|
7
|
1 <tool id="tarean" name="Tandem Repeat Analyzer" version="2.3.8" >
|
|
2
|
2 <stdio>
|
|
|
3 <regex match="Traceback" source="stderr" level="fatal" description="Unknown error" />
|
|
|
4 <regex match="error" source="stderr" level="fatal" description="Unknown error" />
|
|
|
5 <regex match="warning" source="stderr" level="warning" description="Unknown warning" />
|
|
|
6 <exit_code range="1:" level="fatal" description="Error" />
|
|
|
7 </stdio>
|
|
|
8 <description>Identification of genomic tandem repeats from NGS data</description>
|
|
4
|
9 <requirements>
|
|
6
|
10 <container type="singularity">library://repeatexplorer/default/repex_tarean:0.3.8-dbaa07f</container>
|
|
4
|
11 </requirements>
|
|
2
|
12 <command detect_errors="exit_code">
|
|
|
13 export PYTHONHASHSEED=0;
|
|
4
|
14 seqclust --paired --sample ${read_sampling.sample} --output_dir=tarean_output --logfile=${log} --cleanup --tarean_mode
|
|
2
|
15 #if $advanced_options.advanced:
|
|
|
16 --mincl $advanced_options.size_threshold $advanced_options.keep_names $advanced_options.automatic_filtering -M $advanced_options.merging
|
|
|
17 #if $advanced_options.custom_library.options_custom_library :
|
|
|
18 -d $advanced_options.custom_library.library extra_database
|
|
|
19 #end if
|
|
|
20 #if $advanced_options.options.options:
|
|
|
21 -opt $advanced_options.options.options
|
|
|
22 #end if
|
|
|
23 #else:
|
|
|
24 -M 0.2
|
|
|
25
|
|
|
26 #end if
|
|
|
27 ${FastaFile} >stdout.log 2> stderr.log ;
|
|
|
28 echo "STDOUT CONTENT:" >> ${log} ;
|
|
|
29 cat stdout.log >> ${log} ;
|
|
|
30 echo "STDERR CONTENT:" >> ${log} ;
|
|
|
31 cat stderr.log >> ${log} &&
|
|
4
|
32 /opt/repex_tarean/stderr_filter.py stderr.log &&
|
|
2
|
33 cd tarean_output &&
|
|
|
34 zip -r ${ReportArchive}.zip * &&
|
|
|
35 mv ${ReportArchive}.zip ${ReportArchive} &&
|
|
|
36 cp index.html ${ReportFile} &&
|
|
|
37 mkdir ${ReportFile.files_path} &&
|
|
|
38 cp -r --parents libdir ${ReportFile.files_path} &&
|
|
|
39 cp -r --parents seqclust/clustering/superclusters ${ReportFile.files_path} &&
|
|
|
40 cp -r --parents seqclust/clustering/clusters ${ReportFile.files_path} &&
|
|
|
41 cp seqclust/clustering/hitsort.cls ${ReportFile.files_path}/seqclust/clustering/hitsort.cls &&
|
|
|
42 cp *.png ${ReportFile.files_path}/ &&
|
|
|
43 cp *.csv ${ReportFile.files_path}/ &&
|
|
|
44 cp *.html ${ReportFile.files_path}/ &&
|
|
|
45 cp *.css ${ReportFile.files_path}/ &&
|
|
|
46 cp *.fasta ${ReportFile.files_path}/ 2>>$log && rm -r ../tarean_output || :
|
|
|
47
|
|
|
48
|
|
|
49 </command>
|
|
|
50
|
|
|
51 <inputs>
|
|
|
52 <param name="FastaFile" label="Paired-end Illumina reads" type="data" format="fasta"
|
|
|
53 help="Input file must contain FASTA-formatted interlaced read pairs from paired-end sequencing. All pairs must be complete. Example of the input data format is provided in the help below."/>
|
|
|
54
|
|
|
55 <conditional name="read_sampling">
|
|
|
56 <param name="do_sampling" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Read sampling" help="Use this option if you want to analyze only a part of the reads" />
|
|
|
57 <when value="false">
|
|
|
58 <!-- pass -->
|
|
|
59 <param name="sample" label="Sample size" hidden="True" type="integer" value="0" help="Number of analyzed reads"/>
|
|
|
60 </when>
|
|
|
61 <when value="true">
|
|
|
62 <param name="sample" label="Sample size" type="integer" value="500000" min="10000" help="Number of analyzed reads"/>
|
|
|
63 </when>
|
|
|
64 </conditional>
|
|
|
65
|
|
|
66 <conditional name="advanced_options">
|
|
|
