Mercurial > repos > rnateam > graphclust_postprocessing

comparison test-data/1.cluster.top5.alirna.ps @ 17:f93c868203cc draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/GraphClust/CollectResults commit 4406735e44aba20859c252be39f4e99df28c7a92
author rnateam
date Sat, 27 Oct 2018 13:23:06 -0400
parents
children
comparison
equal deleted inserted replaced
16:79df97a1bc0f 17:f93c868203cc
1 %!PS-Adobe-3.0 EPSF-3.0
2 %%Creator: ViennaRNA-2.3.1
3 %%CreationDate: Tue May 30 20:24:19 2017
4 %%Title: RNA Secondary Structure Plot
5 %%BoundingBox: 0 0 700 700
6 %%DocumentFonts: Helvetica
7 %%Pages: 1
8 %%EndComments
9
10 %Options: --noLP
11 % to switch off outline pairs of sequence comment or
12 % delete the appropriate line near the end of the file
13
14 %%BeginProlog
15 /RNAplot 100 dict def
16 RNAplot begin
17 /fsize 14 def
18 /outlinecolor {0.2 setgray} bind def
19 /paircolor {0.2 setgray} bind def
20 /seqcolor {0 setgray} bind def
21 /cshow { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def
22 /min { 2 copy gt { exch } if pop } bind def
23 /max { 2 copy lt { exch } if pop } bind def
24 /arccoords { % i j arccoords
25 % puts optimal x1 y1 x2 y2 coordinates used in bezier curves from i to j
26 % onto the stack
27 dup 3 -1 roll dup 4 -1 roll lt dup dup 5 2 roll {exch} if
28 dup 3 -1 roll dup 3 -1 roll exch sub 1 sub dup
29 4 -2 roll 5 -1 roll {exch} if 4 2 roll
30 sequence length dup 2 div exch 3 1 roll lt
31 {exch 5 -1 roll pop 4 -2 roll exch 4 2 roll}
32 { 4 2 roll 5 -1 roll dup 6 1 roll {exch} if
33 4 -2 roll exch pop dup 3 -1 roll dup 4 1 roll
34 exch add 4 -1 roll dup 5 1 roll sub 1 sub
35 5 -1 roll not {4 -2 roll exch 4 2 roll} if
36 }ifelse
37 % compute the scalingfactor and prepare (1-sf) and sf*r
38 2 mul exch cpr 3 1 roll div dup
39 3 -1 roll mul exch 1 exch sub exch
40 % compute the coordinates
41 3 -1 roll 1 sub coor exch get aload pop % get coord for i
42 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate y1
43 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate x1
44 5 -1 roll 1 sub coor exch get aload pop % get coord for j
45 % duplicate j coord
46 dup 3 -1 roll dup 4 1 roll exch 8 2 roll
47 6 -1 roll dup 7 1 roll mul 5 -1 roll dup 6 1 roll add exch % calculate y2
48 6 -1 roll mul 5 -1 roll add exch % calculate x2
49 6 -2 roll % reorder
50 } bind def
51 /drawoutline {
52 gsave outlinecolor newpath
53 coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence
54 currentdict /cutpoint known % check if cutpoint is defined
55 {coor 0 cutpoint getinterval
56 {aload pop lineto} forall % draw outline of 1st sequence
57 coor cutpoint 1 add get aload pop
58 2 copy moveto 0.8 0 360 arc % draw 5' circle of 2nd sequence
59 coor cutpoint 1 add coor length cutpoint 1 add sub getinterval
60 {aload pop lineto} forall} % draw outline of 2nd sequence
61 {coor {aload pop lineto} forall} % draw outline as a whole
62 ifelse
63 stroke grestore
64 } bind def
65 /drawpairs {
66 paircolor
