Mercurial > repos > rnateam > graphclust_postprocessing
diff test-data/1.cluster.top5.alirna.ps @ 17:f93c868203cc draft default tip
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/GraphClust/CollectResults commit 4406735e44aba20859c252be39f4e99df28c7a92
author | rnateam |
---|---|
date | Sat, 27 Oct 2018 13:23:06 -0400 |
parents | |
children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/1.cluster.top5.alirna.ps Sat Oct 27 13:23:06 2018 -0400 @@ -0,0 +1,417 @@ +%!PS-Adobe-3.0 EPSF-3.0 +%%Creator: ViennaRNA-2.3.1 +%%CreationDate: Tue May 30 20:24:19 2017 +%%Title: RNA Secondary Structure Plot +%%BoundingBox: 0 0 700 700 +%%DocumentFonts: Helvetica +%%Pages: 1 +%%EndComments + +%Options: --noLP +% to switch off outline pairs of sequence comment or +% delete the appropriate line near the end of the file + +%%BeginProlog +/RNAplot 100 dict def +RNAplot begin +/fsize 14 def +/outlinecolor {0.2 setgray} bind def +/paircolor {0.2 setgray} bind def +/seqcolor {0 setgray} bind def +/cshow { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def +/min { 2 copy gt { exch } if pop } bind def +/max { 2 copy lt { exch } if pop } bind def +/arccoords { % i j arccoords + % puts optimal x1 y1 x2 y2 coordinates used in bezier curves from i to j + % onto the stack + dup 3 -1 roll dup 4 -1 roll lt dup dup 5 2 roll {exch} if + dup 3 -1 roll dup 3 -1 roll exch sub 1 sub dup + 4 -2 roll 5 -1 roll {exch} if 4 2 roll + sequence length dup 2 div exch 3 1 roll lt + {exch 5 -1 roll pop 4 -2 roll exch 4 2 roll} + { 4 2 roll 5 -1 roll dup 6 1 roll {exch} if + 4 -2 roll exch pop dup 3 -1 roll dup 4 1 roll + exch add 4 -1 roll dup 5 1 roll sub 1 sub + 5 -1 roll not {4 -2 roll exch 4 2 roll} if + }ifelse + % compute the scalingfactor and prepare (1-sf) and sf*r + 2 mul exch cpr 3 1 roll div dup + 3 -1 roll mul exch 1 exch sub exch + % compute the coordinates + 3 -1 roll 1 sub coor exch get aload pop % get coord for i + 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate y1 + 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate x1 + 5 -1 roll 1 sub coor exch get aload pop % get coord for j + % duplicate j coord + dup 3 -1 roll dup 4 1 roll exch 8 2 roll + 6 -1 roll dup 7 1 roll mul 5 -1 roll dup 6 1 roll add exch % calculate y2 + 6 -1 roll mul 5 -1 roll add exch % calculate x2 + 6 -2 roll % reorder +} bind def +/drawoutline { + gsave outlinecolor newpath + coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence + currentdict /cutpoint known % check if cutpoint is defined + {coor 0 cutpoint getinterval + {aload pop lineto} forall % draw outline of 1st sequence + coor cutpoint 1 add get aload pop + 2 copy moveto 0.8 0 360 arc % draw 5' circle of 2nd sequence + coor cutpoint 1 add coor length cutpoint 1 add sub getinterval + {aload pop lineto} forall} % draw outline of 2nd sequence + {coor {aload pop lineto} forall} % draw outline as a whole + ifelse + stroke grestore +} bind def +/drawpairs { + paircolor + 0.7 setlinewidth + [9 3.01] 9 setdash + newpath + pairs {aload pop + currentdict (cpr) known + { exch dup + coor exch 1 sub get aload pop moveto + exch arccoords curveto + } + { coor exch 1 sub get aload pop moveto + coor exch 1 sub get aload pop lineto + }ifelse + } forall + stroke +} bind def +% draw bases +/drawbases { + [] 0 setdash + seqcolor + 0 + coor { + aload pop moveto + dup sequence exch 1 getinterval cshow + 1 add + } forall + pop +} bind def + +/init { + /Helvetica findfont fsize scalefont setfont + 1 setlinejoin + 1 setlinecap + 0.8 setlinewidth + % find the coordinate range + /xmax -1000 def /xmin 10000 def + /ymax -1000 def /ymin 10000 def + coor { + aload pop + dup ymin lt {dup /ymin exch def} if + dup ymax gt {/ymax exch def} {pop} ifelse + dup xmin lt {dup /xmin exch def} if + dup xmax gt {/xmax exch def} {pop} ifelse + } forall + /size {xmax xmin sub ymax ymin sub max} bind def + /width {xmax xmin sub} bind def + /height {ymax ymin sub} bind def + 10 10 translate + 680 size 10 add div dup scale + size width sub width xmin sub xmax sub add 2 div 5 add + size height sub height ymin sub ymax sub add 2 div 5 add + translate +} bind def +end +RNAplot begin +% extra definitions for standard anotations +/min { 2 copy gt { exch } if pop } bind def +/BLACK { 0 0 0 } def +/RED { 1 0 0 } def +/GREEN { 0 1 0 } def +/BLUE { 0 0 1 } def +/WHITE { 1 1 1 } def +/LabelFont { % font size LabelFont + exch findfont exch fsize mul scalefont setfont +} bind def +/Label { % i dx dy (text) Label + % write text at base i plus offset dx, dy + 4 3 roll 1 sub coor exch get aload pop moveto + 3 1 roll fsize mul exch fsize mul exch rmoveto + show +} bind def +/cmark { % i cmark draw circle around base i + newpath 1 sub coor exch get aload pop + fsize 2 div 0 360 arc stroke +} bind def +/gmark { % i j c gmark + % draw basepair i,j with c counter examples in gray + gsave + 3 min [0 0.33 0.66 0.9] exch get setgray + 1 sub dup coor exch get aload pop moveto + sequence exch 1 getinterval cshow + 1 sub dup coor exch get aload pop moveto + sequence exch 1 getinterval cshow + grestore +} bind def +/segmark { % f i j lw r g b segmark + % mark segment [i,j] with outline width lw and color rgb + % use omark and Fomark instead + gsave + setrgbcolor setlinewidth + newpath + 1 sub exch 1 sub dup + coor exch get aload pop moveto + currentdict (cpr) known + { + 3 -1 roll dup 4 1 roll dup + { + 3 1 roll dup 3 -1 roll dup + 4 1 roll exch 5 2 roll exch + } + { + 3 1 roll exch + } ifelse + 1 exch { coor exch get aload pop lineto } for + { + dup 3 1 roll 1 add exch 1 add arccoords pop pop + 4 2 roll 5 -1 roll coor exch get aload pop curveto + } if + } + { + exch 1 exch { + coor exch get aload pop lineto + } for + } ifelse + { closepath fill } if stroke + grestore +} bind def +/omark { % i j lw r g b omark + % stroke segment [i..j] with linewidth lw, color rgb + false 7 1 roll segmark +} bind def +/Fomark { % i j r g b Fomark + % fill segment [i..j] with color rgb + % should precede drawbases + 1 4 1 roll true 7 1 roll segmark +} bind def +/BFmark{ % i j k l r g b BFmark + % fill block between pairs (i,j) and (k,l) with color rgb + % should precede drawbases + gsave + setrgbcolor + newpath + currentdict (cpr) known + { + dup 1 sub coor exch get aload pop moveto % move to l + dup 1 sub 4 -1 roll dup 5 1 roll 1 sub 1 exch + { coor exch get aload pop lineto } for % lines from l to j + 3 -1 roll 4 -1 roll dup 5 1 roll arccoords curveto % curve from j to i + exch dup 4 -1 roll 1 sub exch 1 sub 1 exch + { coor exch get aload pop lineto } for % lines from i to k + exch arccoords curveto% curve from k to l + } + { exch 4 3 roll exch 1 sub exch 1 sub dup + coor exch get aload pop moveto + exch 1 exch { coor exch get aload pop lineto } for + exch 1 sub exch 1 sub dup + coor exch get aload pop lineto + exch 1 exch { coor exch get aload pop lineto } for + } ifelse + closepath fill stroke + grestore +} bind def +/hsb { + dup 0.3 mul 1 exch sub sethsbcolor +} bind def +/colorpair { % i j hue sat colorpair + % draw basepair i,j in color + % 1 index 0.00 ne { + gsave + newpath + hsb + fsize setlinewidth + currentdict (cpr) known + { + exch dup + coor exch 1 sub get aload pop moveto + exch arccoords curveto + } + { 1 sub coor exch get aload pop moveto + 1 sub coor exch get aload pop lineto + } ifelse + stroke + grestore + % } if +} bind def +end + +%%EndProlog +RNAplot begin +% data start here +/sequence (\ +GUUUCCGUAGUGUAGUGGUUAUCACGUUCGCCUCACACGCGAAAGGU_________CCCCGGUUCGAAACCGGGCGGAAACA\ +) def +/coor [ +[126.01442719 205.80749512] +[125.44680786 190.81823730] +[124.87918091 175.82897949] +[124.31156158 160.83972168] +[123.74394226 145.85047913] +[123.17631531 130.86122131] +[122.60869598 115.87195587] +[107.91925812 124.77088928] +[91.87033844 122.99333954] +[80.97422791 112.51052094] +[66.42591858 116.16383362] +[51.87760544 119.81713867] +[47.74618530 134.60993958] +[36.76065063 145.34370422] +[21.87605476 149.13108826] +[7.09627628 144.95332336] +[-3.60299659 133.93420410] +[-7.34371328 119.03780365] +[-3.11964059 104.27119446] +[7.93296814 93.60651398] +[22.84101677 89.91250610] +[37.59431458 94.18284607] +[48.22429657 105.26882935] +[62.77260971 101.61552429] +[77.32091522 97.96221161] +[93.74244690 75.59227753] +[122.92980194 84.59557343] +[115.84320831 71.37512970] +[108.75661469 58.15468216] +[101.67002106 44.93423462] +[94.58342743 31.71378899] +[79.24071503 28.69135094] +[69.47061157 16.48155785] +[69.88626099 0.84949923] +[80.29140472 -10.82384396] +[95.77305603 -13.02667522] +[109.02124786 -4.71888638] +[113.78059387 10.17683983] +[107.80387115 24.62719536] +[114.89046478 37.84764099] +[121.97705841 51.06808853] +[129.06365967 64.28853607] +[136.15025330 77.50897980] +[130.14912415 63.76174545] +[129.68310547 48.76898575] +[134.81886292 34.67558289] +[144.82167053 23.49776077] +[158.26051331 16.83462524] +[173.21282959 15.63941574] +[187.53950500 20.08312035] +[199.19094849 29.53001785] +[206.50028992 42.62862396] +[208.42185974 57.50503159] +[204.68074036 72.03101349] +[195.81214905 84.12845612] +[183.08483887 92.06668854] +[168.31959534 94.71005249] +[153.62709045 91.67971802] +[168.02673340 95.88093567] +[182.42637634 100.08216095] +[196.82603455 104.28337860] +[211.22567749 108.48459625] +[224.12878418 99.65035248] +[239.68653870 101.22833252] +[250.55305481 112.47345734] +[251.59750366 128.07612610] +[242.32670593 140.66921997] +[227.11805725 144.30670166] +[213.15261841 137.27102661] +[207.02444458 122.88423920] +[192.62480164 118.68302155] +[178.22515869 114.48180389] +[163.82551575 110.28057861] +[149.42587280 106.07936096] +[137.59794617 115.30433655] +[138.16557312 130.29359436] +[138.73320007 145.28285217] +[139.30081177 160.27210999] +[139.86843872 175.26136780] +[140.43606567 190.25062561] +[141.00367737 205.23986816] +[143.92169189 224.40065002] +] def +/pairs [ +[1 81] +[2 80] +[3 79] +[4 78] +[5 77] +[6 76] +[7 75] +[10 25] +[11 24] +[12 23] +[27 43] +[28 42] +[29 41] +[30 40] +[31 39] +[58 74] +[59 73] +[60 72] +[61 71] +[62 70] +] def + +init + +% Start Annotations +1 81 0.0 1 colorpair +2 80 0.16 1 colorpair +3 79 0.16 1 colorpair +4 78 0.16 1 colorpair +5 77 0.16 1 colorpair +6 76 0.32 1 colorpair +7 75 0.16 1 colorpair +10 25 0.0 1 colorpair +11 24 0.16 1 colorpair +12 23 0.16 1 colorpair +27 43 0.16 1 colorpair +28 42 0.0 1 colorpair +29 41 0.16 1 colorpair +30 40 0.0 1 colorpair +31 39 0.16 1 colorpair +58 74 0.16 1 colorpair +59 73 0.0 1 colorpair +60 72 0.16 1 colorpair +61 71 0.0 1 colorpair +62 70 0.0 1 colorpair + +% End Annotations +% switch off outline pairs or bases by removing these lines +drawoutline +drawpairs +drawbases +% Start Annotations +2 cmark +80 cmark +3 cmark +79 cmark +4 cmark +78 cmark +5 cmark +77 cmark +6 cmark +76 cmark +7 cmark +75 cmark +11 cmark +24 cmark +12 cmark +23 cmark +27 cmark +43 cmark +29 cmark +41 cmark +31 cmark +39 cmark +58 cmark +74 cmark +60 cmark +72 cmark + +% End Annotations +% show it +showpage +end +%%EOF