67 <param name="advanced" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Advanced options" />
|
|
|
68 <when value="false">
|
|
|
69 <!-- pass -->
|
|
|
70 </when>
|
|
|
71 <when value="true">
|
|
|
72 <param name="merging" type="boolean" truevalue="0.2" falsevalue="0" checked="True" label="Perform cluster merging" help="By default, clusters connected through paired-end reads are merged"/>
|
|
|
73 <conditional name="custom_library">
|
|
|
74 <param name="options_custom_library" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Use custom repeat database"/>
|
|
|
75 <when value="false">
|
|
|
76 <!-- do nothing here -->
|
|
|
77 </when>
|
|
|
78 <when value="true">
|
|
|
79 <param name="library" format="fasta" type="data" label="Use custom repeat database" help="Perform additional similarity search to user-provided repeat database. The database should contain FASTA-formatted DNA sequences with headers (sequence names) in the format: '>reapeatname#class/subclass'"/>
|
|
|
80 </when>
|
|
|
81 </conditional>
|
|
|
82 <param name="size_threshold" label="Cluster size threshold for detailed analysis" type="float" value="0.01" min="0.0001" max="100" help ="Minimal size (as percentage of input reads) of the smallest cluster which is analyzed; cluster with less than 20 reads are not considered."/>
|
|
|
83 <param name="automatic_filtering" label="Perform automatic filtering of abundant satellite repeats" type="boolean" truevalue="--automatic_filtering" falsevalue="" checked="false"/>
|
|
|
84 <param name="keep_names" label="Keep original read names" type="boolean" truevalue="--keep_names" falsevalue="" checked="false" help="By default, reads are renamed using integers. Use this option if you want to keep original names."/>
|
|
|
85 <conditional name="options">
|
|
|
86 <param name="options" type="select" label="Similarity search options">
|
|
|
87 <option value="ILLUMINA" selected="true">Default </option>
|
|
|
88 <option value="ILLUMINA_DUST_OFF" selected="false">Masking of low complexity repeats disabled </option>
|
|
|
89
|
|
|
90 <!-- <option value="ILLUMINA_SENSITIVE_MGBLAST" selected="false">Illumina reads, sensitive search (search parameters: mgblast, min PID 80, -W8) slow, experimental feature!</option> -->
|
|
|
91 <!-- <option value="ILLUMINA_SENSITIVE_BLASTPLUS" selected="false">Illumina reads, more sensitive search (search parameters: blastn, min PID 80, -W6) extremely slow, experimental feature!</option> -->
|
|
|
92 <!-- <option value="OXFORD_NANOPORE" selected="false"> -->
|
|
|
93 <!-- Pseudo short reads simulated from Oxford Nanopore data, experimental feature! -->
|
|
|
94 <!-- </option> -->
|
|
|
95 </param>
|
|
|
96 </conditional>
|
|
|
97 </when>
|
|
|
98 </conditional>
|
|
|
99
|
|
5
|
100 <conditional name="queue_definition">
|
|
|
101 <param name="queue_select" type="select" label="Select queue">
|
|
|
102 <option value="basic_fast_queue">basic (max runtime 2 days, 4 GB RAM)</option>
|
|
|
103 <option value="long_slow_queue">long (max runtime 2 weeks, 64 GB RAM)</option>
|
|
|
104 <option value="extra_long_slow_queue">extra long (max runtime 4 weeks, 64 GB RAM)</option>
|
|
|
105 </param>
|
|
|
106 <when value="basic_fast_queue">
|
|
|
107 <param name="queue_specification" type="text" label="Modify parameters (optional)"
|
|
|
108 value="-l select=1:ncpus=10:mem=32gb:scratch_local=50gb -l walltime=48:00:00 -q elixirre@pbs.elixir-czech.cz -v TAREAN_MAX_MEM=4000000,TAREAN_CPU=4" />
|
|
|
109 </when>
|
|
|
110
|
|
|
111 <when value="long_slow_queue">
|
|
|
