Mercurial > repos > public-health-bioinformatics > tbprofiler_json_to_tabular
changeset 0:3e0d5ceeeb0f draft default tip
planemo upload for repository https://github.com/public-health-bioinformatics/galaxy_tools/blob/master/tools/tbprofiler_json_to_tabular commit 24535690aedb81353cf5e036dc4577022d9604ad
| author | public-health-bioinformatics |
|---|---|
| date | Tue, 19 Sep 2023 18:03:41 +0000 |
| parents | |
| children | |
| files | tbprofiler_json_to_tabular.py tbprofiler_json_to_tabular.xml test-data/test-01_analysis_metadata.tsv test-data/test-01_gene_coverage.csv test-data/test-01_missing_positions.tsv test-data/test-01_other_variants.tsv test-data/test-01_qc.tsv test-data/test-01_resistance_variants.tsv test-data/test-01_tbprofiler.json |
| diffstat | 9 files changed, 878 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tbprofiler_json_to_tabular.py Tue Sep 19 18:03:41 2023 +0000 @@ -0,0 +1,137 @@ +#!/usr/bin/env python + +import argparse +import csv +import json + + +def main(args): + + with open(args.input, 'r') as f: + report = json.load(f) + + qc_fieldnames = [ + 'pct_reads_mapped', + 'num_reads_mapped', + 'median_coverage', + ] + + with open(args.qc, 'w') as f: + writer = csv.DictWriter(f, fieldnames=qc_fieldnames, dialect='excel-tab', quoting=csv.QUOTE_MINIMAL) + writer.writeheader() + output = {k: report['qc'][k] for k in qc_fieldnames} + writer.writerow(output) + + gene_coverage_fieldnames = [ + 'locus_tag', + 'gene', + 'fraction', + 'cutoff', + ] + + with open(args.gene_coverage, 'w') as f: + writer = csv.DictWriter(f, fieldnames=gene_coverage_fieldnames, dialect='excel-tab', quoting=csv.QUOTE_MINIMAL) + writer.writeheader() + for row in report['qc']['gene_coverage']: + writer.writerow(row) + + missing_positions_fieldnames = [ + 'locus_tag', + 'gene', + 'position', + 'variants', + 'drugs' + ] + + with open(args.missing_positions, 'w') as f: + writer = csv.DictWriter(f, fieldnames=missing_positions_fieldnames, dialect='excel-tab', quoting=csv.QUOTE_MINIMAL) + writer.writeheader() + for row in report['qc']['missing_positions']: + writer.writerow(row) + + resistance_variants_fieldnames = [ + 'chrom', + 'genome_pos', + 'locus_tag', + 'feature_id', + 'gene', + 'type', + 'ref', + 'alt', + 'freq', + 'nucleotide_change', + 'protein_change', + 'change', + 'drugs', + ] + + with open(args.resistance_variants, 'w') as f: + writer = csv.DictWriter(f, fieldnames=resistance_variants_fieldnames, dialect='excel-tab', quoting=csv.QUOTE_MINIMAL) + writer.writeheader() + for row in report['dr_variants']: + row['drugs'] = ', '.join([drug['drug'] + ':' + drug['confers'] for drug in row['drugs']]) + output = {k: row[k] for k in resistance_variants_fieldnames} + writer.writerow(output) + + other_variants_fieldnames = [ + 'chrom', + 'genome_pos', + 'locus_tag', + 'feature_id', + 'gene', + 'type', + 'ref', + 'alt', + 'freq', + 'nucleotide_change', + 'protein_change', + 'change', + 'gene_associated_drugs', + ] + + with open(args.other_variants, 'w') as f: + writer = csv.DictWriter(f, fieldnames=other_variants_fieldnames, dialect='excel-tab', quoting=csv.QUOTE_MINIMAL) + writer.writeheader() + for row in report['other_variants']: + row['gene_associated_drugs'] = ', '.join(row['gene_associated_drugs']) + output = {k: row[k] for k in other_variants_fieldnames} + writer.writerow(output) + + analysis_metadata_fieldnames = [ + 'timestamp', + 'tbprofiler_version', + 'mapping_program', + 'variant_calling_program', + 'db_name', + 'db_commit', + 'db_date', + ] + + with open(args.analysis_metadata, 'w') as f: + writer = csv.DictWriter(f, fieldnames=analysis_metadata_fieldnames, dialect='excel-tab', quoting=csv.QUOTE_MINIMAL) + writer.writeheader() + output = {} + output['timestamp'] = report['timestamp'] + output['tbprofiler_version'] = report['tbprofiler_version'] + output['db_name'] = report['db_version']['name'] + output['db_commit'] = report['db_version']['commit'] + output['db_date'] = report['db_version']['Date'] + for pipeline_entry in report['pipeline']: + if pipeline_entry['Analysis'] == "Mapping": + output['mapping_program'] = pipeline_entry['Program'] + elif pipeline_entry['Analysis'] == "Variant calling": + output['variant_calling_program'] = pipeline_entry['Program'] + + writer.writerow(output) + +if __name__ == '__main__': + parser = argparse.ArgumentParser() + parser.add_argument('input') + parser.add_argument('--qc') + parser.add_argument('--gene-coverage') + parser.add_argument('--missing-positions') + parser.add_argument('--resistance-variants') + parser.add_argument('--other-variants') + parser.add_argument('--analysis-metadata') + args = parser.parse_args() + main(args)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tbprofiler_json_to_tabular.xml Tue Sep 19 18:03:41 2023 +0000 @@ -0,0 +1,41 @@ +<tool id="tbprofiler_json_to_tabular" name="Convert tbprofiler json report to tabular" version="0.1.0+galaxy2"> + <description>Convert tbprofiler json report to tabular</description> + <requirements> + </requirements> + <command detect_errors="exit_code"><![CDATA[ + '$__tool_directory__/tbprofiler_json_to_tabular.py' + ${report} + --qc ${qc} + --gene-coverage ${gene_coverage} + --missing-positions ${missing_positions} + --resistance-variants ${resistance_variants} + --other-variants ${other_variants} + --analysis-metadata ${analysis_metadata} + ]]></command> + <inputs> + <param name="report" type="data" format="json" /> + </inputs> + <outputs> + <data name="qc" label="QC" format="tabular"/> + <data name="gene_coverage" label="Gene Coverage" format="tabular"/> + <data name="missing_positions" label="Missing positions" format="tabular"/> + <data name="resistance_variants" label="Resistance variants" format="tabular"/> + <data name="other_variants" label="Other variants" format="tabular"/> + <data name="analysis_metadata" label="Analysis metadata" format="tabular"/> + </outputs> + <tests> + <test> + <param name="report" value="test-01_tbprofiler.json" /> + <output name="qc" file="test-01_qc.tsv" ftype="tabular" /> + <output name="gene_coverage" file="test-01_gene_coverage.tsv" ftype="tabular" /> + <output name="missing_positions" file="test-01_missing_positions.tsv" ftype="tabular" /> + <output name="resistance_variants" file="test-01_resistance_variants.tsv" ftype="tabular" /> + <output name="other_variants" file="test-01_other_variants.tsv" ftype="tabular" /> + <output name="analysis_metadata" file="test-01_analysis_metadata.tsv" ftype="tabular" /> + </test> + </tests> + <help><![CDATA[ + ]]></help> + <citations> + </citations> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test-01_analysis_metadata.tsv Tue Sep 19 18:03:41 2023 +0000 @@ -0,0 +1,2 @@ +timestamp tbprofiler_version mapping_program variant_calling_program db_name db_commit db_date +22-10-2022 01:09:50 4.1.1 bwa freebayes tbdb 7fc199d Tue Jan 25 17:21:48 2022 +0000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test-01_gene_coverage.csv Tue Sep 19 18:03:41 2023 +0000 @@ -0,0 +1,43 @@ +locus_tag gene fraction cutoff +Rv0005 gyrB 0.0 0 +Rv0006 gyrA 0.0 0 +Rv0407 fgd1 0.0 0 +Rv0486 mshA 0.0 0 +Rv0667 rpoB 0.0 0 +Rv0668 rpoC 0.0 0 +Rv0678 mmpR5 0.0 0 +Rv0682 rpsL 0.0 0 +Rv0701 rplC 0.0 0 +Rv1173 fbiC 0.0 0 +Rv1267c embR 0.0 0 +Rv1305 atpE 0.0 0 +EBG00000313325 rrs 0.0 0 +EBG00000313339 rrl 0.0 0 +Rv1483 fabG1 0.0 0 +Rv1484 inhA 0.0 0 +Rv1630 rpsA 0.0 0 +Rv1694 tlyA 0.0 0 +Rv1908c katG 0.0 0 +Rv2043c pncA 0.0 0 +Rv2245 kasA 0.0 0 +Rv2416c eis 0.0 0 +Rv2428 ahpC 0.0 0 +Rv2447c folC 0.0 0 +Rv2535c pepQ 0.0 0 +Rv2671 ribD 0.0 0 +Rv2754c thyX 0.0 0 +Rv2764c thyA 0.0 0 +Rv2780 ald 0.0 0 +Rv2983 fbiD 0.0 0 +Rv3261 fbiA 0.0 0 +Rv3262 fbiB 0.0 0 +Rv3423c alr 0.0 0 +Rv3547 ddn 0.0 0 +Rv3601c panD 0.0 0 +Rv3793 embC 0.0 0 +Rv3794 embA 0.0 0 +Rv3795 embB 0.0 0 +Rv3806c ubiA 0.0 0 +Rv3854c ethA 0.0 0 +Rv3855 ethR 0.0 0 +Rv3919c gid 0.0 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test-01_missing_positions.tsv Tue Sep 19 18:03:41 2023 +0000 @@ -0,0 +1,1 @@ +locus_tag gene position variants drugs