67 0.7 setlinewidth
68 [9 3.01] 9 setdash
69 newpath
70 pairs {aload pop
71 currentdict (cpr) known
72 { exch dup
73 coor exch 1 sub get aload pop moveto
74 exch arccoords curveto
75 }
76 { coor exch 1 sub get aload pop moveto
77 coor exch 1 sub get aload pop lineto
78 }ifelse
79 } forall
80 stroke
81 } bind def
82 % draw bases
83 /drawbases {
84 [] 0 setdash
85 seqcolor
86 0
87 coor {
88 aload pop moveto
89 dup sequence exch 1 getinterval cshow
90 1 add
91 } forall
92 pop
93 } bind def
94
95 /init {
96 /Helvetica findfont fsize scalefont setfont
97 1 setlinejoin
98 1 setlinecap
99 0.8 setlinewidth
100 % find the coordinate range
101 /xmax -1000 def /xmin 10000 def
102 /ymax -1000 def /ymin 10000 def
103 coor {
104 aload pop
105 dup ymin lt {dup /ymin exch def} if
106 dup ymax gt {/ymax exch def} {pop} ifelse
107 dup xmin lt {dup /xmin exch def} if
108 dup xmax gt {/xmax exch def} {pop} ifelse
109 } forall
110 /size {xmax xmin sub ymax ymin sub max} bind def
111 /width {xmax xmin sub} bind def
112 /height {ymax ymin sub} bind def
113 10 10 translate
114 680 size 10 add div dup scale
115 size width sub width xmin sub xmax sub add 2 div 5 add
116 size height sub height ymin sub ymax sub add 2 div 5 add
117 translate
118 } bind def
119 end
120 RNAplot begin
121 % extra definitions for standard anotations
122 /min { 2 copy gt { exch } if pop } bind def
123 /BLACK { 0 0 0 } def
124 /RED { 1 0 0 } def
125 /GREEN { 0 1 0 } def
126 /BLUE { 0 0 1 } def
127 /WHITE { 1 1 1 } def
128 /LabelFont { % font size LabelFont
129 exch findfont exch fsize mul scalefont setfont
130 } bind def
131 /Label { % i dx dy (text) Label
132 % write text at base i plus offset dx, dy
133 4 3 roll 1 sub coor exch get aload pop moveto
134 3 1 roll fsize mul exch fsize mul exch rmoveto
135 show
136 } bind def
137 /cmark { % i cmark draw circle around base i
138 newpath 1 sub coor exch get aload pop
139 fsize 2 div 0 360 arc stroke
140 } bind def
141 /gmark { % i j c gmark
142 % draw basepair i,j with c counter examples in gray
143 gsave
144 3 min [0 0.33 0.66 0.9] exch get setgray
145 1 sub dup coor exch get aload pop moveto
146 sequence exch 1 getinterval cshow
147 1 sub dup coor exch get aload pop moveto
148 sequence exch 1 getinterval cshow
149 grestore
150 } bind def
151 /segmark { % f i j lw r g b segmark
152 % mark segment [i,j] with outline width lw and color rgb
153 % use omark and Fomark instead
154 gsave
155 setrgbcolor setlinewidth
156 newpath
157 1 sub exch 1 sub dup
158 coor exch get aload pop moveto
159 currentdict (cpr) known
160 {
161 3 -1 roll dup 4 1 roll dup
162 {
163 3 1 roll dup 3 -1 roll dup
164 4 1 roll exch 5 2 roll exch
165 }
166 {
167 3 1 roll exch
168 } ifelse
169 1 exch { coor exch get aload pop lineto } for
170 {
171 dup 3 1 roll 1 add exch 1 add arccoords pop pop
172 4 2 roll 5 -1 roll coor exch get aload pop curveto
173 } if
174 }
175 {
176 exch 1 exch {
177 coor exch get aload pop lineto
178 } for
179 } ifelse
