Mercurial > repos > rnateam > mea

changeset 0:399593f05b4d draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload commit 6f0b360c2f718f0d3bd436db0f89af3805d7c332-dirty
author rnateam
date Sat, 01 Aug 2015 04:46:19 -0400
parents
children 9ebd60531aa6
files mea.xml test-data/test_compare.out test-data/test_dp.ps test-data/test_predict.out test-data/test_reference.txt test-data/test_structure.txt tool_dependencies.xml
diffstat 7 files changed, 1063 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/mea.xml	Sat Aug 01 04:46:19 2015 -0400
@@ -0,0 +1,176 @@
+<tool id="mea" name="MEA" version="0.6.4.0">
+    <description>Predict MEA structures and compare structures of RNAs</description>
+    <requirements>
+        <requirement type="package" version="2.22.6">gengetopt</requirement>
+        <requirement type="package" version="0.6.4">mea</requirement>
+    </requirements>
+    <stdio>
+        <exit_code range=":-1"/>
+        <exit_code range="1:" />
+    </stdio>
+    <version_command>mea --version</version_command>
+    <command><![CDATA[
+        mea
+        #if str($predict_mode.predict_selector) == "predict":
+            $predict_mode.dotplot
+            #if str($predict_mode.mea_parameters.mea_parameters_selector) == "no_default"
+                --alpha $predict_mode.mea_parameters.alpha
+                --beta $predict_mode.mea_parameters.beta
+                --gamma $predict_mode.mea_parameters.gamma
+                --delta $predict_mode.mea_parameters.delta
+            #end if
+        #else
+            --structure `cat $predict_mode.structure`
+        #end if
+        #if str($compare_mode.compare_selector) == 'compare':
+            --reference `cat $compare_mode.reference`
+            $compare_mode.slide_rule
+            $compare_mode.conflict_rule
+        #end if
+        > $stdout
+    ]]></command>
+    <inputs>
+        <conditional name="predict_mode">
+            <param name="predict_selector" type="select" label="Predict MEA structure">
+                <option value="predict">Predict MEA structure</option>
+                <option value="compare">Specify structure (for comparison)</option>
+            </param>
+            <when value="predict">
+                <param name="dotplot" type="data" format="rna_eps" label="Dotplot" optional="False"
+                    help="Dotplot file (RNA base pair probabilities)"/>
+                <conditional name="mea_parameters">
+                    <param name="mea_parameters_selector" type="boolean" label="Use default parameters"
+                       truevalue="default" falsevalue="no_default" checked="True"
+                       help="The default parameters assign a base pair weight
+                            of 0.5 and penalize long base pairs." />
+                    <when value="default" />
+                    <when value="no_default">
+                    <param name="alpha" label="Alpha value" type="float"
+                            optional="False" value="0.012"
+                            help="Slope of base pair distance penalty. (--alpha)"/>
+                    <param name="beta" label="Beta value" type="float"
+                            optional="False" value="315"
+                            help="Turning point of base pair distance penalty. (--beta)" />
+                    <param name="gamma" label="Gamma value" type="float"
+                            optional="False" value="0.5"
+                            help="Base pair weight factor. (--gamma)" />
+                    <param name="delta" label="Delta value" type="float"
+                            optional="False" value="0.003"
+                            help="Minimum penalty factor for base pairs. (--delta)" />
+                    </when>
+                </conditional>
+            </when>
+            <when value="compare">
+                <param name="structure" format="txt" type="data" label="Structure" optional="False"
+                    help="(Predicted) RNA secondary structure for comparison to a reference structure. (--structure)" />
+            </when>
+        </conditional>
+        <conditional name="compare_mode">
+            <param name="compare_selector" type="select" label="Compare to a reference structure"
+                help="Whether to compare the predicted (or specified) structure to a reference structure.">
+                <option value="dont_compare">Do not compare</option>
+                <option value="compare">Compare to reference structure</option>
+            </param>
+            <when value="dont_compare" />
+            <when value="compare">
+                <param name="reference"
+                       optional="false"
+                       format="txt" type="data"
+                       label="Reference"
+                       help="Reference structure in dot-bracket format"/>
+                <param name="slide_rule" label="Slide Rule" type="boolean"
+                       optional="False" checked="True" falsevalue="--no-slide-rule" truevalue="" help="Use slide rule. (--no-slide-rule)" />
+                <param name="conflict_rule" label="Conflict Rule" type="boolean"
+                       optional="False" checked="True" falsevalue="--no-conflict-rule" truevalue="" help="Use onflict rule. (--no-conflict-rule)"/>
+            </when>
+        </conditional>
+    </inputs>
+    <outputs>
+        <data format="txt" name="stdout" label="${tool.name} on ${on_string}" />
+    </outputs>
+    <tests>
+        <test>
+            <param name="mea_parameter_selector" value="default" />
+            <param name="predict_selector" value="predict" />
+            <param name="compare_selector"  value="compare" />
+            <param name="dotplot" value="test_dp.ps" />
+            <param name="reference" value="test_reference.txt" />
+            <output name="stdout" file="test_predict.out" />
+        </test>
+        <test>
+            <param name="mea_parameter_selector" value="default" />
+            <param name="predict_selector" value="compare" />
+            <param name="compare_selector" value="compare" />
+            <param name="structure" value="test_structure.txt" />
+            <param name="reference" value="test_reference.txt" />
+            <output name="stdout" file="test_compare.out" />
+        </test>
+    </tests>
+    <help><![CDATA[
+=====
+MEA
+=====
+
+`MEA <http://www.bioinf.uni-leipzig.de/Software/mea/>`_ predicts RNA maximum expected accuracy structures from RNA base pair probabilities and optionally compares them to a reference structure. In a special mode it skips the prediction and compares a
+given structure to the reference.  For the prediction, MEA allows to
+penalize long base pairs, using parameters alpha, beta, gamma, and
+delta. For the comparison of secondary structures, several measures
+are computed from the confusion matrix of the RNA base pairs.