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test-01_other_variants.tsv Tue Sep 19 18:03:41 2023 +0000 @@ -0,0 +1,14 @@ +chrom genome_pos locus_tag feature_id gene type ref alt freq nucleotide_change protein_change change gene_associated_drugs +Chromosome 7362 Rv0006 CCP42728 gyrA missense_variant G C 1.0 c.61G>C p.Glu21Gln p.Glu21Gln levofloxacin, ciprofloxacin, ofloxacin, moxifloxacin, fluoroquinolones +Chromosome 7585 Rv0006 CCP42728 gyrA missense_variant G C 1.0 c.284G>C p.Ser95Thr p.Ser95Thr levofloxacin, ciprofloxacin, ofloxacin, moxifloxacin, fluoroquinolones +Chromosome 7892 Rv0006 CCP42728 gyrA synonymous_variant G A 1.0 c.591G>A p.Leu197Leu c.591G>A levofloxacin, ciprofloxacin, ofloxacin, moxifloxacin, fluoroquinolones +Chromosome 9304 Rv0006 CCP42728 gyrA missense_variant G A 1.0 c.2003G>A p.Gly668Asp p.Gly668Asp levofloxacin, ciprofloxacin, ofloxacin, moxifloxacin, fluoroquinolones +Chromosome 766789 Rv0668 CCP43411 rpoC synonymous_variant G A 1.0 c.3420G>A p.Glu1140Glu c.3420G>A rifampicin +Chromosome 781395 Rv0682 CCP43425 rpsL upstream_gene_variant T C 1.0 c.-165T>C c.-165T>C streptomycin +Chromosome 1305494 Rv1173 CCP43929 fbiC frameshift_variant&stop_lost&splice_region_variant CGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT C 0.21739130434782608 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT p.Ala855fs c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT delamanid +Chromosome 1460976 Rv1305 CCP44062 atpE upstream_gene_variant C T 1.0 c.-69C>T c.-69C>T bedaquiline +Chromosome 1471659 EBG00000313325 EBG00000313325-1 rrs upstream_gene_variant C T 1.0 n.-187C>T n.-187C>T aminoglycosides, streptomycin, amikacin, capreomycin, kanamycin +Chromosome 1917972 Rv1694 CCP44459 tlyA synonymous_variant A G 1.0 c.33A>G p.Leu11Leu c.33A>G capreomycin +Chromosome 3073868 Rv2764c CCP45563 thyA missense_variant T C 1.0 c.604A>G p.Thr202Ala p.Thr202Ala para-aminosalicylic_acid +Chromosome 4242643 Rv3794 CCP46623 embA upstream_gene_variant C T 1.0 c.-590C>T c.-590C>T ethambutol +Chromosome 1305494 Rv1173 CCP43929 fbiC frameshift_variant&stop_lost&splice_region_variant C <DEL> 1.0 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN p.Ala855fs c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN delamanid
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test-01_qc.tsv Tue Sep 19 18:03:41 2023 +0000 @@ -0,0 +1,2 @@ +pct_reads_mapped num_reads_mapped median_coverage +99.47 1731409 84
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test-01_resistance_variants.tsv Tue Sep 19 18:03:41 2023 +0000 @@ -0,0 +1,3 @@ +chrom genome_pos locus_tag feature_id gene type ref alt freq nucleotide_change protein_change change drugs +Chromosome 761155 Rv0667 CCP43410 rpoB missense_variant C T 1.0 c.1349C>T p.Ser450Leu p.Ser450Leu rifampicin:resistance +Chromosome 1674048 Rv1484 CCP44244 inhA upstream_gene_variant G A 1.0 c.-154G>A c.-154G>A isoniazid:resistance, ethionamide:resistance
