Mercurial > repos > rnateam > mirdeep2

changeset 4:d338dbd76ea0 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mirdeep2/mirdeep2 commit 04c75332ac618b43ce5c3f307f7866e97147e865
author rnateam
date Thu, 05 Apr 2018 08:37:10 -0400
parents 5cecae70d439
children 6a17e1229b9f
files miRDeep2.tar.gz mirdeep2.xml test-data/detailed_fasta/known_mature.fa test-data/detailed_fasta/known_pres.fa test-data/detailed_fasta/known_star.fa test-data/detailed_fasta/not_mature.fa test-data/detailed_fasta/not_pres.fa test-data/detailed_fasta/not_star.fa test-data/detailed_fasta/novel_mature.fa test-data/detailed_fasta/novel_pres.fa test-data/detailed_fasta/novel_star.fa
diffstat 8 files changed, 130 insertions(+), 42 deletions(-) [+]
line wrap: on
line diff
Binary file miRDeep2.tar.gz has changed
--- a/mirdeep2.xml	Wed Jul 12 14:37:54 2017 -0400
+++ b/mirdeep2.xml	Thu Apr 05 08:37:10 2018 -0400
@@ -1,80 +1,67 @@
-<tool id="rbc_mirdeep2" name="MiRDeep2" version="2.0.0">
+<tool id="rbc_mirdeep2" name="MiRDeep2" version="2.0.0.8.1">
     <description>identification of novel and known miRNAs</description>
     <requirements>
         <requirement type="package" version="2.0.0.8">mirdeep2</requirement>
     </requirements>
-    <stdio>
-        <!-- Anything other than zero is an error -->
-        <exit_code range="1:" />
-        <exit_code range=":-1" />
-        <!-- In case the return code has not been set propery check stderr too -->
-        <regex match="Error:" />
-        <regex match="Exception:" />
-    </stdio>
-    <command>
+    <command detect_errors="aggressive">
 <![CDATA[
     miRDeep2.pl
-    
+
     $reads
     $genome
     $mappings
-    
+
     #if $mature_this
         $mature_this
     #else
         none
     #end if
-    
+
     #if $mature_other
         $mature_other
     #else
         none
     #end if
-    
+
     #if $precursors
         $precursors
     #else
         none
     #end if
-    
+
     #if $species.value != 'all'
         -t $species
     #end if
-    
+
     #if $star_sequences
         -s $star_sequences
     #end if
-    
+
     #if $min_read_stack
         -a $min_read_stack
     #end if
-    
+
     #if $min_read_stack
         -a $min_read_stack
     #end if
-    
+
     -g $max_precursors_analyze
     -b $min_score_cutoff
     $disable_randfold
-    
-    ; mv result*.bed result.bed 2> /dev/null
-    ; mv result*.csv result.csv 2> /dev/null
-    ; mv mirdeep_runs/run*/output.mrd . 2> /dev/null
-    ; mv mirdeep_runs/run*/survey.csv . 2> /dev/null
-    
+
+    &&
+
     ## html output
-    ;
     mv result*.html $html 2> /dev/null
-    
+
     ## move pdf directory to be accessible from the new index.html
-    ;
+    &&
     mkdir -p $html.files_path 2> /dev/null
-    ;
+    &&
     mv pdfs* $html.files_path 2> /dev/null
-    
 ]]>
     </command>
-    <inputs> 
+    <inputs>
         <param name="reads" format="fasta" type="data" label="Collapsed deep sequencing reads">
             <help>
 <![CDATA[
@@ -86,7 +73,7 @@
         </param>
         <param name="genome" format="fasta" type="data" label="Genome" help="Genome contigs in fasta format. The identifiers should be unique."/>
         <param name="mappings" format="tabular" type="data" label="Mappings" help="Reads mapped against genome. Mappings should be in ARF format."/>
-        <param name="mature_this" optional="true" format="fasta" type="data" label="Mature miRNA sequences for this species" 