+
+------
+Inputs
+------
+
+The tool accepts dot plot files as generated by RNAfold -p.
+
+For (predicted) structure and reference, the tool accepts
+dot-bracket structures with pseudoknots (supporting bracket pairs
+(),{},[],<>,Aa,Bb,...)
+
+-------
+Outputs
+-------
+
+If predicting a structure, the tool outputs the sequence and the
+predicted dot bracket strucuture with computed score in parenthesis
+following the structure. This mimicks the output of the Vienna
+tools.
+
+The result of structure comparison is reported as a line of numbers
+
+TP FP FN TN SENS PPV F1 MCC
+
+where 
+
+* TP   = # true positives
+
+* FP   = # false positives
+
+* FN   = # false negatives
+
+* TN   = # true negatives
+
+* SENS = TP/(TP+FN) 'Sensitivity'http://www.bioinf.uni-leipzig.de/Software/mea/
+
+* PPV  = TP/(TP+FP) 'Positive Predictive Value'
+
+* F1   = PPV*SENS / (PPV+SENS), if PPV+SENS!=0; 0, otherwise   'F1-score'
+
+* MCC  = (TP*TN - FP*FN) / sqrt( (TP+FP)*(TP+FN)*(TN+FP)*(TN+FN) ) 'Mathews correlation coefficient'
+
+
+Special rules for prediction evaluation:
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+
+* Slide rule: tolerate shift of one base pair end by one base. This
+  rule directly affects the number of true positives.  
+* Conflict rule: predicted base pairs are false only if they
+  conflict with the reference; two base pair conflict if and only if
+  they share one end This rule directly affects the number of false
+  positives.
+
+    ]]></help>
+    <citations>
+        <citation type="doi">10.1007/978-3-319-02624-4_1</citation>
+    </citations>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_compare.out	Sat Aug 01 04:46:19 2015 -0400
@@ -0,0 +1,1 @@
+22 0 6 4067 0.785714 1 0.88 0.885752
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_dp.ps	Sat Aug 01 04:46:19 2015 -0400
@@ -0,0 +1,854 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Title: RNA Dot Plot
+%%Creator: PS_dot.c,v 1.38 2007/02/02 15:18:13 ivo Exp $, ViennaRNA-2.1.8
+%%CreationDate: Tue Jun 30 15:53:02 2015
+%%BoundingBox: 66 211 518 662
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options: -d2 
+% 
+%This file contains the square roots of the base pair probabilities in the form
+% i  j  sqrt(p(i,j)) ubox
+
+%%BeginProlog
+/DPdict 100 dict def
+DPdict begin
+/logscale false def
+/lpmin 1e-05 log def
+
+/box { %size x y box - draws box centered on x,y
+   2 index 0.5 mul sub            % x -= 0.5
+   exch 2 index 0.5 mul sub exch  % y -= 0.5
+   3 -1 roll dup rectfill
+} bind def
+
+/ubox {
+   logscale {
+      log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
+   } if
+   3 1 roll
+   exch len exch sub 1 add box
+} bind def
+
+/lbox {
+   3 1 roll
+   len exch sub 1 add box
+} bind def
+
+/drawseq {
+% print sequence along all 4 sides
+[ [0.7 -0.3 0 ]
+  [0.7 0.7 len add 0]
+  [-0.3 len sub -0.4 -90]
+  [-0.3 len sub 0.7 len add -90]
+] {
+   gsave
+    aload pop rotate translate
+    0 1 len 1 sub {
+     dup 0 moveto
+     sequence exch 1 getinterval
+     show
+    } for
+   grestore
+  } forall
+} bind def
+
+/drawgrid{
+  0.01 setlinewidth
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+  dup 1 gt {
+     dup dup 20 div dup 2 array astore exch 40 div setdash
+  } { [0.3 0.7] 0.1 setdash } ifelse
+  0 exch len {
+     dup dup
+     0 moveto
+     len lineto 
+     dup
+     len exch sub 0 exch moveto
+     len exch len exch sub lineto
+     stroke
