene_drug_version   = 050218 
+    resfinder_gene_drug_version   = 050218.1 
 
 results.xlsx
 ````````````
 
-An Excel spreadsheet containing the previous 4 files as separate worksheets.
+An Excel spreadsheet containing the previous 5 files as separate worksheets.
 
 BLAST Hits
 ``````````
@@ -283,6 +369,7 @@
 
 .. _staramr: https://github.com/phac-nml/staramr
 .. _ResFinder: https://bitbucket.org/genomicepidemiology/resfinder_db
+.. _PlasmidFinder: https://bitbucket.org/genomicepidemiology/plasmidfinder_db
 .. _PointFinder: https://bitbucket.org/genomicepidemiology/pointfinder_db
 .. _webservice: https://cge.cbs.dtu.dk/services/ResFinder/
     ]]></help>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test1-detailed-summary.tsv	Tue Apr 30 15:50:46 2019 -0400
@@ -0,0 +1,5 @@
+Isolate ID	Gene	Predicted Phenotype	%Identity	%Overlap	HSP Length/Total Length	Contig	Start	End	Accession	Data Type
+16S-rc_gyrA-rc_beta-lactam.fsa	None									Plasmid
+16S-rc_gyrA-rc_beta-lactam.fsa	16S_rrsD (C1065T)	spectinomycin	99.94	100.0	1544/1544	16S_rrsD	1604	61		Resistance
+16S-rc_gyrA-rc_beta-lactam.fsa	blaIMP-42	ampicillin, amoxicillin/clavulanic acid, cefoxitin, ceftriaxone, meropenem	99.73	100.0	741/741	16S_rrsD	4381	5121	AB753456	Resistance
+16S-rc_gyrA-rc_beta-lactam.fsa	gyrA (A67P)	ciprofloxacin I/R, nalidixic acid	99.96	100.0	2637/2637	16S_rrsD	4317	1681		Resistance
--- a/test-data/test1-hits/pointfinder_16S-rc_gyrA-rc_beta-lactam.fsa	Tue Feb 19 16:47:25 2019 -0500
+++ b/test-data/test1-hits/pointfinder_16S-rc_gyrA-rc_beta-lactam.fsa	Tue Apr 30 15:50:46 2019 -0400
@@ -1,4 +1,4 @@
->16S_rrsD isolate: 16S-rc_gyrA-rc_beta-lactam.fsa, contig: 16S_rrsD, contig_start: 1604, contig_end: 61, resistance_gene_start: 1, resistance_gene_end: 1544, hsp/length: 1544/1544, pid: 99.94%, plength: 100.00%
+>16S_rrsD isolate: 16S-rc_gyrA-rc_beta-lactam.fsa, contig: 16S_rrsD, contig_start: 1604, contig_end: 61, database_gene_start: 1, database_gene_end: 1544, hsp/length: 1544/1544, pid: 99.94%, plength: 100.00%
 AATTGAAGAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAG
 TCGAACGGTAACAGGAAGCAGCTTGCTGCTTCGCTGACGAGTGGCGGACGGGTGAGTAAT
 GTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTGGCTAATACCGCATA
@@ -25,7 +25,7 @@
 CCCGGGCCTTGTACACACCGCCCGTCACACCATGGGAGTGGGTTGCAAAAGAAGTAGGTA
 GCTTAACCTTCGGGAGGGCGCTTACCACTTTGTGATTCATGACTGGGGTGAAGTCGTAAC
 AAGGTAACCGTAGGGGAACCTGCGGTTGGATCACCTCCTTACCT
