Mercurial > repos > petr-novak > repeatexplorer2_testing
changeset 2:349b197133dc draft
Uploaded
| author | petr-novak | 
|---|---|
| date | Fri, 24 Jul 2020 07:26:59 -0400 | 
| parents | 422485508110 | 
| children | d1f67a13b70f | 
| files | repex_full_clustering.xml repex_tarean.xml tool_dependencies.xml | 
| diffstat | 3 files changed, 569 insertions(+), 26 deletions(-) [+] | 
line wrap: on
 line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/repex_full_clustering.xml Fri Jul 24 07:26:59 2020 -0400 @@ -0,0 +1,311 @@ +<tool id="repeatexplorer2" name="RepeatExplorer2 clustering: " version="2.3.8" > + <stdio> + <regex match="lastdb: can't open file: NEAR" source="stderr" level="fatal" description="Version of last is too old, use ver 956 or higher\n" /> + <regex match="Traceback" source="stderr" level="fatal" description="Unknown error" /> + <regex match="error" source="stderr" level="fatal" description="Unknown error" /> + <regex match="Warning" source="stderr" level="warning" description="Unknown error" /> + <exit_code range="1:" level="fatal" description="Error" /> + </stdio> + <description>Improved version or repeat discovery and characterization using graph-based sequence clustering</description> + <requirements> + <requirement type="package" version="1.18.1">numpy</requirement> + <requirement type="package" version="0.8">logomaker</requirement> + <requirement type="package" version="1.0.3">pandas</requirement> + <requirement type="package" version="3.1.3">matplotlib</requirement> + <requirement type="package">last</requirement> + <requirement type="package">imagemagick</requirement> + <requirement type="package">mafft</requirement> + <requirement type="package">blast</requirement> + <requirement type="package" version="0.9.29" >diamond</requirement> + <requirement type="package">blast-legacy</requirement> + <requirement type="package">r-igraph</requirement> + <requirement type="package">r-data.tree</requirement> + <requirement type="package">r-stringr</requirement> + <requirement type="package">r-r2html</requirement> + <requirement type="package">r-hwriter</requirement> + <requirement type="package">r-dt</requirement> + <requirement type="package">r-scales</requirement> + <requirement type="package">r-plotrix</requirement> + <requirement type="package">r-png</requirement> + <requirement type="package">r-plyr</requirement> + <requirement type="package">r-dplyr</requirement> + <requirement type="package">r-optparse</requirement> + <requirement type="package">r-dbi</requirement> + <requirement type="package">r-rsqlite</requirement> + <requirement type="package">r-rserve</requirement> + <requirement type="package">bioconductor-biostrings</requirement> + <requirement type="package" version="2.3.8">repex_tarean</requirement> + <requirement type="set_environment">REPEX</requirement> + <requirement type="set_environment">REPEX_VERSION</requirement> + <requirement type="package" version="0.9.1" >pyrserve</requirement> + </requirements> + <command > + export PYTHONHASHSEED=0; + \${REPEX}/seqclust --sample ${read_sampling.sample} --output_dir=tarean_output --logfile=${log} --cleanup $paired --taxon $taxon + + #if $advanced_options.advanced: + --mincl $advanced_options.size_threshold $advanced_options.keep_names $advanced_options.automatic_filtering -D $advanced_options.blastx.options_blastx + --assembly_min $advanced_options.assembly_min_cluster_size + + #if $advanced_options.comparative.options_comparative: + --prefix_length $advanced_options.comparative.prefix_length + #end if + + #if $advanced_options.custom_library.options_custom_library: + -d $advanced_options.custom_library.library extra_database + #end if + + #if $advanced_options.options.options: + -opt $advanced_options.options.options + #end if + #end if + ${FastaFile} >stdout.log 2> stderr.log ; + echo "STDOUT CONTENT:" >> ${log} ; + cat stdout.log >> ${log} ; + echo "STDERR CONTENT:" >> ${log}; + cat stderr.log >> ${log} && + \${REPEX}/stderr_filter.py stderr.log && + cd tarean_output && + zip -r ${ReportArchive}.zip * && + mv ${ReportArchive}.zip ${ReportArchive} && + cp index.html ${ReportFile} && + mkdir ${ReportFile.files_path} && + cp -r --parents libdir ${ReportFile.files_path} && + cp -r --parents seqclust/clustering/superclusters ${ReportFile.files_path} && + cp -r --parents seqclust/clustering/clusters ${ReportFile.files_path} && + cp seqclust/clustering/hitsort.cls ${ReportFile.files_path}/seqclust/clustering/hitsort.cls && + cp *.png ${ReportFile.files_path}/ && + cp *.csv ${ReportFile.files_path}/ && + cp *.html ${ReportFile.files_path}/ && + cp *.css ${ReportFile.files_path}/ && + cp *.fasta ${ReportFile.files_path}/ 2>>$log && rm -r ../tarean_output || : + + </command> + <inputs> + <param name="FastaFile" label="NGS reads" type="data" format="fasta" + help="Input file must contain FASTA-formatted NGS reads. Illumina paired-end reads are recommended."