+  } for
+  [] 0 setdash
+  0.04 setlinewidth 
+  currentdict /cutpoint known {
+    cutpoint 1 sub
+    dup dup -1 moveto len 1 add lineto
+    len exch sub dup
+    -1 exch moveto len 1 add exch lineto
+    stroke
+  } if
+  0.5 neg dup translate
+} bind def
+
+end
+%%EndProlog
+DPdict begin
+%delete next line to get rid of title
+270 665 moveto /Helvetica findfont 14 scalefont setfont (dot.ps) show
+
+/sequence { (\
+ACGUAGCGGCGAUCGUAGCUAGCGCGCGAGUCGAUCGGCGCGGAUGCAUGCGGCGCGAGCGGUAGCGCGUAGGAGAUAUUAGCGGCGCGAUGCG\
+) } def
+/len { sequence length } bind def
+
+72 216 translate
+72 6 mul len 1 add div dup scale
+/Helvetica findfont 0.95 scalefont setfont
+
+drawseq
+0.5 dup translate
+% draw diagonal
+0.04 setlinewidth
+0 len moveto len 0 lineto stroke 
+
+/min { 2 copy gt { exch } if pop } bind def
+
+/utri{ % i j prob utri
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.33
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub
+  moveto lineto lineto closepath fill
+  grestore
+} bind def
+
+%data starts here
+
+%start of quadruplex data
+
+%draw the grid
+drawgrid
+
+%start of base pair probability data
+1 45 0.037521086 ubox
+1 63 0.014295566 ubox
+1 91 0.020645728 ubox
+2 6 0.004367449 ubox
+2 8 0.021705446 ubox
+2 11 0.013667321 ubox
+2 15 0.003271257 ubox
+2 22 0.035590809 ubox
+2 24 0.012104068 ubox
+2 26 0.004697631 ubox
+2 40 0.008961167 ubox
+2 42 0.099828325 ubox
+2 43 0.149022299 ubox
+2 46 0.130891127 ubox
+2 52 0.005379135 ubox
+2 57 0.039834753 ubox
+2 59 0.013489281 ubox
+2 61 0.240340024 ubox
+2 62 0.014748017 ubox
+2 65 0.012986509 ubox
+2 87 0.018454189 ubox
+2 89 0.198685971 ubox
+2 92 0.258042883 ubox
+2 94 0.239140657 ubox
+3 7 0.020435524 ubox
+3 10 0.013735849 ubox
+3 14 0.003249549 ubox
+3 19 0.012487128 ubox
+3 23 0.012668579 ubox
+3 25 0.004730655 ubox
+3 39 0.008994103 ubox
+3 41 0.076982114 ubox
+3 45 0.190948035 ubox
+3 47 0.015810575 ubox
+3 51 0.005415168 ubox
+3 56 0.039802053 ubox
+3 60 0.241563115 ubox
+3 63 0.003875608 ubox
+3 86 0.018481981 ubox
+3 88 0.199541373 ubox
+3 91 0.257491606 ubox
+3 93 0.249218165 ubox
+4 9 0.013378812 ubox
+4 18 0.012395370 ubox
+4 21 0.107585739 ubox
+4 22 0.009274398 ubox
+4 24 0.004418681 ubox
+4 38 0.008727279 ubox
+4 40 0.070572076 ubox
+4 42 0.061372098 ubox
+4 43 0.104490298 ubox
+4 44 0.200010223 ubox
+4 46 0.015931964 ubox
+4 50 0.005390376 ubox
+4 55 0.037202525 ubox
+4 57 0.004029813 ubox
+4 58 0.014866920 ubox
+4 59 0.237954189 ubox
+4 61 0.009749317 ubox
+4 62 0.005199825 ubox
+4 64 0.013142870 ubox
+4 85 0.017574854 ubox
+4 87 0.186788879 ubox
+4 89 0.003663857 ubox
+4 90 0.247333055 ubox
+4 92 0.247345722 ubox
+5 20 0.110571280 ubox
+5 45 0.018536568 ubox
+5 49 0.005281456 ubox
+5 63 0.013431643 ubox
+5 91 0.217923792 ubox
+6 16 0.013892313 ubox
+6 19 0.111340434 ubox
+6 23 0.006732127 ubox
+6 39 0.025916162 ubox
+6 41 0.844447131 ubox
+6 54 0.040029951 ubox
+6 56 0.181842067 ubox
+6 60 0.149620792 ubox
+6 83 0.018806564 ubox
+6 86 0.204827846 ubox
+6 88 0.350799591 ubox
+6 93 0.023085094 ubox
+7 15 0.014531894 ubox
+7 18 0.111297143 ubox
+7 22 0.007515494 ubox
+7 33 0.004585087 ubox
+7 37 0.064515784 ubox
+7 38 0.023622021 ubox
+7 40 0.847088320 ubox
+7 42 0.007244682 ubox
+7 53 0.040045383 ubox
+7 55 0.181902420 ubox
+7 57 0.112607527 ubox
+7 59 0.150083377 ubox
+7 61 0.020101947 ubox
+7 82 0.018805245 ubox
+7 84 0.018804944 ubox
+7 85 0.204883438 ubox
+7 87 0.351777128 ubox
