Mercurial > repos > rnateam > remurna
changeset 0:b1f5d49a6f30 draft default tip
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/remurna commit 6e51a331dbeab2786d8df5fd379ae3a63eb61d83
| author | rnateam |
|---|---|
| date | Tue, 13 Dec 2016 12:32:11 -0500 |
| parents | |
| children | |
| files | create_input_file.py remurna.xml test-data/generated_input_file_example.fa test-data/output.tabular test-data/seq.fa test-data/snp.txt |
| diffstat | 6 files changed, 145 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/create_input_file.py Tue Dec 13 12:32:11 2016 -0500 @@ -0,0 +1,13 @@ +import sys +import os +wild_fa = sys.argv[1] +snp_tags = sys.argv[2] +outfile = sys.argv[3] +# Write RNA sequence and SNP tags to a outfile +out = open(outfile,'w') +with open (wild_fa) as in_fa_handle: + for line in in_fa_handle: + out.write(line) +with open (snp_tags) as in_snp_handle: + out.write('*'+in_snp_handle.readline()) +out.close()
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/remurna.xml Tue Dec 13 12:32:11 2016 -0500 @@ -0,0 +1,124 @@ +<tool id="remurna" name="remuRNA" version="1.0.0"> + <description>Measurement of Single Nucleotide Polymorphism induced Changes of RNA Conformation</description> + <requirements> + <requirement type="package" version="1.0">remurna</requirement> + </requirements> + <stdio> + <exit_code range="1:" /> + </stdio> + <command><![CDATA[ + touch input.fa && + python $__tool_directory__/create_input_file.py '$seq' '$snp' input.fa && + \$(which remuRNA) + --proc="\${GALAXY_SLOTS}" ## number of CPUs + --window=$window + #if $advanced.advanced_selector =="advanced" + --NA=$advanced.NA + #if $advanced.energy == "abs_sig" + --energy='|sig|' + #else + --energy='sig' + #end if + --tmin=$advanced.tmin + --tinc=$advanced.tinc + --tmax=$advanced.tmax + #if $advanced.suffix + --suffix='$advanced.suffix' + #end if + --log=$advanced.log + #if $advanced.sodium + --sodium=$advanced.sodium + #end if + #if $advanced.magnesium + --magnesium=$advanced.magnesium + #end if + $advanced.polymer + $advanced.zip + $advanced.mutations + $advanced.nodangle + #end if + input.fa + > '$outfile' + ]]></command> + <inputs> + <param argument="--seq" type="data" format="fasta" label="Input Alignment File" /> + <param argument="--snp" type="data" format="txt" label="SNP" help="remuRNA accepts only a single tag in each call."/> + <param argument="--window" type="integer" value="200" min="1" label="Windows size" help="Compute average distance over windows of size winsize."/> + + <conditional name="advanced"> + <param name="advanced_selector" type="select" label="Advanced Options"> + <option value="basic">Basic options</option> + <option value="advanced">Advanced options</option> + </param> + <when value="basic"></when> + <when value="advanced"> + <param argument="--NA" type="select" label="RNA or DNA"> + <option value="RNA" selected="true">RNA sequence</option> + <option value="DNA">DNA sequence</option> + </param> + <param argument="--energy" type="select" label="Energy"> + <option value="abs_sig" selected="true">|sig|</option> + <option value="sig">sig</option> + </param> + + <param argument="--tmin" type="float" value="37.0" label="Min temperature [°C]" help=""/> + <param argument="--tmax" type="float" value="37.0" label="Max temperature [°C]" help=""/> + <param argument="--tinc" type="float" value="1.0" label="Temperature increment [°C]" help=""/> + + <param argument="--suffix" type="text" optional="true" label="Suffix" /> + + + <param argument="--sodium" type="float" optional="true" label="Salt concentration" help=""/> + <param argument="--magnesium" type="float" optional="true" label="Magnesium concentration" help=""/> + <param argument="--mutations" type="boolean" truevalue="--mutations" falsevalue="" checked="false" label="Compute relative entropy for all ppossible point mutations" help=""/> + <param argument="--nodangle" type="boolean" truevalue="" falsevalue="--nodangle" checked="true" label="Include dangling energies" help="default, dangling energies will be added for the bases adjacent to a helix on both sides in any case"/> + <param argument="--polymer" type="boolean" truevalue="--polymer" falsevalue="" checked="false" label="Polymer" help=""/> + <param argument="--zip" type="boolean" truevalue="--zip" falsevalue="" checked="false" label="Zip" help=""/> + <param argument="--log" type="select" label="Log level"> + <option value="0">0: OFF</option> + <option value="1" selected="true">1: Errors</option> + <option value="2">2: Warnings</option> + <option value="3">3: Info</option> + <option value="4">4: Debug</option> + <option value="5">5: All</option> + </param> + </when> + </conditional> + + </inputs> + + <outputs> + <data name="outfile" format="tabular" /> + </outputs> + <tests> + <test> + <param name="seq" value="seq.fa"/> + <param name="snp" value="snp.txt"/> + <output name="outfile" file="output.tabular"/> + </test> + </tests> + <help><![CDATA[ +**What it does** + + Measurement of Single-Nucleotide Polymorphism-induced Changes of RNA Conformation + +Single-nucleotide polymorphisms (SNPs) are often linked to critical phenotypes such as diseases or responses to vaccines, medications and environmental factors. However, the specific molecular mechanisms by which a causal SNP acts is usually not obvious. Changes in RNA secondary structure emerge as a possible explanation necessitating the development of methods to measure the impact of single-nucleotide variation on RNA structure. To answer this need, remuRNA commutes the relative entropy between the Boltzmann ensembles of the native and a mutant structure. + +**Input** + +1. Sequence file: must contain one sequence in Fasta format. + +2. SNP file: must contain only one tag + + +**Output**. + +SNP MFE(wt) MFE(mu) dMFE H(wt||mu) GCratio + +A23G -15.600 -16.000 0.400 0.877 0.336066 + ]]></help> + + <citations> + <citation type="doi">10.1093/nar/gks1009</citation> + </citations> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/generated_input_file_example.fa Tue Dec 13 12:32:11 2016 -0500 @@ -0,0 +1,3 @@ +>TEST +ccactttcacaatctgctagcaaaggttatgcagctaactaatcactttcccatcttttgttagatttgaatatatacattctatgatcattgctttttctctttacaggggagaatttcat +*a23g
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/output.tabular Tue Dec 13 12:32:11 2016 -0500 @@ -0,0 +1,2 @@ +SNP MFE(wt) MFE(mu) dMFE H(wt||mu) GCratio +A23G -15.600 -16.000 0.400 0.877 0.336066