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test-01_tbprofiler.json Tue Sep 19 18:03:41 2023 +0000 @@ -0,0 +1,635 @@ +{ + "qc": { + "pct_reads_mapped": 99.47, + "num_reads_mapped": 1731409, + "median_coverage": 84, + "gene_coverage": [ + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv0005", + "gene": "gyrB" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv0006", + "gene": "gyrA" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv0407", + "gene": "fgd1" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv0486", + "gene": "mshA" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv0667", + "gene": "rpoB" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv0668", + "gene": "rpoC" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv0678", + "gene": "mmpR5" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv0682", + "gene": "rpsL" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv0701", + "gene": "rplC" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv1173", + "gene": "fbiC" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv1267c", + "gene": "embR" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv1305", + "gene": "atpE" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "EBG00000313325", + "gene": "rrs" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "EBG00000313339", + "gene": "rrl" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv1483", + "gene": "fabG1" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv1484", + "gene": "inhA" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv1630", + "gene": "rpsA" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv1694", + "gene": "tlyA" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv1908c", + "gene": "katG" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv2043c", + "gene": "pncA" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv2245", + "gene": "kasA" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv2416c", + "gene": "eis" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv2428", + "gene": "ahpC" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv2447c", + "gene": "folC" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv2535c", + "gene": "pepQ" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv2671", + "gene": "ribD" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv2754c", + "gene": "thyX" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv2764c", + "gene": "thyA" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv2780", + "gene": "ald" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv2983", + "gene": "fbiD" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv3261", + "gene": "fbiA" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv3262", + "gene": "fbiB" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv3423c", + "gene": "alr" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv3547", + "gene": "ddn" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv3601c", + "gene": "panD" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv3793", + "gene": "embC" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv3794", + "gene": "embA" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv3795", + "gene": "embB" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv3806c", + "gene": "ubiA" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv3854c", + "gene": "ethA" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv3855", + "gene": "ethR" + }, + { + "fraction": 0.0, + "cutoff": 0, + "locus_tag": "Rv3919c", + "gene": "gid" + } + ], + "missing_positions": [] + }, + "delly": "success", + "lineage": [ + { + "lin": "lineage4", + "family": "Euro-American", + "spoligotype": "LAM;T;S;X;H", + "rd": "None", + "frac": 1.0 + }, + { + "lin": "lineage4.5", + "family": "Euro-American", + "spoligotype": "H;T", + "rd": "RD122", + "frac": 1.0 + } + ], + "main_lin": "lineage4", + "sublin": "lineage4.5", + "dr_variants": [ + { + "chrom": "Chromosome", + "genome_pos": 761155, + "ref": "C", + "alt": "T", + "freq": 