/> + <param name="paired" type="boolean" truevalue="--paired" falsevalue="" checked="True" label="Paired-end reads" help="If paired-end reads are used, left- and right-hand reads must be interlaced and all pairs must be complete. Example of the correct format is provided in the help below." /> + + <conditional name="read_sampling"> + <param name="do_sampling" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Read sampling" help="Use this option if you want to analyze only a part of the reads" /> + <when value="false"> + <!-- pass --> + <param name="sample" label="Sample size" hidden="True" type="integer" value="0" help="Number of analyzed reads"/> + </when> + <when value="true"> + <param name="sample" label="Sample size" type="integer" value="500000" min="10000" help="Number of analyzed reads"/> + </when> + </conditional> + + + <param name="taxon" label="Select taxon and protein domain database version (REXdb)" type="select" help="Reference database of transposable element protein domains - REXdb - is used for annotation of repeats"> + <option value="VIRIDIPLANTAE3.0" selected="true">Viridiplantae version 3.0 </option> + <option value="VIRIDIPLANTAE2.2" selected="true">Viridiplantae version 2.2</option> + <option value="METAZOA3.0" >Metazoa version 3.0</option> + <option value="METAZOA2.0" >Metazoa version 2.0</option> + <!-- Modify setting in config.py accordingly --> + </param> + + <conditional name="advanced_options"> + <param name="advanced" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Advanced options" /> + <when value="false"> + <!-- pass --> + </when> + <when value="true"> + <conditional name="comparative"> + <param name="options_comparative" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Perform comparative analysis" help="Use this options to analyze multiple samples simultaneously"/> + <when value="false"> + <!-- do nothing here --> + </when> + <when value="true"> + <param name="prefix_length" label="Group code length" type="integer" value="3" min="1" max="10" help="For comparative analysis, reads from different samples are distinguished by sample codes included as prefix to the read names. See example below."/> + </when> + </conditional> + + <conditional name="blastx"> + <param name="options_blastx" type="select" label="Select parameters for protein domain search"> + <option value="BLASTX_W2" selected="false">blastx with word size 2 (the most sensitive, slowest)</option> + <option value="BLASTX_W3" selected="true">blastx with word size 3 (default)</option> + <option value="DIAMOND" selected="false">diamond program (the least sensitive, fastest)</option> + </param> + </conditional> + + <conditional name="options"> + <param name="options" type="select" label="Similarity search options"> + <option value="ILLUMINA" selected="true">Default </option> + <option value="ILLUMINA_DUST_OFF" selected="false">Masking of low complexity repeats disabled </option> + + <!-- <option value="ILLUMINA_SENSITIVE_MGBLAST" selected="false">Illumina reads, sensitive search (search parameters: mgblast, min PID 80, -W8) slow, experimental feature!</option> --> + <!-- <option value="ILLUMINA_SENSITIVE_BLASTPLUS" selected="false">Illumina reads, more sensitive search (search parameters: blastn, min PID 80, -W6) extremely slow, experimental feature!</option> --> + <!-- <option value="OXFORD_NANOPORE" selected="false"> --> + <!-- Pseudo short reads simulated from Oxford Nanopore data, experimental feature! --> + <!-- </option> --> + </param> + </conditional> + + <conditional name="custom_library"> + <param name="options_custom_library" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Use custom repeat database"/> + <when value="false"> + <!