+        <param name="mature_this" optional="true" format="fasta" type="data" label="Mature miRNA sequences for this species"
             help="miRBase miRNA sequences in fasta format. These should be the known mature sequences for the species being analyzed."/>
         <param name="mature_other" optional="true" format="fasta" type="data" label="Mature miRNA sequences for related species">
             <help>
@@ -96,9 +83,9 @@
 ]]>
             </help>
         </param>
-        <param name="precursors" optional="true" format="fasta" type="data" label="Precursor sequences" 
+        <param name="precursors" optional="true" format="fasta" type="data" label="Precursor sequences"
             help="miRBase miRNA precursor sequences in fasta format. These should be the known precursor sequences for the species being analyzed."/>
-            
+
         <param name="species" type="select" label="Search in species" help="If not searching in a specific species all species in your files will be analyzed. (-t)">
             <option value="all">All species</option>
             <option value="tni">tetraodon</option>
@@ -134,7 +121,7 @@
             <option value="dsi">d.simulans</option>
         </param>
         <param name="star_sequences" format="fasta" type="data" optional="true" label="Star sequences" help="From miRBase in fasta format (optional) (-s)"/>
-        
+
         <param name="min_read_stack" optional="true" type="integer" min="0" label="Minimum read stack height">
             <help>
 <![CDATA[
@@ -143,18 +130,47 @@
 ]]>
             </help>
         </param>
-        <param name="max_precursors_analyze" type="integer" value="50000" label="Maximum precursors" 
+        <param name="max_precursors_analyze" type="integer" value="50000" label="Maximum precursors"
             help="Maximum number of precursors to analyze when automatic excision gearing is used. If set to -1 all precursors will be analyzed. (-g)."/>
-        <param name="min_score_cutoff" type="integer" value="0" label="Minimum miRNA score" 
+        <param name="min_score_cutoff" type="integer" value="0" label="Minimum miRNA score"
             help="Minimum score cut-off for predicted novel miRNAs to be displayed in the overview table. (-b)"/>
         <param name="disable_randfold" type="boolean" truevalue="-c" falsevalue="" label="Disable randfold analysis" help="(-c)"/>
+        <param name="detailed_fasta" type="boolean" checked="false" label="Detailed fasta output" help="Output fasta files of precursors, mature and star strand for both novel and known miRNAs"/>
     </inputs>
     <outputs>
-        <data name="tab_results" format="tabular" from_work_dir="result.csv" label="Tabular output of ${tool.name} on ${on_string}"/>
+        <data name="tab_results" format="tabular" from_work_dir="result*.csv" label="Tabular output of ${tool.name} on ${on_string}"/>
         <data format="html" name="html" label="${tool.name} on ${on_string} (html report)"/>
-        <data name="pred_acc" format="tabular" from_work_dir="survey.csv" label="Prediction accuracy output of ${tool.name} on ${on_string}"/>
-        <data name="bed_out" format="bed" from_work_dir="result.bed" label="Bed output of ${tool.name} on ${on_string}"/>
-        <data name="mrd_out" format="txt" from_work_dir="output.mrd" label="Text output of ${tool.name} on ${on_string}"/>
+        <data name="pred_acc" format="tabular" from_work_dir="mirdeep_runs/run*/survey.csv" label="Prediction accuracy output of ${tool.name} on ${on_string}"/>