1.0, + "feature_id": "CCP43410", + "type": "missense_variant", + "nucleotide_change": "c.1349C>T", + "protein_change": "p.Ser450Leu", + "annotation": [ + { + "type": "resistance_association_confidence", + "drug": "rifampicin", + "confidence": "high" + } + ], + "alternate_consequences": [], + "change": "p.Ser450Leu", + "locus_tag": "Rv0667", + "gene": "rpoB", + "drugs": [ + { + "type": "drug", + "drug": "rifampicin", + "confers": "resistance", + "literature": "10.1128/AAC.01093-18" + } + ] + }, + { + "chrom": "Chromosome", + "genome_pos": 1674048, + "ref": "G", + "alt": "A", + "freq": 1.0, + "feature_id": "CCP44244", + "type": "upstream_gene_variant", + "nucleotide_change": "c.-154G>A", + "protein_change": "", + "annotation": [], + "alternate_consequences": [], + "change": "c.-154G>A", + "locus_tag": "Rv1484", + "gene": "inhA", + "drugs": [ + { + "type": "drug", + "drug": "isoniazid", + "confers": "resistance", + "literature": "https://www.who.int/publications/i/item/9789240028173" + }, + { + "type": "drug", + "drug": "ethionamide", + "confers": "resistance", + "literature": "https://www.who.int/publications/i/item/9789240028173" + } + ] + } + ], + "other_variants": [ + { + "chrom": "Chromosome", + "genome_pos": 7362, + "ref": "G", + "alt": "C", + "freq": 1.0, + "feature_id": "CCP42728", + "type": "missense_variant", + "nucleotide_change": "c.61G>C", + "protein_change": "p.Glu21Gln", + "alternate_consequences": [], + "change": "p.Glu21Gln", + "locus_tag": "Rv0006", + "gene": "gyrA", + "gene_associated_drugs": [ + "levofloxacin", + "ciprofloxacin", + "ofloxacin", + "moxifloxacin", + "fluoroquinolones" + ] + }, + { + "chrom": "Chromosome", + "genome_pos": 7585, + "ref": "G", + "alt": "C", + "freq": 1.0, + "feature_id": "CCP42728", + "type": "missense_variant", + "nucleotide_change": "c.284G>C", + "protein_change": "p.Ser95Thr", + "annotation": [ + { + "type": "phylogenetic_mutation", + "lineage": "lineage4" + } + ], + "alternate_consequences": [], + "change": "p.Ser95Thr", + "locus_tag": "Rv0006", + "gene": "gyrA", + "gene_associated_drugs": [ + "levofloxacin", + "ciprofloxacin", + "ofloxacin", + "moxifloxacin", + "fluoroquinolones" + ] + }, + { + "chrom": "Chromosome", + "genome_pos": 7892, + "ref": "G", + "alt": "A", + "freq": 1.0, + "feature_id": "CCP42728", + "type": "synonymous_variant", + "nucleotide_change": "c.591G>A", + "protein_change": "p.Leu197Leu", + "alternate_consequences": [], + "change": "c.591G>A", + "locus_tag": "Rv0006", + "gene": "gyrA", + "gene_associated_drugs": [ + "levofloxacin", + "ciprofloxacin", + "ofloxacin", + "moxifloxacin", + "fluoroquinolones" + ] + }, + { + "chrom": "Chromosome", + "genome_pos": 9304, + "ref": "G", + "alt": "A", + "freq": 1.0, + "feature_id": "CCP42728", + "type": "missense_variant", + "nucleotide_change": "c.2003G>A", + "protein_change": "p.Gly668Asp", + "alternate_consequences": [], + "change": "p.Gly668Asp", + "locus_tag": "Rv0006", + "gene": "gyrA", + "gene_associated_drugs": [ + "levofloxacin", + "ciprofloxacin", + "ofloxacin", + "moxifloxacin", + "fluoroquinolones" + ] + }, + { + "chrom": "Chromosome", + "genome_pos": 766789, + "ref": "G", + "alt": "A", + "freq": 1.0, + "feature_id": "CCP43411", + "type": "synonymous_variant", + "nucleotide_change": "c.3420G>A", + "protein_change": "p.Glu1140Glu", + "alternate_consequences": [], + "change": "c.3420G>A", + "locus_tag": "Rv0668", + "gene": "rpoC", + "gene_associated_drugs": [ + "rifampicin" + ] + }, + { + "chrom": "Chromosome", + "genome_pos": 781395, + "ref": "T", + "alt": "C", + "freq": 1.0, + "feature_id": "CCP43425", + "type": "upstream_gene_variant", + "nucleotide_change": "c.-165T>C", + "protein_change": "", + "alternate_consequences": [], + "change": "c.