-- do nothing here --> + </when> + <when value="true"> + <param name="library" format="fasta" type="data" label="Custom repeat database" help="The database should contain DNA sequences in FASTA format. The required format for sequence IDs is : '>reapeatname#class/subclass'"/> + </when> + </conditional> + <param name="size_threshold" label="Cluster size threshold for detailed analysis" type="float" value="0.01" min="0.0001" max="100" help ="Minimal size (as percentage of input reads) of the smallest cluster which is analyzed; clusters with less than 20 reads are not considered."/> + <param name="automatic_filtering" label="Perform automatic filtering of abundant satellite repeats" help="Automatic filtering identifies the most abundant tandem repeats and partially removes their reads from the analysis. This enables to analyze higher proportions of other less abundant repeats." type="boolean" truevalue="--automatic_filtering" falsevalue="" checked="false"/> + <param name="keep_names" label="Keep original read names" type="boolean" truevalue="--keep_names" falsevalue="" checked="false" help="By default, reads are renamed using integers. Use this option to keep original names."/> + <param name="assembly_min_cluster_size" type="integer" label="Minimal cluster size for assembly" value="5" min="2" max="100"/> + </when> + </conditional> + + + + </inputs> + <outputs> + <data name="log" format="txt" label="RepeatExplorer2 - log file"/> + <data name="ReportArchive" format="zip" label="RepeatExplorer2 - Archive with HTML report from data ${FastaFile.hid}"/> + <data name="ReportFile" format="html" label="RepeatExplorer2 - HTML report from data ${FastaFile.hid}"/> + </outputs> + + <help> + **HELP** + + RepeatExplorer2 clustering is a computational pipeline for unsupervised + identification of repeats from unassembled sequence reads. The + pipeline uses low-pass whole genome sequence reads and performs graph-based + clustering. Resulting clusters, representing all types of repeats, are then + examined to identify and classify into repeats groups. + + **Input data** + + The analysis requires either **single** or **paired-end reads** generated + by whole genome shotgun sequencing provided as a single fasta-formatted file. + Generally, paired-end reads provide significantly better results than single + reads. Reads should be of uniform length (optimal size range is 100-200 nt) and + the number of analyzed reads should represent less than 1x genome equivalent + (genome coverage of 0.01 - 0.50 x is recommended). Reads should be + quality-filtered (recommended filtering : quality score >=10 over 95% of bases + and no Ns allowed) and only **complete read pairs** should be submitted for + analysis. When paired reads are used, input data must be **interlaced** format + as fasta file: + + example of interlaced input format:: + + >0001_f + CGTAATATACATACTTGCTAGCTAGTTGGATGCATCCAACTTGCAAGCTAGTTTGATG + >0001_r + GATTTGACGGACACACTAACTAGCTAGTTGCATCTAAGCGGGCACACTAACTAACTAT + >0002_f + ACTCATTTGGACTTAACTTTGATAATAAAAACTTAAAAAGGTTTCTGCACATGAATCG + >0002_r + TATGTTGAAAAATTGAATTTCGGGACGAAACAGCGTCTATCGTCACGACATAGTGCTC + >0003_f + TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT + >0003_r + TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT + ... + + + **Comparative analysis** + + For comparative analysis sequence names must contain code (prefix) for each group. + Prefix in sequences names must be of fixed length. + + Example of labeling two groups with where **group code length** is 2 and is used to distinguish groups - AA and BB :: + + >AA0001_f + CGTAATATACATACTTGCTAGCTAGTTGGATGCATCCAACTTGCAAGCTAGTTTGATG + >AA0001_r + GATTTGACGGACACACTAACTAGCTAGTTGCATCTAAGCGGGCACACTAACTAACTAT + >AA0002_f + ACTCATTTGGACTTAACTTTGATAATAAAAACTTAAAAAGGTTTCTGCACATGAATCG + >AA0002_r + TATGTTGAAAAATTGAATTTCGGGACGAAACAGCGTCTATCGTCACGACATAGTGCTC + >BB0001_f + TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT + >BB0001_r + TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT + >BB0002_f + TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT + >BB0002_r + TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT + + + To prepare quality filtered and interlaced input fasta file from fastq + files, use `Preprocessing of paired-reads`__ tool. + + .. __: tool_runner?tool_id=paired_fastq_filtering + + + **Additional parameters** + + **Sample size** defines how many reads should be used in calculation. + Default setting with 500,000 reads will enable detection of high copy + repeats within several hours of computation time. For higher + sensitivity the sample size can be set