+        <data name="bed_out" format="bed" from_work_dir="result*.bed" label="Bed output of ${tool.name} on ${on_string}"/>
+        <data name="mrd_out" format="txt" from_work_dir="mirdeep_runs/run*/output.mrd" label="Text output of ${tool.name} on ${on_string}"/>
+
+        <data name="known_mature" format="fasta" from_work_dir="mirna_results_*/known_mature_*.fa" label="${tool.name} on ${on_string}: known mature">
+            <filter>detailed_fasta</filter>
+        </data>
+        <data name="known_pres" format="fasta" from_work_dir="mirna_results_*/known_pres_*.fa" label="${tool.name} on ${on_string}: known precursors">
+            <filter>detailed_fasta</filter>
+        </data>
+        <data name="known_star" format="fasta" from_work_dir="mirna_results_*/known_star_*.fa" label="${tool.name} on ${on_string}: known star">
+            <filter>detailed_fasta</filter>
+        </data>
+        <data name="not_mature" format="fasta" from_work_dir="mirna_results_*/not_mature_*.fa" label="${tool.name} on ${on_string}: not detected mature">
+            <filter>detailed_fasta</filter>
+        </data>
+        <data name="not_pres" format="fasta" from_work_dir="mirna_results_*/not_pres_*.fa" label="${tool.name} on ${on_string}: not detected precursors">
+            <filter>detailed_fasta</filter>
+        </data>
+        <data name="not_star" format="fasta" from_work_dir="mirna_results_*/not_star_*.fa" label="${tool.name} on ${on_string}: not detected star">
+            <filter>detailed_fasta</filter>
+        </data>
+        <data name="novel_mature" format="fasta" from_work_dir="mirna_results_*/novel_mature_*.fa" label="${tool.name} on ${on_string}: novel mature">
+            <filter>detailed_fasta</filter>
+        </data>
+        <data name="novel_pres" format="fasta" from_work_dir="mirna_results_*/novel_pres_*.fa" label="${tool.name} on ${on_string}: novel precursors">
+            <filter>detailed_fasta</filter>
+        </data>
+        <data name="novel_star" format="fasta" from_work_dir="mirna_results_*/novel_star_*.fa" label="${tool.name} on ${on_string}: novel star">
+            <filter>detailed_fasta</filter>
+        </data>
     </outputs>
     <tests>
         <test>
@@ -164,12 +180,36 @@
             <param name="mature_this" value="mature_ref_this_species.fa"/>
             <param name="mature_other" value="mature_ref_other_species.fa"/>
             <param name="precursors" value="precursors_ref_this_species.fa"/>
-            
+
             <output name="tab_results" file="result.csv" compare="sim_size"/>
             <output name="pred_acc" file="survey.csv" compare="sim_size"/>
             <output name="bed_out" file="result.bed" compare="sim_size"/>
             <output name="mrd_out" file="output.mrd" compare="sim_size"/>
         </test>
+        <test>
+            <param name="reads" value="reads_collapsed.fa"/>
+            <param name="genome" value="cel_cluster.fa"/>
+            <param name="mappings" value="reads_collapsed_vs_genome.arf"/>
+            <param name="mature_this" value="mature_ref_this_species.fa"/>
+            <param name="mature_other" value="mature_ref_other_species.fa"/>
+            <param name="precursors" value="precursors_ref_this_species.fa"/>
+            <param name="detailed_fasta" value="true"/>
+
+            <output name="tab_results" file="result.csv" compare="sim_size"/>
+            <output name="pred_acc" file="survey.csv" compare="sim_size"/>