-165T>C", + "locus_tag": "Rv0682", + "gene": "rpsL", + "gene_associated_drugs": [ + "streptomycin" + ] + }, + { + "chrom": "Chromosome", + "genome_pos": 1305494, + "ref": "CGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT", + "alt": "C", + "freq": 0.21739130434782608, + "feature_id": "CCP43929", + "type": "frameshift_variant&stop_lost&splice_region_variant", + "nucleotide_change": "c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT", + "protein_change": "p.Ala855fs", + "alternate_consequences": [], + "change": "c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT", + "locus_tag": "Rv1173", + "gene": "fbiC", + "gene_associated_drugs": [ + "delamanid" + ] + }, + { + "chrom": "Chromosome", + "genome_pos": 1460976, + "ref": "C", + "alt": "T", + "freq": 1.0, + "feature_id": "CCP44062", + "type": "upstream_gene_variant", + "nucleotide_change": "c.-69C>T", + "protein_change": "", + "alternate_consequences": [], + "change": "c.-69C>T", + "locus_tag": "Rv1305", + "gene": "atpE", + "gene_associated_drugs": [ + "bedaquiline" + ] + }, + { + "chrom": "Chromosome", + "genome_pos": 1471659, + "ref": "C", + "alt": "T", + "freq": 1.0, + "feature_id": "EBG00000313325-1", + "type": "upstream_gene_variant", + "nucleotide_change": "n.-187C>T", + "protein_change": "", + "alternate_consequences": [], + "change": "n.-187C>T", + "locus_tag": "EBG00000313325", + "gene": "rrs", + "gene_associated_drugs": [ + "aminoglycosides", + "streptomycin", + "amikacin", + "capreomycin", + "kanamycin" + ] + }, + { + "chrom": "Chromosome", + "genome_pos": 1917972, + "ref": "A", + "alt": "G", + "freq": 1.0, + "feature_id": "CCP44459", + "type": "synonymous_variant", + "nucleotide_change": "c.33A>G", + "protein_change": "p.Leu11Leu", + "alternate_consequences": [], + "change": "c.33A>G", + "locus_tag": "Rv1694", + "gene": "tlyA", + "gene_associated_drugs": [ + "capreomycin" + ] + }, + { + "chrom": "Chromosome", + "genome_pos": 3073868, + "ref": "T", + "alt": "C", + "freq": 1.0, + "feature_id": "CCP45563", + "type": "missense_variant", + "nucleotide_change": "c.604A>G", + "protein_change": "p.Thr202Ala", + "alternate_consequences": [], + "change": "p.Thr202Ala", + "locus_tag": "Rv2764c", + "gene": "thyA", + "gene_associated_drugs": [ + "para-aminosalicylic_acid" + ] + }, + { + "chrom": "Chromosome", + "genome_pos": 4242643, + "ref": "C", + "alt": "T", + "freq": 1.0, + "feature_id": "CCP46623", + "type": "upstream_gene_variant", + "nucleotide_change": "c.-590C>T", + "protein_change": "", + "alternate_consequences": [ + { + "gene_name": "embC", + "gene_id": "Rv3793", + "feature_id": "CCP46622", + "type": "synonymous_variant", + "nucleotide_change": "c.2781C>T", + "protein_change": "p.Arg927Arg" + } + ], + "change": "c.-590C>T", + "locus_tag": "Rv3794", + "gene": "embA", + "gene_associated_drugs": [ + "ethambutol" + ] + }, + { + "chrom": "Chromosome", + "genome_pos": 1305494, + "ref": "C", + "alt": "<DEL>", + "freq": 1.0, + "feature_id": "CCP43929", + "type": "frameshift_variant&stop_lost&splice_region_variant", + "nucleotide_change": "c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN", + "protein_change": "p.Ala855fs", + "alternate_consequences": [], + "change": "c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN", + "locus_tag": "Rv1173", + "gene": "fbiC", + "gene_associated_drugs": [ + "delamanid" + ] + } + ], + "drtype": "MDR-TB", + "db_version": { + "name": "tbdb", + "commit": "7fc199d", + "Merge": "bad550a 277d053", + "Author": "Jody Phelan <jody.phelan@lshtm.ac.uk>", + "Date": "Tue Jan 25 17:21:48 2022 +0000" + }, + "id": "tbprofiler", + "tbprofiler_version": "4.1.1", + "pipeline": [ + { + "Analysis": "Mapping", + "Program": "bwa" + }, + { + "Analysis": "Variant calling", + "Program": "freebayes" + } + ], + "timestamp": "22-10-2022 01:09:50" +}