180 { closepath fill } if stroke
181 grestore
182 } bind def
183 /omark { % i j lw r g b omark
184 % stroke segment [i..j] with linewidth lw, color rgb
185 false 7 1 roll segmark
186 } bind def
187 /Fomark { % i j r g b Fomark
188 % fill segment [i..j] with color rgb
189 % should precede drawbases
190 1 4 1 roll true 7 1 roll segmark
191 } bind def
192 /BFmark{ % i j k l r g b BFmark
193 % fill block between pairs (i,j) and (k,l) with color rgb
194 % should precede drawbases
195 gsave
196 setrgbcolor
197 newpath
198 currentdict (cpr) known
199 {
200 dup 1 sub coor exch get aload pop moveto % move to l
201 dup 1 sub 4 -1 roll dup 5 1 roll 1 sub 1 exch
202 { coor exch get aload pop lineto } for % lines from l to j
203 3 -1 roll 4 -1 roll dup 5 1 roll arccoords curveto % curve from j to i
204 exch dup 4 -1 roll 1 sub exch 1 sub 1 exch
205 { coor exch get aload pop lineto } for % lines from i to k
206 exch arccoords curveto% curve from k to l
207 }
208 { exch 4 3 roll exch 1 sub exch 1 sub dup
209 coor exch get aload pop moveto
210 exch 1 exch { coor exch get aload pop lineto } for
211 exch 1 sub exch 1 sub dup
212 coor exch get aload pop lineto
213 exch 1 exch { coor exch get aload pop lineto } for
214 } ifelse
215 closepath fill stroke
216 grestore
217 } bind def
218 /hsb {
219 dup 0.3 mul 1 exch sub sethsbcolor
220 } bind def
221 /colorpair { % i j hue sat colorpair
222 % draw basepair i,j in color
223 % 1 index 0.00 ne {
224 gsave
225 newpath
226 hsb
227 fsize setlinewidth
228 currentdict (cpr) known
229 {
230 exch dup
231 coor exch 1 sub get aload pop moveto
232 exch arccoords curveto
233 }
234 { 1 sub coor exch get aload pop moveto
235 1 sub coor exch get aload pop lineto
236 } ifelse
237 stroke
238 grestore
239 % } if
240 } bind def
241 end
242
243 %%EndProlog
244 RNAplot begin
245 % data start here
246 /sequence (\
247 GUUUCCGUAGUGUAGUGGUUAUCACGUUCGCCUCACACGCGAAAGGU_________CCCCGGUUCGAAACCGGGCGGAAACA\
248 ) def
249 /coor [
250 [126.01442719 205.80749512]
251 [125.44680786 190.81823730]
252 [124.87918091 175.82897949]
253 [124.31156158 160.83972168]
254 [123.74394226 145.85047913]
255 [123.17631531 130.86122131]
256 [122.60869598 115.87195587]
257 [107.91925812 124.77088928]
258 [91.87033844 122.99333954]
259 [80.97422791 112.51052094]
260 [66.42591858 116.16383362]
261 [51.87760544 119.81713867]
262 [47.74618530 134.60993958]
263 [36.76065063 145.34370422]
264 [21.87605476 149.13108826]
265 [7.09627628 144.95332336]
266 [-3.60299659 133.93420410]
267 [-7.34371328 119.03780365]
268 [-3.11964059 104.27119446]
269 [7.93296814 93.60651398]
270 [22.84101677 89.91250610]
271 [37.59431458 94.18284607]
272 [48.22429657 105.26882935]
273 [62.77260971 101.61552429]
274 [77.32091522 97.96221161]
275 [93.74244690 75.59227753]
276 [122.92980194 84.59557343]
277 [115.84320831 71.37512970]
278 [108.75661469 58.15468216]
279 [101.67002106 44.93423462]
280 [94.58342743 31.71378899]
281 [79.24071503 28.69135094]