higher. Since sample size affects + the memory usage, this parameter may be automatically adjusted to lower + value during the run. Maximum sample size which can be processed depends on + the repetitiveness of analyzed genome. + + + **Select taxon and protein domain database version (REXdb)**. Classification + of transposable elements is based on the similarity to our reference database + of transposable element protein domains (**REXdb**). Standalone database for Viridiplantae species + can be obtained on `repeatexplorer.org`__. Classification + system used in REXdb is described in article `Systematic survey of plant + LTR-retrotransposons elucidates phylogenetic relationships of their + polyprotein domains and provides a reference for element classification`__ + Database for Metazoa species is still under development so use it with caution. + + .. __: http://repeatexplorer.org + .. __: https://doi.org/10.1186/s13100-018-0144-1 + + **Select parameters for protein domain search** REXdb is compared with s + equence clusters either using blastx or diamond aligner. Diamond program + is about three time faster than blastx with word size 3. + + **Similarity search options** By default sequence reads are compared using + mgblast program. Default threshold is explicitly set to 90% sequence + similarity spanning at least 55% of the read length (in the case of reads + differing in length it applies to the longer one). Additionally, sequence + overlap must be at least 55 nt. If you select option for shorter reads + than 100 nt, minimum overlap 55 nt is not required. + + By default, + mgblast search use DUST program to filter out + low-complexity sequences. If you want + to increase sensitivity of detection of satellites with shorter monomer + use option with '*no masking of low complexity repeats*'. Note that omitting + DUST filtering will significantly increase running times + + + **Automatic filtering of abundant satellite repeats** perform clustering on + smaller dataset of sequence reads to detect abundant high confidence + satellite repeats. If such satellites are detected, sequence reads derived + from these satellites are depleted from input dataset. This step enable more + sensitive detection of less abundant repeats as more reads can be used + in clustering step. + + **Use custom repeat database**. This option allows users to perform similarity + comparison of identified repeats to their custom databases. The repeat class must + be encoded in FASTA headers of database entries in order to allow correct + parsing of similarity hits. Required format for custom database sequence name is: :: + + >reapeatname#class/subclass + + + **Output** + + List of clusters identified as putative satellite repeats, their genomic + abundance and various cluster characteristics. + + Output includes a **HTML summary** with table listing of all analyzed + clusters. More detailed information about clusters is provided in + additional files and directories. All results are also provided as + downloadable **zip archive**. Additionally a **log file** reporting + the progress of the computational pipeline is provided. + + </help> + +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/repex_tarean.xml Fri Jul 24 07:26:59 2020 -0400 @@ -0,0 +1,251 @@ +<tool id="tarean" name="Tandem Repeat Analyzer" version="2.3.8" > + <stdio> + <regex match="Traceback" source="stderr" level="fatal" description="Unknown error" /> + <regex match="error" source="stderr" level="fatal" description="Unknown error" /> + <regex match="warning" source="stderr" level="warning" description="Unknown warning" /> + <exit_code range="1:" level="fatal" description="Error" /> + </stdio> + <description>Identification of genomic tandem repeats from NGS data</description> + <requirements> + <requirement type="package">imagemagick</requirement> + <requirement type="package">mafft</requirement> + <requirement type="package">blast</requirement> + <requirement type="package" version="0.9.29">diamond</requirement> + <requirement type="package">blast-legacy</requirement> + <requirement type="package">r-igraph</requirement> + <requirement type="package">r-data.tree</requirement> + <requirement type="package">r-stringr</requirement> + <requirement type="package">r-r2html</requirement> + <requirement type="package">r-hwriter</requirement> + <requirement type="package">r-dt</requirement> + <requirement