+            <output name="bed_out" file="result.bed" compare="sim_size"/>
+            <output name="mrd_out" file="output.mrd" compare="sim_size"/>
+
+            <output name="known_mature" file="detailed_fasta/known_mature.fa" compare="sim_size"/>
+            <output name="known_pres" file="detailed_fasta/known_pres.fa" compare="sim_size"/>
+            <output name="known_star" file="detailed_fasta/known_star.fa" compare="sim_size"/>
+            <output name="not_mature" file="detailed_fasta/not_mature.fa" compare="sim_size"/>
+            <output name="not_pres" file="detailed_fasta/not_pres.fa" compare="sim_size"/>
+            <output name="not_star" file="detailed_fasta/not_star.fa" compare="sim_size"/>
+            <output name="novel_mature" file="detailed_fasta/novel_mature.fa" compare="sim_size"/>
+            <output name="novel_pres" file="detailed_fasta/novel_pres.fa" compare="sim_size"/>
+            <output name="novel_star" file="detailed_fasta/novel_star.fa" compare="sim_size"/>
+        </test>
     </tests>
     <help>
 <![CDATA[
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/detailed_fasta/known_mature.fa	Thu Apr 05 08:37:10 2018 -0400
@@ -0,0 +1,14 @@
+>chrII:11534525-11540624_11
+TCACCGGGTGAACACTTGCAGT
+>chrII:11534525-11540624_17
+TCACCGGGTGTACATCAGCTAA
+>chrII:11534525-11540624_9
+TCACCGGGTGAAAATTCGCATG
+>chrII:11534525-11540624_15
+TCACCGGGTGTAAATCAGCTTG
+>chrII:11534525-11540624_19
+GGTGGTTTTTCTCTGCAGTGATA
+>chrII:11534525-11540624_13
+TCACCGGGAGAAAAACTGGAGT
+>chrII:11534525-11540624_12
+TCACCGGGTGAACACTTGCAGT
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/detailed_fasta/known_pres.fa	Thu Apr 05 08:37:10 2018 -0400
@@ -0,0 +1,14 @@
+>chrII:11534525-11540624_11
+TGTGGGTGTCCGTTGCGGTGCTACATTCTCTAATCTGTATCACCGGGTGAACACTTGCAGT
+>chrII:11534525-11540624_17
+AGTGGATGTATGCCATGATGATAAGATATCAGAAATCCTATCACCGGGTGTACATCAGCTAA
+>chrII:11534525-11540624_9
+CGCCAATTTTCGCTTCAGTGCTAGACCATCCAAAGTGTCTATCACCGGGTGAAAATTCGCATG
+>chrII:11534525-11540624_15
+AGCTGATTTCGTCTTGGTAATAAGCTCGTCATTGAGATTATCACCGGGTGTAAATCAGCTTG
+>chrII:11534525-11540624_19
+GGTGGTTTTTCTCTGCAGTGATAGATACTTCTAACAACTCGCTATCACCGGGTGAAAAATCACCTA
+>chrII:11534525-11540624_13
+TCCGGTTTTTTCCGTGGTGATAACGCATCCAAAAGTCTCTATCACCGGGAGAAAAACTGGAGT
+>chrII:11534525-11540624_12
+TCACCGGGTGAACACTTGCAGTGGTCCTCGTGGTTTCTCTGTGAGCCAGGTCCTGTTCCGGTTTTTTCCGTGGTGATA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/detailed_fasta/known_star.fa	Thu Apr 05 08:37:10 2018 -0400
@@ -0,0 +1,14 @@
+>chrII:11534525-11540624_11
+TGTGGGTGTCCGTTGCGGTGCTA
+>chrII:11534525-11540624_17
+AGTGGATGTATGCCATGATGATA
+>chrII:11534525-11540624_9
+CGCCAATTTTCGCTTCAGTGCTA
+>chrII:11534525-11540624_15
+AGCTGATTTCGTCTTGGTAATA
+>chrII:11534525-11540624_19
+TCACCGGGTGAAAAATCACCTA
+>chrII:11534525-11540624_13
+TCCGGTTTTTTCCGTGGTGATA
+>chrII:11534525-11540624_12
+TGTTCCGGTTTTTTCCGTGGTGATA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/detailed_fasta/novel_mature.fa	Thu Apr 05 08:37:10 2018 -0400
@@ -0,0 +1,2 @@
+>chrII:11534525-11540624_7
+TCACCGGGTGGAAACTAGCAGT
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/detailed_fasta/novel_pres.fa	Thu Apr 05 08:37:10 2018 -0400
@@ -0,0 +1,2 @@
+>chrII:11534525-11540624_7
+TGCTGGTTTCTTCCACAGTGGTACTTTCCATTAGAACTATCACCGGGTGGAAACTAGCAGT
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/detailed_fasta/novel_star.fa	Thu Apr 05 08:37:10 2018 -0400
@@ -0,0 +1,2 @@
+>chrII:11534525-11540624_7
+TGCTGGTTTCTTCCACAGTGGTA