282 [69.47061157 16.48155785]
283 [69.88626099 0.84949923]
284 [80.29140472 -10.82384396]
285 [95.77305603 -13.02667522]
286 [109.02124786 -4.71888638]
287 [113.78059387 10.17683983]
288 [107.80387115 24.62719536]
289 [114.89046478 37.84764099]
290 [121.97705841 51.06808853]
291 [129.06365967 64.28853607]
292 [136.15025330 77.50897980]
293 [130.14912415 63.76174545]
294 [129.68310547 48.76898575]
295 [134.81886292 34.67558289]
296 [144.82167053 23.49776077]
297 [158.26051331 16.83462524]
298 [173.21282959 15.63941574]
299 [187.53950500 20.08312035]
300 [199.19094849 29.53001785]
301 [206.50028992 42.62862396]
302 [208.42185974 57.50503159]
303 [204.68074036 72.03101349]
304 [195.81214905 84.12845612]
305 [183.08483887 92.06668854]
306 [168.31959534 94.71005249]
307 [153.62709045 91.67971802]
308 [168.02673340 95.88093567]
309 [182.42637634 100.08216095]
310 [196.82603455 104.28337860]
311 [211.22567749 108.48459625]
312 [224.12878418 99.65035248]
313 [239.68653870 101.22833252]
314 [250.55305481 112.47345734]
315 [251.59750366 128.07612610]
316 [242.32670593 140.66921997]
317 [227.11805725 144.30670166]
318 [213.15261841 137.27102661]
319 [207.02444458 122.88423920]
320 [192.62480164 118.68302155]
321 [178.22515869 114.48180389]
322 [163.82551575 110.28057861]
323 [149.42587280 106.07936096]
324 [137.59794617 115.30433655]
325 [138.16557312 130.29359436]
326 [138.73320007 145.28285217]
327 [139.30081177 160.27210999]
328 [139.86843872 175.26136780]
329 [140.43606567 190.25062561]
330 [141.00367737 205.23986816]
331 [143.92169189 224.40065002]
332 ] def
333 /pairs [
334 [1 81]
335 [2 80]
336 [3 79]
337 [4 78]
338 [5 77]
339 [6 76]
340 [7 75]
341 [10 25]
342 [11 24]
343 [12 23]
344 [27 43]
345 [28 42]
346 [29 41]
347 [30 40]
348 [31 39]
349 [58 74]
350 [59 73]
351 [60 72]
352 [61 71]
353 [62 70]
354 ] def
355
356 init
357
358 % Start Annotations
359 1 81 0.0 1 colorpair
360 2 80 0.16 1 colorpair
361 3 79 0.16 1 colorpair
362 4 78 0.16 1 colorpair
363 5 77 0.16 1 colorpair
364 6 76 0.32 1 colorpair
365 7 75 0.16 1 colorpair
366 10 25 0.0 1 colorpair
367 11 24 0.16 1 colorpair
368 12 23 0.16 1 colorpair
369 27 43 0.16 1 colorpair
370 28 42 0.0 1 colorpair
371 29 41 0.16 1 colorpair
372 30 40 0.0 1 colorpair
373 31 39 0.16 1 colorpair
374 58 74 0.16 1 colorpair
375 59 73 0.0 1 colorpair
376 60 72 0.16 1 colorpair
377 61 71 0.0 1 colorpair
378 62 70 0.0 1 colorpair
379
380 % End Annotations
381 % switch off outline pairs or bases by removing these lines
382 drawoutline
383 drawpairs
384 drawbases
385 % Start Annotations
386 2 cmark
387 80 cmark
388 3 cmark
389 79 cmark
390 4 cmark
391 78 cmark
392 5 cmark
393 77 cmark
394 6 cmark
395 76 cmark
396 7 cmark
397 75 cmark
398 11 cmark
399 24 cmark
400 12 cmark
401 23 cmark
402 27 cmark
403 43 cmark
404 29 cmark
405 41 cmark
406 31 cmark
407 39 cmark
408 58 cmark
409 74 cmark
410 60 cmark
411 72 cmark
412
413 % End Annotations
414 % show it
415 showpage
416 end
417 %%EOF