+7 89 0.043066339 ubox
+7 92 0.023134223 ubox
+7 94 0.003907637 ubox
+8 14 0.014827477 ubox
+8 16 0.003209920 ubox
+8 20 0.011969025 ubox
+8 32 0.004614874 ubox
+8 36 0.065392120 ubox
+8 39 0.847188337 ubox
+8 41 0.007178023 ubox
+8 54 0.181306532 ubox
+8 56 0.080337419 ubox
+8 60 0.020086236 ubox
+8 83 0.018124772 ubox
+8 86 0.351634124 ubox
+8 88 0.033522271 ubox
+8 91 0.018551778 ubox
+9 13 0.009610222 ubox
+9 16 0.101290090 ubox
+9 19 0.013854560 ubox
+9 31 0.004612511 ubox
+9 35 0.064869077 ubox
+9 36 0.009174145 ubox
+9 39 0.009762960 ubox
+9 51 0.040238572 ubox
+9 54 0.017892412 ubox
+9 56 0.224659359 ubox
+9 83 0.207194705 ubox
+9 86 0.017267611 ubox
+9 88 0.064192694 ubox
+9 93 0.024125686 ubox
+10 15 0.106267019 ubox
+10 18 0.013868465 ubox
+10 30 0.004596046 ubox
+10 33 0.066712846 ubox
+10 37 0.847381407 ubox
+10 38 0.008186006 ubox
+10 50 0.040244507 ubox
+10 52 0.178117235 ubox
+10 53 0.022350185 ubox
+10 55 0.238410141 ubox
+10 57 0.003546542 ubox
+10 82 0.207212728 ubox
+10 84 0.349993064 ubox
+10 85 0.016510985 ubox
+10 87 0.069764212 ubox
+10 89 0.015095559 ubox
+10 92 0.024298069 ubox
+10 94 0.003668690 ubox
+11 32 0.066778179 ubox
+11 36 0.847577632 ubox
+11 49 0.034418944 ubox
+11 51 0.176357702 ubox
+11 54 0.238356297 ubox
+11 56 0.003552368 ubox
+11 79 0.009009634 ubox
+11 80 0.085658080 ubox
+11 83 0.348590635 ubox
+11 86 0.069697953 ubox
+11 88 0.014830844 ubox
+11 91 0.014586538 ubox
+11 93 0.003880719 ubox
+12 31 0.065069649 ubox
+12 35 0.847389109 ubox
+12 49 0.071664533 ubox
+12 70 0.005852706 ubox
+12 77 0.095653881 ubox
+12 79 0.103294789 ubox
+12 80 0.086537203 ubox
+12 91 0.020714973 ubox
+13 29 0.060139119 ubox
+13 30 0.034396159 ubox
+13 34 0.847175040 ubox
+13 48 0.072572200 ubox
+13 50 0.012455906 ubox
+13 53 0.239385252 ubox
+13 71 0.005947257 ubox
+13 74 0.010883135 ubox
+13 76 0.099046684 ubox
+13 78 0.101455563 ubox
+13 81 0.099504308 ubox
+13 82 0.027687917 ubox
+13 85 0.067876723 ubox
+13 90 0.025283938 ubox
+14 28 0.069953762 ubox
+14 30 0.003635706 ubox
+14 33 0.847289081 ubox
+14 46 0.015512422 ubox
+14 50 0.094202845 ubox
+14 52 0.246327244 ubox
+14 69 0.057875825 ubox
+14 73 0.011307529 ubox
+14 75 0.099304185 ubox
+14 82 0.015780741 ubox
+14 84 0.068556444 ubox
+14 87 0.017719285 ubox
+14 89 0.025309144 ubox
+14 94 0.003775421 ubox
+15 27 0.071514866 ubox
+15 31 0.010847351 ubox
+15 32 0.843968222 ubox
+15 45 0.015472831 ubox
+15 47 0.149926609 ubox
+15 49 0.097360282 ubox
+15 51 0.246797690 ubox
+15 68 0.058270453 ubox
+15 77 0.262987322 ubox
+15 79 0.222099445 ubox
+15 80 0.009088416 ubox
+15 83 0.067701853 ubox
+15 86 0.018263026 ubox
+15 88 0.025217470 ubox
+15 93 0.003991467 ubox
+16 26 0.067491075 ubox
+16 28 0.031008167 ubox
+16 29 0.072594599 ubox
+16 30 0.201983675 ubox
+16 44 0.015076160 ubox
+16 46 0.149962565 ubox
+16 48 0.097145888 ubox
+16 50 0.246761891 ubox
+16 67 0.054519211 ubox
+16 71 0.010400114 ubox
+16 73 0.022474058 ubox
+16 74 0.016616876 ubox
+16 75 0.040604294 ubox
+16 76 0.270624115 ubox
+16 78 0.228368573 ubox
+16 81 0.019277755 ubox
+16 82 0.062560990 ubox
+16 85 0.017470895 ubox
+16 87 0.024343783 ubox
+16 92 0.003984466 ubox
+17 31 0.067807624 ubox
+17 45 0.135192933 ubox
+17 49 0.243922602 ubox
+17 70 0.009806352 ubox
+17 77 0.210876465 ubox
+17 79 0.005721920 ubox
+17 80 0.026405295 ubox
+17 91 0.003890715 ubox
+18 23 0.007566048 ubox
+18 25 0.202387424 ubox
+18 27 0.766629747 ubox
+18 31 0.261859827 ubox