type="package">r-scales</requirement> + <requirement type="package">r-plotrix</requirement> + <requirement type="package">r-png</requirement> + <requirement type="package">r-plyr</requirement> + <requirement type="package">r-dplyr</requirement> + <requirement type="package">r-optparse</requirement> + <requirement type="package">r-dbi</requirement> + <requirement type="package">r-rsqlite</requirement> + <requirement type="package">r-rserve</requirement> + <requirement type="package">bioconductor-biostrings</requirement> + <requirement type="package" version="2.3.8">repex_tarean</requirement> + <requirement type="set_environment">REPEX</requirement> + <requirement type="set_environment">REPEX_VERSION</requirement> + <requirement type="package" version="0.9.1">pyrserve</requirement> + </requirements> + <command detect_errors="exit_code"> + export PYTHONHASHSEED=0; + \${REPEX}/seqclust --paired --sample ${read_sampling.sample} --output_dir=tarean_output --logfile=${log} --cleanup --tarean_mode + #if $advanced_options.advanced: + --mincl $advanced_options.size_threshold $advanced_options.keep_names $advanced_options.automatic_filtering -M $advanced_options.merging + #if $advanced_options.custom_library.options_custom_library : + -d $advanced_options.custom_library.library extra_database + #end if + #if $advanced_options.options.options: + -opt $advanced_options.options.options + #end if + #else: + -M 0.2 + + #end if + ${FastaFile} >stdout.log 2> stderr.log ; + echo "STDOUT CONTENT:" >> ${log} ; + cat stdout.log >> ${log} ; + echo "STDERR CONTENT:" >> ${log} ; + cat stderr.log >> ${log} && + \${REPEX}/stderr_filter.py stderr.log && + cd tarean_output && + zip -r ${ReportArchive}.zip * && + mv ${ReportArchive}.zip ${ReportArchive} && + cp index.html ${ReportFile} && + mkdir ${ReportFile.files_path} && + cp -r --parents libdir ${ReportFile.files_path} && + cp -r --parents seqclust/clustering/superclusters ${ReportFile.files_path} && + cp -r --parents seqclust/clustering/clusters ${ReportFile.files_path} && + cp seqclust/clustering/hitsort.cls ${ReportFile.files_path}/seqclust/clustering/hitsort.cls && + cp *.png ${ReportFile.files_path}/ && + cp *.csv ${ReportFile.files_path}/ && + cp *.html ${ReportFile.files_path}/ && + cp *.css ${ReportFile.files_path}/ && + cp *.fasta ${ReportFile.files_path}/ 2>>$log && rm -r ../tarean_output || : + + + </command> + + <inputs> + <param name="FastaFile" label="Paired-end Illumina reads" type="data" format="fasta" + help="Input file must contain FASTA-formatted interlaced read pairs from paired-end sequencing. All pairs must be complete. Example of the input data format is provided in the help below."/> + + <conditional name="read_sampling"> + <param name="do_sampling" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Read sampling" help="Use this option if you want to analyze only a part of the reads" /> + <when value="false"> + <!-- pass --> + <param name="sample" label="Sample size" hidden="True" type="integer" value="0" help="Number of analyzed reads"/> + </when> + <when value="true"> + <param name="sample" label="Sample size" type="integer" value="500000" min="10000" help="Number of analyzed reads"/> + </when> + </conditional> + + <conditional name="advanced_options"> + <param name="advanced" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Advanced options" /> + <when value="false"> + <!-- pass --> + </when> + <when value="true"> + <param name="merging" type="boolean" truevalue="0.2" falsevalue="0" checked="True" label="Perform cluster merging" help="By default, clusters connected through paired-end reads are merged"/> + <conditional name="custom_library"> + <param name="options_custom_library" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Use custom repeat database"/> + <when value="false"> + <!-- do nothing here --> + </when> + <when value="true"> + <param name="library" format="fasta" type="data" label="Use custom repeat database" help="Perform additional similarity search to user-provided repeat database. The database should contain FASTA-formatted DNA sequences with headers (sequence names) in the format: '>reapeatname#class/subclass'"/> + </when> + </conditional> + <param name="size_threshold" label="Cluster size threshold for detailed analysis" type="float" value="0.01" min="0.0001" max="100" help ="Minimal size (as percentage of input reads) of the smallest cluster which is analyzed; cluster with less than 20 reads are not considered."