Mercurial > repos > rnateam > targetfinder
view TargetFinder.xml @ 1:c9d56748fbde draft default tip
"planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/targetfinder/ commit fe9dd99a14770b6c5f26e24893599acb577e304f"
| author | rnateam |
|---|---|
| date | Thu, 25 Mar 2021 19:53:15 +0000 |
| parents | 773fdd1a02ea |
| children |
line wrap: on
line source
<tool id='targetfinder' name='TargetFinder' version='1.7.0+galaxy1' profile='20.01'> <description>plant small RNA target prediction tool</description> <macros> <import>macros.xml</import> </macros> <expand macro='edam' /> <expand macro='requirements' /> <stdio> <exit_code range='1:' /> </stdio> <command><![CDATA[ targetfinder_threads.pl -f '$f' -d '$d' -c $c -p $output_format -t "\${GALAXY_SLOTS:-12}" $r -o '$output_file' ]]></command> <inputs> <param argument='-f' type='data' format='fasta' label='Input small RNA sequences file' help='FASTA-format' /> <param argument='-d' type='data' format='fasta' label='Target sequence database file' help='FASTA-format' /> <param argument='-c' type='float' value='4.0' label='Prediction score cutoff value' help='Predicted targets are printed out if they are equal to or lower than the cutoff score specified. DEFAULT = 4' /> <param argument='-c' type='float' value='4.0' label='Prediction score cutoff value' help='Predicted targets are printed out if they are equal to or lower than the cutoff score specified. DEFAULT = 4' /> <param argument='-r' type='boolean' falsevalue='' truevalue='-r' checked='false' label='Search reverse strand for targets?' help='Use this option if the database is genomic DNA.' /> <param name='output_format' argument='-p' type='select' label='Output format' help='Output format for small RNA-target pairs (Default = classic).' > <option value='classic'>Original TargetFinder base-pair format</option> <option value='gff'>GFF</option> <option value='json'>JavaScript Object Notation (JSON)</option> <option value='table'>Tab-delimited format</option> </param> </inputs> <outputs> <data name='output_file' format='txt'> <change_format> <when input="output_format" value="gff" format="gff" /> <when input="output_format" value="json" format="json" /> <when input="output_format" value="table" format="tabular" /> </change_format> </data> </outputs> <tests> <test> <param name='f' value='arabidopsis_thaliana_miRNA.fasta'/> <param name='d' value='arabidopsis_thaliana_mRNA.fasta'/> <param name='r' value='false'/> <param name='c' value='4.0'/> <param name='output_format' value='classic'/> <output name='output_file' file='targetfinder_test_01.txt' compare='contains'/> </test> <test> <param name='f' value='arabidopsis_thaliana_miRNA.fasta'/> <param name='d' value='arabidopsis_thaliana_mRNA.fasta'/> <param name='r' value='true'/> <param name='c' value='4.0'/> <param name='output_format' value='classic'/> <output name='output_file' file='targetfinder_test_02.txt' compare='contains'/> </test> <test> <param name='f' value='arabidopsis_thaliana_miRNA.fasta'/> <param name='d' value='arabidopsis_thaliana_mRNA.fasta'/> <param name='r' value='false'/> <param name='c' value='6.0'/> <param name='output_format' value='classic'/> <output name='output_file' file='targetfinder_test_03.txt' compare='contains'/> </test> <test> <param name='f' value='arabidopsis_thaliana_miRNA.fasta'/> <param name='d' value='arabidopsis_thaliana_mRNA.fasta'/> <param name='r' value='false'/> <param name='c' value='4.0'/> <param name='output_format' value='classic'/> <output name='output_file' file='targetfinder_test_04.txt' compare='contains'/> </test> <test> <param name='f' value='arabidopsis_thaliana_miRNA.fasta'/> <param name='d' value='arabidopsis_thaliana_mRNA.fasta'/> <param name='r' value='false'/> <param name='c' value='4.0'/> <param name='output_format' value='gff'/> <output name='output_file' file='targetfinder_test_05.gff' compare='contains'/> </test> <test> <param name='f' value='arabidopsis_thaliana_miRNA.fasta'/> <param name='d' value='arabidopsis_thaliana_mRNA.fasta'/> <param name='r' value='false'/> <param name='c' value='4.0'/> <param name='output_format' value='table'/> <output name='output_file' file='targetfinder_test_06.tab' compare='contains'/> </test> <test> <param name='f' value='arabidopsis_thaliana_miRNA.fasta'/> <param name='d' value='arabidopsis_thaliana_mRNA.fasta'/> <param name='r' value='false'/> <param name='c' value='4.0'/> <param name='output_format' value='json'/> <output name='output_file' file='targetfinder_test_07.json' compare='contains' lines_diff='1'/> </test> <test> <param