+18 32 0.004157726 ubox
+18 45 0.004658670 ubox
+18 47 0.266002961 ubox
+18 66 0.061518302 ubox
+18 77 0.010308519 ubox
+18 79 0.026034275 ubox
+18 80 0.017320703 ubox
+18 83 0.033674072 ubox
+18 86 0.006370458 ubox
+19 24 0.202161595 ubox
+19 26 0.766002718 ubox
+19 28 0.098227020 ubox
+19 30 0.276214409 ubox
+19 42 0.007255022 ubox
+19 43 0.115466385 ubox
+19 46 0.266190796 ubox
+19 65 0.061621321 ubox
+19 72 0.132433308 ubox
+19 73 0.335075981 ubox
+19 75 0.174097688 ubox
+19 82 0.034009440 ubox
+19 85 0.006337894 ubox
+20 24 0.041288952 ubox
+20 26 0.011266781 ubox
+20 28 0.009527024 ubox
+20 29 0.269100135 ubox
+20 42 0.102651357 ubox
+20 43 0.017791755 ubox
+20 44 0.029567081 ubox
+20 46 0.006913403 ubox
+20 64 0.061609346 ubox
+20 71 0.132343080 ubox
+20 72 0.327064446 ubox
+20 73 0.024744916 ubox
+20 74 0.172172078 ubox
+20 78 0.008616522 ubox
+20 81 0.034044897 ubox
+20 84 0.005349261 ubox
+21 45 0.019901701 ubox
+21 63 0.061450239 ubox
+21 70 0.094630320 ubox
+21 77 0.008770697 ubox
+21 80 0.033712127 ubox
+22 27 0.144503043 ubox
+22 31 0.050422832 ubox
+22 41 0.207166987 ubox
+22 68 0.019255477 ubox
+22 70 0.389118283 ubox
+22 79 0.011286016 ubox
+22 88 0.007249638 ubox
+23 28 0.037382685 ubox
+23 30 0.050805185 ubox
+23 40 0.207341852 ubox
+23 42 0.252666381 ubox
+23 43 0.004602337 ubox
+23 61 0.061616082 ubox
+23 67 0.019277203 ubox
+23 69 0.406334190 ubox
+23 72 0.004682256 ubox
+23 87 0.007270739 ubox
+24 31 0.033760458 ubox
+24 39 0.207344295 ubox
+24 41 0.253201902 ubox
+24 60 0.061639786 ubox
+24 66 0.019274829 ubox
+24 68 0.406511149 ubox
+24 70 0.016029681 ubox
+24 86 0.007260326 ubox
+25 30 0.034038814 ubox
+25 38 0.207189392 ubox
+25 40 0.253223146 ubox
+25 42 0.007561329 ubox
+25 59 0.061515545 ubox
+25 65 0.019254142 ubox
+25 67 0.406511369 ubox
+25 69 0.016372634 ubox
+25 84 0.005456586 ubox
+25 85 0.005217208 ubox
+25 94 0.007850186 ubox
+26 39 0.252885748 ubox
+26 41 0.007602875 ubox
+26 63 0.015134489 ubox
+26 66 0.406506091 ubox
+26 68 0.016378544 ubox
+26 83 0.007440764 ubox
+26 93 0.008310063 ubox
+27 37 0.262262676 ubox
+27 38 0.194749775 ubox
+27 40 0.007591399 ubox
+27 42 0.004178327 ubox
+27 57 0.060646786 ubox
+27 61 0.006856647 ubox
+27 62 0.016172056 ubox
+27 65 0.406287833 ubox
+27 67 0.016378075 ubox
+27 82 0.007447105 ubox
+27 92 0.008301162 ubox
+27 94 0.004246028 ubox
+28 36 0.308389500 ubox
+28 39 0.006526280 ubox
+28 41 0.004312139 ubox
+28 56 0.060646316 ubox
+28 60 0.010855479 ubox
+28 63 0.019268097 ubox
+28 66 0.016299714 ubox
+28 91 0.004460063 ubox
+28 93 0.004475462 ubox
+29 35 0.305668438 ubox
+29 63 0.111713816 ubox
+30 35 0.021217944 ubox
+30 36 0.040438679 ubox
+30 39 0.006684463 ubox
+30 54 0.060335569 ubox
+30 60 0.093092305 ubox
+30 63 0.145671356 ubox
+30 77 0.006982399 ubox
+30 91 0.008049747 ubox
+31 38 0.007121915 ubox
+31 53 0.060405807 ubox
+31 58 0.102211146 ubox
+31 59 0.054262976 ubox
+31 61 0.020926780 ubox
+31 62 0.355366954 ubox
+31 76 0.007343760 ubox
+31 90 0.009770487 ubox
+32 37 0.008976508 ubox
+32 52 0.060411444 ubox
+32 57 0.112171720 ubox
+32 59 0.022765395 ubox
+32 61 0.386545258 ubox
+32 62 0.019149553 ubox
+32 75 0.007376470 ubox
+32 89 0.009853263 ubox
+33 51 0.060202424 ubox
+33 56 0.109875526 ubox
+33 60 0.383724314 ubox
+33 88 0.009645443 ubox
+34 45 0.006544156 ubox
+34 49 0.009212129 ubox
+34 63 0.003712235 ubox
+35 44 0.006721756 ubox
+35 48 0.008368024 ubox