->gyrA isolate: 16S-rc_gyrA-rc_beta-lactam.fsa, contig: 16S_rrsD, contig_start: 4317, contig_end: 1681, resistance_gene_start: 1, resistance_gene_end: 2637, hsp/length: 2637/2637, pid: 99.96%, plength: 100.00%
+>gyrA isolate: 16S-rc_gyrA-rc_beta-lactam.fsa, contig: 16S_rrsD, contig_start: 4317, contig_end: 1681, database_gene_start: 1, database_gene_end: 2637, hsp/length: 2637/2637, pid: 99.96%, plength: 100.00%
 ATGAGCGACCTTGCGAGAGAAATTACACCGGTCAACATTGAGGAAGAGCTGAAAAGCTCC
 TATCTGGATTATGCGATGTCGGTCATTGTTGGCCGTGCGCTGCCGGATGTCCGAGATGGC
 CTGAAGCCGGTACACCGTCGCGTACTTTACGCCATGAACGTATTGGGCAATGACTGGAAC
--- a/test-data/test1-hits/resfinder_16S-rc_gyrA-rc_beta-lactam.fsa	Tue Feb 19 16:47:25 2019 -0500
+++ b/test-data/test1-hits/resfinder_16S-rc_gyrA-rc_beta-lactam.fsa	Tue Apr 30 15:50:46 2019 -0400
@@ -1,4 +1,4 @@
->blaIMP-42_1_AB753456 isolate: 16S-rc_gyrA-rc_beta-lactam.fsa, contig: 16S_rrsD, contig_start: 4381, contig_end: 5121, resistance_gene_start: 1, resistance_gene_end: 741, hsp/length: 741/741, pid: 99.73%, plength: 100.00%
+>blaIMP-42_1_AB753456 isolate: 16S-rc_gyrA-rc_beta-lactam.fsa, contig: 16S_rrsD, contig_start: 4381, contig_end: 5121, database_gene_start: 1, database_gene_end: 741, hsp/length: 741/741, pid: 99.73%, plength: 100.00%
 ATGAGCAAGTTATCTGCATTCTTTATATTTTTGTTTTGCAGCATTGATACCGCAGCAGAG
 TCTTTGCCAGATTTAAAAATTGAAAAGCTTGATGAAGGCGTTTATGTTCATACTTCGTTT
 GAAGAAGTTAACAGGTGGGGCGTTGTTCCTAAACATGGTTTGGTGGTTCTTGTAAATGCT
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test1-plasmidfinder.tsv	Tue Apr 30 15:50:46 2019 -0400
@@ -0,0 +1,1 @@
+Isolate ID	Gene	%Identity	%Overlap	HSP Length/Total Length	Contig	Start	End	Accession
--- a/test-data/test1-summary.tsv	Tue Feb 19 16:47:25 2019 -0500
+++ b/test-data/test1-summary.tsv	Tue Apr 30 15:50:46 2019 -0400
@@ -1,2 +1,2 @@
-Isolate ID	Genotype	Predicted Phenotype
-16S-rc_gyrA-rc_beta-lactam.fsa	16S_rrsD (C1065T), blaIMP-42, gyrA (A67P)	spectinomycin, ampicillin, amoxicillin/clavulanic acid, cefoxitin, ceftriaxone, meropenem, ciprofloxacin I/R, nalidixic acid
+Isolate ID	Genotype	Predicted Phenotype	Plasmid Genes
+16S-rc_gyrA-rc_beta-lactam.fsa	16S_rrsD (C1065T), blaIMP-42, gyrA (A67P)	spectinomycin, ampicillin, amoxicillin/clavulanic acid, cefoxitin, ceftriaxone, meropenem, ciprofloxacin I/R, nalidixic acid	None
--- a/test-data/test2-hits/resfinder_16S-rc_gyrA-rc_beta-lactam.fsa	Tue Feb 19 16:47:25 2019 -0500
+++ b/test-data/test2-hits/resfinder_16S-rc_gyrA-rc_beta-lactam.fsa	Tue Apr 30 15:50:46 2019 -0400
@@ -1,4 +1,4 @@