name='f' value='arabidopsis_thaliana_miRNA.fasta'/> <param name='d' value='arabidopsis_thaliana_mRNA.fasta'/> <param name='r' value='true'/> <param name='c' value='6.5'/> <param name='output_format' value='table'/> <output name='output_file' file='targetfinder_test_08.tab' compare='contains'/> </test> </tests> <help><![CDATA[ .. class:: infomark **What it does** TargetFinder will computationally predict small RNA binding sites on target transcripts from a sequence database. This is done by aligning the input small RNA sequence against all transcripts, followed by site scoring using a position-weighted scoring matrix. ---- .. class:: infomark **Input** This tool requires two fasta files: :: -f Input small RNA sequences file (FASTA-format). -d Target sequence database file (FASTA-format) ---- .. class:: infomark **Original TargetFinder Output** Each predicted target site is printed out separately. The output consists of two parts. The first is a description line and the second is a base-pairing diagram of the target and small RNA (query) sequence. The description line contains the query name, the description line from the target sequence database, and the target prediction score. :: query=miR399a, target=AT2G33770.1 | Symbol: None | ubiquitin-conjugating enzyme family protein, low similarity to u, score=1.5 The base-pairing diagram has the target site sequence on top in 5'-3' orientation and the query sequence on the bottom in 3'-5' orientation. Between the target site sequece and the query sequence are base pair symbols. A ':' (colon) symbol represents an ordinary Watson-Crick base pair, a '.' (period) represents a G:U base pair, and a ' ' (space) represents a mismatch. :: target 5' UAGGGCAAAUCUUCUUUGGCA 3' .:::::::::::.:::::::: query 3' GUCCCGUUUAGAGGAAACCGU 5' If a small RNA is predicted to target a sequence more than once, each target site will be output as separate output. ---- .. class:: infomark **Additional output formats** In addition to the output described above ('classic' output), three new output format options were added to TargetFinder. Generic Feature Format (GFF3): :: AT2G33770.1 | Symbols: UBC24 | phosphate 2 | chr2:14277558-14283040 REVERSE LEN targetfinder rna_target 607 627 1.5 + . smallRNA=miR399a;target_seq=UAGGGCAAAUCUUCUUUGGCA;base_pairs=.:::::::::::.::::::::;miR_seq=GUCCCGUUUAGAGGAAACCGU AT2G33770.1 | Symbols: UBC24 | phosphate 2 | chr2:14277558-14283040 REVERSE LEN targetfinder rna_target 740 760 1.5 + . smallRNA=miR399a;target_seq=UAGGGCAUAUCUCCUUUGGCA;base_pairs=.:::::: :::::::::::::;miR_seq=GUCCCGUUUAGAGGAAACCGU AT2G33770.1 | Symbols: UBC24 | phosphate 2 | chr2:14277558-14283040 REVERSE LEN targetfinder rna_target 829 849 1.5 + . smallRNA=miR399a;target_seq=UUGGGCAAAUCUCCUUUGGCA;base_pairs=. :::::::::::::::::::;miR_seq=GUCCCGUUUAGAGGAAACCGU Tab-deliminated Format: :: miR399a AT2G33770.1 | Symbols: UBC24 | phosphate 2 | chr2:14277558-14283040 REVERSE LEN 607 627 + 1.5 UAGGGCAAAUCUUCUUUGGCA .:::::::::::.:::::::: GUCCCGUUUAGAGGAAACCGU miR399a AT2G33770.1 | Symbols: UBC24 | phosphate 2 | chr2:14277558-14283040 REVERSE LEN 740 760 + 1.5 UAGGGCAUAUCUCCUUUGGCA .:::::: ::::::::::::: GUCCCGUUUAGAGGAAACCGU miR399a AT2G33770.1 | Symbols: UBC24 | phosphate 2 | chr2:14277558-14283040 REVERSE LEN 829 849 + 1.5 UUGGGCAAAUCUCCUUUGGCA . ::::::::::::::::::: GUCCCGUUUAGAGGAAACCGU JavaScript Object Notation Format (JSON): :: { 'miR399a': { 'hits' : [ { 'Target accession': 'AT2G33770.1 | Symbols: UBC24, ATUBC24, PHO2 | phosphate 2 | chr2:14277558-14283040 REVERSE LEN', 'Score': '1.5', 'Coordinates': '607-627', 'Strand': '+', 'Target sequence': 'UAGGGCAAAUCUUCUUUGGCA', 'Base pairing': '.:::::::::::.::::::::', 'amiRNA sequence': 'GUCCCGUUUAGAGGAAACCGU' } ] } } ---- .. class:: infomark **Method** TargetFinder searches for potential miRNA target sites in a FASTA-formated sequence database using three main steps. 1. The small RNA query sequence is aligned to every sequence in the FASTA-formated sequence database using `Smith-Waterman (SW) alignments <https://en.wikipedia.org/wiki/Smith%E2%80%93Waterman_algorithm>`_ implemented in the FASTA package (ssearch35_t). 2. The SW alignments are converted into RNA duplexes. 3. Each duplex is scored using a position-dependent scoring matrix. SW alignments are used to identify the best complementary regions between the small RNA query sequence and every sequence in the FASTA-formated sequence database. ]]></help> <expand macro='citations' /> </tool>