+35 50 0.013009869 ubox
+35 55 0.007498445 ubox
+35 57 0.010422186 ubox
+35 58 0.331608099 ubox
+35 59 0.049103805 ubox
+35 62 0.004164222 ubox
+35 73 0.005746522 ubox
+35 74 0.003269593 ubox
+36 43 0.006735926 ubox
+36 50 0.014173462 ubox
+36 53 0.010751776 ubox
+36 55 0.150088918 ubox
+36 57 0.360797410 ubox
+36 59 0.009049701 ubox
+36 61 0.004285642 ubox
+36 72 0.005907132 ubox
+36 73 0.003296694 ubox
+36 87 0.010138181 ubox
+37 47 0.003475085 ubox
+37 49 0.013285354 ubox
+37 54 0.155023410 ubox
+37 56 0.303554581 ubox
+37 60 0.004274899 ubox
+37 86 0.010372872 ubox
+38 47 0.059155232 ubox
+38 51 0.011959125 ubox
+38 54 0.230460425 ubox
+38 56 0.221561602 ubox
+38 68 0.004180892 ubox
+38 70 0.006935648 ubox
+39 46 0.059208724 ubox
+39 50 0.012018649 ubox
+39 52 0.216700833 ubox
+39 53 0.180049832 ubox
+39 55 0.293106797 ubox
+39 57 0.006672659 ubox
+39 67 0.004253543 ubox
+39 69 0.007186705 ubox
+39 84 0.010677991 ubox
+40 45 0.038354313 ubox
+40 47 0.012692859 ubox
+40 49 0.010960050 ubox
+40 51 0.260362642 ubox
+40 54 0.293413841 ubox
+40 56 0.006787752 ubox
+40 66 0.004255686 ubox
+40 68 0.007188595 ubox
+40 83 0.010722221 ubox
+41 46 0.012738676 ubox
+41 50 0.260610340 ubox
+41 52 0.137141405 ubox
+41 53 0.280814164 ubox
+41 55 0.006805474 ubox
+41 65 0.004265493 ubox
+41 67 0.007181400 ubox
+41 82 0.010720009 ubox
+42 47 0.024020779 ubox
+42 49 0.237558669 ubox
+42 51 0.161383013 ubox
+42 54 0.006732983 ubox
+42 66 0.006752797 ubox
+42 93 0.007784487 ubox
+43 47 0.030029679 ubox
+43 49 0.005096988 ubox
+43 51 0.242156365 ubox
+43 80 0.009174223 ubox
+43 93 0.004326096 ubox
+44 49 0.084853186 ubox
+44 70 0.005622445 ubox
+44 79 0.010555236 ubox
+44 91 0.007563281 ubox
+45 50 0.050375260 ubox
+45 52 0.014395383 ubox
+45 61 0.012956084 ubox
+45 64 0.004541817 ubox
+45 67 0.004306230 ubox
+45 69 0.005968153 ubox
+45 78 0.010540639 ubox
+45 90 0.007481616 ubox
+45 94 0.611990670 ubox
+46 51 0.014743705 ubox
+46 54 0.003633148 ubox
+46 60 0.014157606 ubox
+46 63 0.004701867 ubox
+46 66 0.008725838 ubox
+46 68 0.006115946 ubox
+46 77 0.010205016 ubox
+46 93 0.844929365 ubox
+47 52 0.004893440 ubox
+47 53 0.003691975 ubox
+47 59 0.014208084 ubox
+47 62 0.004727591 ubox
+47 65 0.011355058 ubox
+47 67 0.006112402 ubox
+47 72 0.004387523 ubox
+47 73 0.004823292 ubox
+47 75 0.005117092 ubox
+47 89 0.004439383 ubox
+47 92 0.854884327 ubox
+48 70 0.003287385 ubox
+48 91 0.852545355 ubox
+49 57 0.014240061 ubox
+49 61 0.005541667 ubox
+49 64 0.027074876 ubox
+49 69 0.003494650 ubox
+49 71 0.013545611 ubox
+49 74 0.008745336 ubox
+49 87 0.003392678 ubox
+49 89 0.500638881 ubox
+49 90 0.687224962 ubox
+49 94 0.019600277 ubox
+50 56 0.014446566 ubox
+50 60 0.006234868 ubox
+50 63 0.029074204 ubox
+50 68 0.003595231 ubox
+50 70 0.014187673 ubox
+50 86 0.004894875 ubox
+50 88 0.854957079 ubox
+50 93 0.026690703 ubox
+51 55 0.014342853 ubox
+51 59 0.006236231 ubox
+51 62 0.029401438 ubox
+51 67 0.003597607 ubox
+51 69 0.014373151 ubox
+51 72 0.009478243 ubox
+51 85 0.004895816 ubox
+51 87 0.855765444 ubox
+51 89 0.031333967 ubox
+51 92 0.026729787 ubox
+52 66 0.003540774 ubox
+52 68 0.010239428 ubox
+52 86 0.855579282 ubox
+52 88 0.022788657 ubox
+52 91 0.020615027 ubox
+53 60 0.030128010 ubox
+53 68 0.042295935 ubox
+53 70 0.021470856 ubox
+53 83 0.006687683 ubox
+53 86 0.009821488 ubox
+53 88 0.031592782 ubox
+54 59 0.030161365 ubox
+54 67 0.044305764 ubox
+54 69 0.027833176 ubox