->blaIMP-42_1_AB753456 isolate: 16S-rc_gyrA-rc_beta-lactam.fsa, contig: 16S_rrsD, contig_start: 4381, contig_end: 5121, resistance_gene_start: 1, resistance_gene_end: 741, hsp/length: 741/741, pid: 99.73%, plength: 100.00%
+>blaIMP-42_1_AB753456 isolate: 16S-rc_gyrA-rc_beta-lactam.fsa, contig: 16S_rrsD, contig_start: 4381, contig_end: 5121, database_gene_start: 1, database_gene_end: 741, hsp/length: 741/741, pid: 99.73%, plength: 100.00%
 ATGAGCAAGTTATCTGCATTCTTTATATTTTTGTTTTGCAGCATTGATACCGCAGCAGAG
 TCTTTGCCAGATTTAAAAATTGAAAAGCTTGATGAAGGCGTTTATGTTCATACTTCGTTT
 GAAGAAGTTAACAGGTGGGGCGTTGTTCCTAAACATGGTTTGGTGGTTCTTGTAAATGCT
--- a/test-data/test2-summary.tsv	Tue Feb 19 16:47:25 2019 -0500
+++ b/test-data/test2-summary.tsv	Tue Apr 30 15:50:46 2019 -0400
@@ -1,2 +1,2 @@
-Isolate ID	Genotype	Predicted Phenotype
-16S-rc_gyrA-rc_beta-lactam.fsa	blaIMP-42	ampicillin, amoxicillin/clavulanic acid, cefoxitin, ceftriaxone, meropenem
+Isolate ID	Genotype	Predicted Phenotype	Plasmid Genes
+16S-rc_gyrA-rc_beta-lactam.fsa	blaIMP-42	ampicillin, amoxicillin/clavulanic acid, cefoxitin, ceftriaxone, meropenem	None
--- a/test-data/test3-summary.tsv	Tue Feb 19 16:47:25 2019 -0500
+++ b/test-data/test3-summary.tsv	Tue Apr 30 15:50:46 2019 -0400
@@ -1,2 +1,2 @@
-Isolate ID	Genotype	Predicted Phenotype
-16S-rc_gyrA-rc_beta-lactam.fsa	None	Sensitive
+Isolate ID	Genotype	Predicted Phenotype	Plasmid Genes
+16S-rc_gyrA-rc_beta-lactam.fsa	None	Sensitive	None
--- a/test-data/test4-summary.tsv	Tue Feb 19 16:47:25 2019 -0500
+++ b/test-data/test4-summary.tsv	Tue Apr 30 15:50:46 2019 -0400
@@ -1,2 +1,2 @@
-Isolate ID	Genotype	Predicted Phenotype
-16S_rc_gyrA_rc_beta-lactam_spaces__extra:characters_.fsa	None	Sensitive
+Isolate ID	Genotype	Predicted Phenotype	Plasmid Genes
+16S_rc_gyrA_rc_beta-lactam_spaces__extra:characters_.fsa	None	Sensitive	None
--- a/test-data/test5-summary.tsv	Tue Feb 19 16:47:25 2019 -0500
+++ b/test-data/test5-summary.tsv	Tue Apr 30 15:50:46 2019 -0400
@@ -1,2 +1,2 @@
-Isolate ID	Genotype	Predicted Phenotype
-test-aminoglycoside.fsa	None	Sensitive
+Isolate ID	Genotype	Predicted Phenotype	Plasmid Genes
+test-aminoglycoside.fsa	None	Sensitive	None
--- a/test-data/test6-summary.tsv	Tue Feb 19 16:47:25 2019 -0500
+++ b/test-data/test6-summary.tsv	Tue Apr 30 15:50:46 2019 -0400
@@ -1,2 +1,2 @@
-Isolate ID	Genotype	Predicted Phenotype
-test-aminoglycoside.fsa	aac(6')-Iaa	gentamicin
+Isolate ID	Genotype	Predicted Phenotype	Plasmid Genes
+test-aminoglycoside.fsa	aac(6')-Iaa	gentamicin	None