112 <param name="queue_specification" type="text" label="Modify parameters (optional)"
|
|
|
113 value="-l select=1:ncpus=16:mem=112gb:scratch_local=50gb -l walltime=336:00:00 -q elixirre@pbs.elixir-czech.cz -v TAREAN_MAX_MEM=64000000,TAREAN_CPU=15" />
|
|
|
114 </when>
|
|
|
115 <when value="extra_long_slow_queue">
|
|
|
116 <param name="queue_specification" type="text" label="Modify parameters (optional)"
|
|
|
117 value="-l select=1:ncpus=16:mem=112gb:scratch_local=50gb -l walltime=720:00:00 -q elixirre@pbs.elixir-czech.cz -v TAREAN_MAX_MEM=64000000,TAREAN_CPU=15" />
|
|
|
118 </when>
|
|
|
119 </conditional>
|
|
|
120
|
|
|
121
|
|
2
|
122
|
|
|
123 </inputs>
|
|
|
124 <outputs>
|
|
|
125 <data name="log" format="txt" label="TAREAN log file"/>
|
|
|
126 <data name="ReportArchive" format="zip" label="TAREAN Archive with HTML report from data ${FastaFile.hid}"/>
|
|
|
127 <data name="ReportFile" format="html" label="TAREAN HTML report from data ${FastaFile.hid}"/>
|
|
|
128 </outputs>
|
|
|
129
|
|
|
130 <help>
|
|
|
131 **HELP**
|
|
|
132
|
|
|
133 TAREAN - TAndem REpeat ANalyzer is a computational pipeline for
|
|
|
134 **unsupervised identification of satellite repeats** from unassembled
|
|
|
135 sequence reads. The pipeline uses low-pass paired-end whole genome
|
|
|
136 sequence reads and performs graph-based clustering. The resulting
|
|
|
137 clusters, representing all types of repeats present in the genome, are
|
|
|
138 then examined to identify those containing circular structures indicative
|
|
|
139 of tandem repeats. A poster summarizing TAREAN principles and
|
|
|
140 implementation can be found `here.`__
|
|
|
141
|
|
|
142
|
|
|
143 .. __: http://w3lamc.umbr.cas.cz/lamc/?page_id=312
|
|
|
144
|
|
|
145 **Input data**
|
|
|
146
|
|
|
147
|
|
|
148 The analysis requires **paired-end reads** generated by whole genome
|
|
|
149 shotgun sequencing. The data should be provided as a single input file in
|
|
|
150 fasta format with the reads interlaced (see example below). All the pairs
|
|
|
151 must be complete, i.e. both "forward" and "reverse" sequence reads must be
|
|
|
152 present. The reads should all be trimmed to the same length. The optimal
|
|
|
153 size range is between 100 and 200 nucleotides. The number of reads to be
|
|
|
154 analyzed should not exceed 1x coverage of the genome. Genome coverage
|
|
|
155 between 0.01 and 0.5x is recommended. The reads should be filtered for
|
|
|
156 quality. The recommended quality filtering is as follows: each read should
|
|
|
157 have a quality score >=10 for 95% of the bases, i.e. if your reads are 100
|
|
|
158 base pairs long, then a read only passes this quality threshold if 95
|
|
|
159 bases have a quality of 10 or higher. Additionally, any reads containing
|
|
|
160 indeterminate base pairs (indicated as N in the reads) should be removed.
|
|
|
161 Finally, if either one of the reads in a pair fails to meet the
|
|
|
162 aforementioned thresholds, **both** sequences should be removed.
|
|
|
163 example of interlaced input format::
|
|
|
164
|
|
|
165 >0001_f
|
|
|
166 CGTAATATACATACTTGCTAGCTAGTTGGATGCATCCAACTTGCAAGCTAGTTTGATG
|
|
|
167 >0001_r
|
|
|
168 GATTTGACGGACACACTAACTAGCTAGTTGCATCTAAGCGGGCACACTAACTAACTAT
|
|
|
169 >0002_f
|
|
|
170 ACTCATTTGGACTTAACTTTGATAATAAAAACTTAAAAAGGTTTCTGCACATGAATCG
|
|
|
171 >0002_r
|
|
|
172 TATGTTGAAAAATTGAATTTCGGGACGAAACAGCGTCTATCGTCACGACATAGTGCTC
|
|
|
173 >0003_f
|
|
|
174 TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT
|
|
|
175 >0003_r
|
|
|
176 TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT
|
|
|
177 ...