+54 72 0.006003260 ubox
+54 73 0.004584043 ubox
+54 82 0.006699170 ubox
+54 84 0.855415726 ubox
+54 85 0.009198290 ubox
+54 87 0.038349419 ubox
+54 89 0.024683668 ubox
+54 94 0.007743693 ubox
+55 63 0.004177347 ubox
+55 66 0.044356410 ubox
+55 68 0.027971222 ubox
+55 70 0.019603111 ubox
+55 83 0.855475752 ubox
+55 86 0.038394491 ubox
+55 88 0.024771550 ubox
+55 93 0.008613265 ubox
+56 62 0.004553975 ubox
+56 65 0.044360134 ubox
+56 67 0.027981546 ubox
+56 69 0.034383459 ubox
+56 72 0.016469331 ubox
+56 73 0.014742567 ubox
+56 75 0.003417972 ubox
+56 82 0.854226870 ubox
+56 84 0.004284036 ubox
+56 85 0.038306499 ubox
+56 87 0.024772209 ubox
+56 92 0.008626194 ubox
+57 66 0.025306963 ubox
+57 68 0.065891741 ubox
+57 70 0.230571481 ubox
+57 77 0.005164467 ubox
+57 79 0.009166416 ubox
+57 80 0.102921631 ubox
+57 83 0.004543159 ubox
+57 86 0.024594341 ubox
+57 91 0.008356748 ubox
+58 63 0.006090708 ubox
+58 70 0.026598818 ubox
+58 77 0.008004488 ubox
+58 79 0.113644146 ubox
+58 80 0.112782577 ubox
+59 66 0.128669116 ubox
+59 68 0.801896747 ubox
+59 70 0.124445033 ubox
+59 77 0.004642866 ubox
+59 79 0.081824095 ubox
+59 80 0.018016421 ubox
+59 83 0.041658916 ubox
+59 88 0.010840428 ubox
+59 93 0.091998057 ubox
+60 65 0.129083699 ubox
+60 67 0.802618719 ubox
+60 69 0.128700330 ubox
+60 72 0.004269792 ubox
+60 73 0.004251557 ubox
+60 75 0.013383322 ubox
+60 82 0.041685356 ubox
+60 84 0.012512459 ubox
+60 87 0.010967331 ubox
+60 92 0.092308158 ubox
+60 94 0.010509920 ubox
+61 66 0.799006510 ubox
+61 68 0.128296443 ubox
+61 77 0.027527913 ubox
+61 79 0.012802671 ubox
+61 80 0.058425842 ubox
+61 83 0.012517462 ubox
+61 86 0.010550821 ubox
+61 91 0.089635301 ubox
+61 93 0.016515255 ubox
+62 66 0.016092620 ubox
+62 68 0.008939286 ubox
+62 77 0.184365063 ubox
+62 79 0.098074869 ubox
+62 80 0.003783512 ubox
+62 86 0.004120089 ubox
+62 88 0.013646910 ubox
+62 91 0.024352420 ubox
+62 93 0.278387764 ubox
+63 67 0.009731503 ubox
+63 71 0.010836445 ubox
+63 72 0.004005127 ubox
+63 74 0.009262094 ubox
+63 75 0.044289773 ubox
+63 76 0.186008241 ubox
+63 78 0.100799889 ubox
+63 81 0.012702778 ubox
+63 84 0.006377925 ubox
+63 85 0.004693129 ubox
+63 87 0.013530602 ubox
+63 89 0.007178144 ubox
+63 90 0.027351004 ubox
+63 92 0.278426675 ubox
+64 70 0.010922997 ubox
+64 77 0.093995775 ubox
+64 79 0.003756619 ubox
+64 80 0.012545301 ubox
+64 91 0.232970816 ubox
+65 77 0.003856379 ubox
+65 79 0.010283574 ubox
+65 83 0.010452049 ubox
+65 86 0.010405874 ubox
+65 88 0.119955935 ubox
+65 91 0.007155932 ubox
+65 93 0.007298737 ubox
+66 72 0.083401356 ubox
+66 73 0.190878754 ubox
+66 75 0.083919306 ubox
+66 82 0.010468713 ubox
+66 84 0.019553940 ubox
+66 85 0.009603068 ubox
+66 87 0.120137686 ubox
+66 89 0.276151499 ubox
+66 92 0.006803754 ubox
+67 77 0.006659374 ubox
+67 83 0.021320354 ubox
+67 86 0.120043445 ubox
+67 88 0.278633972 ubox
+68 72 0.021773601 ubox
+68 73 0.093874610 ubox
+68 75 0.035898725 ubox
+68 82 0.021525030 ubox
+68 84 0.067109636 ubox
+68 85 0.100654537 ubox
+68 87 0.278647007 ubox
+69 77 0.035753327 ubox
+69 79 0.188994541 ubox
+69 80 0.012025776 ubox
+69 83 0.094055814 ubox
+69 86 0.278570056 ubox
+70 74 0.010727916 ubox
+70 75 0.011552397 ubox
+70 76 0.037676632 ubox
+70 78 0.201236372 ubox
+70 81 0.175792959 ubox
+70 82 0.087904386 ubox
+70 84 0.008008457 ubox
+70 85 0.269224462 ubox
+71 77 0.200786870 ubox
+71 79 0.023407691 ubox
+71 80 0.183844324 ubox
+72 77 0.018375803 ubox