/> + <param name="automatic_filtering" label="Perform automatic filtering of abundant satellite repeats" type="boolean" truevalue="--automatic_filtering" falsevalue="" checked="false"/> + <param name="keep_names" label="Keep original read names" type="boolean" truevalue="--keep_names" falsevalue="" checked="false" help="By default, reads are renamed using integers. Use this option if you want to keep original names."/> + <conditional name="options"> + <param name="options" type="select" label="Similarity search options"> + <option value="ILLUMINA" selected="true">Default </option> + <option value="ILLUMINA_DUST_OFF" selected="false">Masking of low complexity repeats disabled </option> + + <!-- <option value="ILLUMINA_SENSITIVE_MGBLAST" selected="false">Illumina reads, sensitive search (search parameters: mgblast, min PID 80, -W8) slow, experimental feature!</option> --> + <!-- <option value="ILLUMINA_SENSITIVE_BLASTPLUS" selected="false">Illumina reads, more sensitive search (search parameters: blastn, min PID 80, -W6) extremely slow, experimental feature!</option> --> + <!-- <option value="OXFORD_NANOPORE" selected="false"> --> + <!-- Pseudo short reads simulated from Oxford Nanopore data, experimental feature! --> + <!-- </option> --> + </param> + </conditional> + </when> + </conditional> + + + + </inputs> + <outputs> + <data name="log" format="txt" label="TAREAN log file"/> + <data name="ReportArchive" format="zip" label="TAREAN Archive with HTML report from data ${FastaFile.hid}"/> + <data name="ReportFile" format="html" label="TAREAN HTML report from data ${FastaFile.hid}"/> + </outputs> + + <help> + **HELP** + + TAREAN - TAndem REpeat ANalyzer is a computational pipeline for + **unsupervised identification of satellite repeats** from unassembled + sequence reads. The pipeline uses low-pass paired-end whole genome + sequence reads and performs graph-based clustering. The resulting + clusters, representing all types of repeats present in the genome, are + then examined to identify those containing circular structures indicative + of tandem repeats. A poster summarizing TAREAN principles and + implementation can be found `here.`__ + + + .. __: http://w3lamc.umbr.cas.cz/lamc/?page_id=312 + + **Input data** + + + The analysis requires **paired-end reads** generated by whole genome + shotgun sequencing. The data should be provided as a single input file in + fasta format with the reads interlaced (see example below). All the pairs + must be complete, i.e. both "forward" and "reverse" sequence reads must be + present. The reads should all be trimmed to the same length. The optimal + size range is between 100 and 200 nucleotides. The number of reads to be + analyzed should not exceed 1x coverage of the genome. Genome coverage + between 0.01 and 0.5x is recommended. The reads should be filtered for + quality. The recommended quality filtering is as follows: each read should + have a quality score >=10 for 95% of the bases, i.e. if your reads are 100 + base pairs long, then a read only passes this quality threshold if 95 + bases have a quality of 10 or higher. Additionally, any reads containing + indeterminate base pairs (indicated as N in the reads) should be removed. + Finally, if either one of the reads in a pair fails to meet the + aforementioned thresholds, **both** sequences should be removed. + example of interlaced input format:: + + >0001_f + CGTAATATACATACTTGCTAGCTAGTTGGATGCATCCAACTTGCAAGCTAGTTTGATG + >0001_r + GATTTGACGGACACACTAACTAGCTAGTTGCATCTAAGCGGGCACACTAACTAACTAT + >0002_f + ACTCATTTGGACTTAACTTTGATAATAAAAACTTAAAAAGGTTTCTGCACATGAATCG + >0002_r + TATGTTGAAAAATTGAATTTCGGGACGAAACAGCGTCTATCGTCACGACATAGTGCTC + >0003_f + TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT + >0003_r + TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT + ... + + + To perform the quality filtering on your fastQ formatted data as described + above, and to interlace your paired-end sequence reads, + please use the `Preprocessing of paired-reads`__ tool. + + .. __: tool_runner?tool_id=paired_fastq_filtering + + + **Additional parameters** + + **Sample size** defines how many reads will be used during the computation. + The default setting of 500,000 reads will enable detection of high copy + number satellites within several hours. For higher + sensitivity the sample size can be