|
|
|
178
|
|
|
179
|
|
|
180 To perform the quality filtering on your fastQ formatted data as described
|
|
|
181 above, and to interlace your paired-end sequence reads,
|
|
|
182 please use the `Preprocessing of paired-reads`__ tool.
|
|
|
183
|
|
|
184 .. __: tool_runner?tool_id=paired_fastq_filtering
|
|
|
185
|
|
|
186
|
|
|
187 **Additional parameters**
|
|
|
188
|
|
|
189 **Sample size** defines how many reads will be used during the computation.
|
|
|
190 The default setting of 500,000 reads will enable detection of high copy
|
|
|
191 number satellites within several hours. For higher
|
|
|
192 sensitivity the sample size can be increased. Since the sample size affects
|
|
|
193 memory usage, this parameter may be automatically adjusted to a lower value
|
|
|
194 during the run. The maximum sample size which can be processed depends on the
|
|
|
195 repetitiveness of the analyzed genome. This significantly limits the number of reads
|
|
|
196 that can be analyzed with the TAREAN pipeline.
|
|
|
197
|
|
|
198 **Perform cluster merging**. Families of repetitive elements are
|
|
|
199 frequently split into multiple clusters rather than being represented as a
|
|
|
200 single one. If you do not want to merge clusters based on the presence
|
|
|
201 of broken read pairs, disable this option.
|
|
|
202
|
|
|
203 **Use custom repeat database**. This option allows users to perform similarity
|
|
|
204 comparison of identified repeats to their custom databases. The repeat class should
|
|
|
205 be encoded in FASTA headers of database entries in order to allow correct
|
|
|
206 parsing of similarity hits.
|
|
|
207
|
|
|
208 **Similarity search options** By default sequence reads are compared using
|
|
|
209 mgblast program. Default threshold is explicitly set to 90% sequence
|
|
|
210 similarity spanning at least 55% of the read length (in the case of reads
|
|
|
211 differing in length it applies to the longer one). Additionally, sequence
|
|
|
212 overlap must be at least 55 nt. If you select option for shorter reads
|
|
|
213 than 100 nt, minimum overlap 55 nt is not required.
|
|
|
214
|
|
|
215 By default,
|
|
|
216 mgblast search use DUST program to filter out
|
|
|
217 low-complexity sequences. If you want
|
|
|
218 to increase sensitivity of detection of satellites with shorter monomer
|
|
|
219 use option with '*no masking of low complexity repeats*'. Note that omitting
|
|
|
220 DUST filtering will significantly increase running times
|
|
|
221
|
|
|
222 **Output**
|
|
|
223
|
|
|
224 A list of clusters identified as putative satellite repeats, their genomic
|
|
|
225 abundance and various cluster characteristics are provided. Length and
|
|
|
226 consensus sequences of reconstructed monomers are also shown and
|
|
|
227 accompanied by a detailed output from kmer-based reconstruction including
|
|
|
228 sequences and sequence logos of alternative variants of monomer sequences.
|
|
|
229
|
|
|
230 The output includes an **HTML summary** with a table listing all analyzed
|
|
|
231 clusters. More detailed information about clusters is provided in
|
|
|
232 additional files and directories. All results are also provided as a
|
|
|
233 downloadable **zip archive**. Since read clustering results in
|
|
|
234 thousands of clusters, the search for satellite repeats is limited to
|
|
|
235 a subset of the largest ones corresponding to the most abundant genomic
|
|
|
236 repeats. The default setting of the pipeline is to analyze all clusters containing at least
|
|
|
237 0.01% of the input reads. Besides the satellite repeats, three other
|
|
|
238 groups of clusters are reported in the output (1) LTR-retrotransposons,
|
|
|
239 (2) 45S and 5S rDNA and (3) all remaining clusters passing the size
|
|
|
240 threshold. As (1) and (2) contain sequences with circular
|
|
|
241 graphs, their consensus is calculated in the same way as for satellite
|
|
|
242 repeats. Additionally a **log file** reporting the progress of the
|
|
|
243 computational pipeline is provided.
|
|
|
244
|
|
|
245
|
|
|
246 </help>
|
|
|
247
|
|
|
248 </tool>
|