+72 79 0.175344507 ubox
+72 80 0.026989439 ubox
+72 83 0.217675516 ubox
+73 77 0.009943918 ubox
+73 79 0.023475545 ubox
+73 80 0.162325910 ubox
+73 83 0.065050489 ubox
+74 79 0.163619801 ubox
+74 80 0.054426892 ubox
+75 79 0.039481991 ubox
+75 80 0.096270277 ubox
+75 83 0.011150614 ubox
+76 80 0.038209845 ubox
+77 81 0.012538807 ubox
+77 82 0.007217726 ubox
+77 84 0.003386513 ubox
+82 93 0.005527246 ubox
+83 92 0.005542929 ubox
+84 91 0.005065037 ubox
+85 93 0.007029342 ubox
+86 92 0.007053740 ubox
+86 94 0.005293461 ubox
+87 91 0.004357089 ubox
+87 93 0.011645051 ubox
+88 92 0.011626182 ubox
+89 93 0.003620304 ubox
+6 41 0.9500000 lbox
+7 40 0.9500000 lbox
+8 39 0.9500000 lbox
+10 37 0.9500000 lbox
+11 36 0.9500000 lbox
+12 35 0.9500000 lbox
+13 34 0.9500000 lbox
+14 33 0.9500000 lbox
+15 32 0.9500000 lbox
+18 27 0.9500000 lbox
+19 26 0.9500000 lbox
+45 94 0.9500000 lbox
+46 93 0.9500000 lbox
+47 92 0.9500000 lbox
+48 91 0.9500000 lbox
+49 90 0.9500000 lbox
+50 88 0.9500000 lbox
+51 87 0.9500000 lbox
+52 86 0.9500000 lbox
+54 84 0.9500000 lbox
+55 83 0.9500000 lbox
+56 82 0.9500000 lbox
+59 68 0.9500000 lbox
+60 67 0.9500000 lbox
+61 66 0.9500000 lbox
+showpage
+end
+%%EOF
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_predict.out	Sat Aug 01 04:46:19 2015 -0400
@@ -0,0 +1,3 @@
+ACGUAGCGGCGAUCGUAGCUAGCGCGCGAGUCGAUCGGCGCGGAUGCAUGCGGCGCGAGCGGUAGCGCGUAGGAGAUAUUAGCGGCGCGAUGCG
+.....(((.((((((..((......))....)))))).)))....(((.(((.(((..(((....))).............))).)))..))). (53.4375)
+23 0 2 4070 0.92 1 0.958333 0.958931
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_reference.txt	Sat Aug 01 04:46:19 2015 -0400
@@ -0,0 +1,1 @@
+.....(((.((((((..((......))....)))))).)))...((((((((.(((..(((....))).............))).))).)))))
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_structure.txt	Sat Aug 01 04:46:19 2015 -0400
@@ -0,0 +1,2 @@
+.....(((.((((((..((......))....)))))).)))......(((((.(((.....(((....))).........).)).))).))...
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml	Sat Aug 01 04:46:19 2015 -0400
@@ -0,0 +1,26 @@
+<?xml version="1.0"?>
+<tool_dependency>
+    <package name="gengetopt" version="2.22.6">
+        <repository changeset_revision="6071205c5cd3" name="package_gengetopt_2_22_6" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" />
+    </package>
+    <package name="mea" version="0.6.4">
+        <install version="1.0">
+            <actions>
+                <action type="download_by_url">
+                    http://www.bioinf.uni-leipzig.de/Software/mea/mea-0.6.4.tar.gz
+                </action>
+                <action type="set_environment_for_install">
+                    <repository changeset_revision="6071205c5cd3" name="package_gengetopt_2_22_6" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu">
+                        <package name="gengetopt" version="2.22.6" />
+                    </repository>
+                </action>
+                <action type="autoconf" />
+                <action type="set_environment">
+                    <environment_variable action="prepend_to" name="PATH">$INSTALL_DIR/bin</environment_variable>
+                    <environment_variable action="set_to" name="MEA_ROOT_PATH">$INSTALL_DIR</environment_variable>
+                </action>
+            </actions>
+        </install>
+        <readme>Compiling MEA requires a C++ compiler (usually g++)</readme>
+    </package>
+</tool_dependency>