increased. Since the sample size affects + memory usage, this parameter may be automatically adjusted to a lower value + during the run. The maximum sample size which can be processed depends on the + repetitiveness of the analyzed genome. This significantly limits the number of reads + that can be analyzed with the TAREAN pipeline. + + **Perform cluster merging**. Families of repetitive elements are + frequently split into multiple clusters rather than being represented as a + single one. If you do not want to merge clusters based on the presence + of broken read pairs, disable this option. + + **Use custom repeat database**. This option allows users to perform similarity + comparison of identified repeats to their custom databases. The repeat class should + be encoded in FASTA headers of database entries in order to allow correct + parsing of similarity hits. + + **Similarity search options** By default sequence reads are compared using + mgblast program. Default threshold is explicitly set to 90% sequence + similarity spanning at least 55% of the read length (in the case of reads + differing in length it applies to the longer one). Additionally, sequence + overlap must be at least 55 nt. If you select option for shorter reads + than 100 nt, minimum overlap 55 nt is not required. + + By default, + mgblast search use DUST program to filter out + low-complexity sequences. If you want + to increase sensitivity of detection of satellites with shorter monomer + use option with '*no masking of low complexity repeats*'. Note that omitting + DUST filtering will significantly increase running times + + **Output** + + A list of clusters identified as putative satellite repeats, their genomic + abundance and various cluster characteristics are provided. Length and + consensus sequences of reconstructed monomers are also shown and + accompanied by a detailed output from kmer-based reconstruction including + sequences and sequence logos of alternative variants of monomer sequences. + + The output includes an **HTML summary** with a table listing all analyzed + clusters. More detailed information about clusters is provided in + additional files and directories. All results are also provided as a + downloadable **zip archive**. Since read clustering results in + thousands of clusters, the search for satellite repeats is limited to + a subset of the largest ones corresponding to the most abundant genomic + repeats. The default setting of the pipeline is to analyze all clusters containing at least + 0.01% of the input reads. Besides the satellite repeats, three other + groups of clusters are reported in the output (1) LTR-retrotransposons, + (2) 45S and 5S rDNA and (3) all remaining clusters passing the size + threshold. As (1) and (2) contain sequences with circular + graphs, their consensus is calculated in the same way as for satellite + repeats. Additionally a **log file** reporting the progress of the + computational pipeline is provided. + + + </help> + +</tool>
--- a/tool_dependencies.xml Fri Jul 24 07:26:07 2020 -0400 +++ b/tool_dependencies.xml Fri Jul 24 07:26:59 2020 -0400 @@ -1,28 +1,9 @@ -<?xml version="1.0"?> +<?xml version="1.0" ?> <tool_dependency> - <package name="repex_tarean_dev" version="2.3.8"> - <install version="1.0"> - <actions> - <action type="download_by_url">https://bitbucket.org/petrnovak/repex_tarean/get/7fa000f91080.zip</action> - <action type="shell_command"> - make - </action> - <action type="move_directory_files"> - <source_directory>$TMP_WORK_DIR/petrnovak-repex_tarean-7fa000f91080</source_directory> - <destination_directory>$INSTALL_DIR</destination_directory> - </action> - - <action type="set_environment"> - <environment_variable action="set_to" name="REPEX">$INSTALL_DIR</environment_variable> - </action> - <action type="set_environment"> - <environment_variable action="set_to" name="REPEX_VERSION">"version: 0.3.8-458(7fa000f) branch: almitey"</environment_variable> - </action> - </actions> - </install> - <readme> - repeatexplorer executables and databases + <package name="repex_tarean" version="2.3.8"> + <repository changeset_revision="0bccba287857" name="package_repex_tarean_2_3_8" owner="petr-novak" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu"/> + <readme> + prepare repex database and scripts </readme> - </package> -</tool_dependency> - + </package> +</tool_dependency> \ No newline at end of file
