Mercurial > repos > rnateam > viennarna_rnafold

comparison rnafold.xml @ 7:86f517dcfdfb draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit d9f13fd859165e4280412ec73f8f3f8b258d351d-dirty
author rnateam
date Thu, 28 Sep 2017 16:24:39 -0400
parents b31dcdb31209
children bdb786715d28
comparison
equal deleted inserted replaced
6:b31dcdb31209 7:86f517dcfdfb
1 <tool id="viennarna_rnafold" name="@EXECUTABLE@" version="@VERSION@.2"> 1 <tool id="viennarna_rnafold" name="@EXECUTABLE@" version="@VERSION@.3">
2 <description>Calculate minimum free energy secondary structures and partition function of RNAs</description> 2 <description>Calculate minimum free energy secondary structures and partition function of RNAs</description>
3 <macros> 3 <macros>
4 <token name="@EXECUTABLE@">RNAfold</token> 4 <token name="@EXECUTABLE@">RNAfold</token>
5 <import>macros.xml</import> 5 <import>macros.xml</import>
6 </macros> 6 </macros>
29 -T $temperature 29 -T $temperature
30 --dangles=$dangling 30 --dangles=$dangling
31 #if $layout_type ==0 31 #if $layout_type ==0
32 --layout-type=$general_options.layout_type 32 --layout-type=$general_options.layout_type
33 #end if 33 #end if
34 #if $measelect.mea == "yes": 34 #if $mea:
35 --MEA=$measelect.meavalue 35 --MEA=$mea
36 #if $measelect.pfScale <> 1.07 36 #end if
37 --pfScale=$measelect.pfScale 37 #if $pf
38 #end if 38 $pf
39 #else 39 #if $pfscale:
40 $measelect.pf 40 --pfScale=$pfscale
41 #if $measelect.pfScale <> 1.07
42 --pfScale=$measelect.pfScale
43 #end if 41 #end if
44 #end if 42 #end if
45 $advancedOptions.noconversion 43 $advancedOptions.noconversion
46 $advancedOptions.gquad 44 $advancedOptions.gquad
47 $advancedOptions.nolp 45 $advancedOptions.nolp
132 </param> 130 </param>
133 <param name="layout_type" type="select" label="Layout algorithm" argument="--layout_type" > 131 <param name="layout_type" type="select" label="Layout algorithm" argument="--layout_type" >
134 <option value="1" selected="true">Default: Naview layout</option> 132 <option value="1" selected="true">Default: Naview layout</option>
135 <option value="0">Simple radial layout</option> 133 <option value="0">Simple radial layout</option>
136 </param> 134 </param>
137 <conditional name="measelect"> 135 <param argument="--MEA" name="mea" type="float" value="1.0" optional="true" label="Gamma Value" help="Used for the calculation of the Maximum Expected accuracy"/>
138 <param name="mea" type="select" label="Calculate Maximum Expected accuracy" argument="--MEA"> 136 <param name="pf" type="boolean" checked="false" truevalue="--partfunc" falsevalue="" label="Calculate Partition Function" help="--partfunc"/>
139 <option value="no">No</option> 137 <param name="pfscale" type="float" value="1.07" optional="true" label="Scaling factor" help="In the calculation of the pf use scale*mfe as an estimate for the ensemble free energy (used to avoid overflows). The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for long sequences."/>
140 <option value="yes">Yes</option>
141 </param>
142 <when value="yes">
143 <param name="meavalue" type="float" value="1.0" label="Gamma Value"/>
144 <param argument="--pfScale" type="float" value="1.07" label="Scaling factor" help="In the calculation of the pf use scale*mfe as an estimate for the ensemble free energy (used to avoid overflows). The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for long sequences."/>
145 </when>
146 <when value="no">
147 <param name="pf" type="boolean" checked="false" truevalue="--partfunc" falsevalue="" label="Calculate Partition Function" help="--partfunc"/>
148 <param argument="--pfScale" type="float" value="1.07" label="Scaling factor" help="In the calculation of the pf use scale*mfe as an estimate for the ensemble free energy (used to avoid overflows). The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for long sequences."/>
149 </when>
150 </conditional>
151 <section name="advancedOptions" title="Advanced options"> 138 <section name="advancedOptions" title="Advanced options">
152 <param name="nops" type="boolean" truevalue="--noPS" falsevalue="" checked="false" label="Do not produce postscript drawing of the mfe structure (reduces run-time)" help="(--noPS)"/> 139 <param name="nops" type="boolean" truevalue="--noPS" falsevalue="" checked="false" label="Do not produce postscript drawing of the mfe structure (reduces run-time)" help="(--noPS)"/>
153 <param name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help="(--noLP)"/> 140 <param name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help="(--noLP)"/>
154 <param name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing" help="--noGU"/> 141 <param name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing" help="--noGU"/>
155 <param name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices. --noClosingGU"/> 142 <param name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices. --noClosingGU"/>
192 <param name="maxBPspan" type="integer" value="-1" label="Set the maximum base pair span" help="" argument="--maxBPspan"/> 179 <param name="maxBPspan" type="integer" value="-1" label="Set the maximum base pair span" help="" argument="--maxBPspan"/>
193 <conditional name="constraintLocation"> 180 <conditional name="constraintLocation">
194 <param name="constraintSelector" type="select" label="Constraints"> 181 <param name="constraintSelector" type="select" label="Constraints">
195 <!-- <option value="fromInput">The constraints are included in the input file</option> --> 182 <!-- <option value="fromInput">The constraints are included in the input file</option> -->
196 <option value="fromFile">The constraints are in a seperate file</option> 183 <option value="fromFile">The constraints are in a seperate file</option>
197 <option value="inFile">The constraints are in the fasta input file</option> 184 <option value="inFile">The constraints are in the fasta input file</option>
198 <option value="none" selected="true">Don't use constraints</option> 185 <option value="none" selected="true">Don't use constraints</option>
199 </param> 186 </param>
200 <!-- <when value="fromInput"></when> --> 187 <!-- <when value="fromInput"></when> -->
201 <when value="none"></when> 188 <when value="none"></when>
202 <when value="inFile"></when> 189 <when value="inFile"></when>
203 <when value="fromFile"> 190 <when value="fromFile">
204 <param name="constraintsFile" type="data" format="txt" label="Constraints file" argument="--constraint"/> 191 <param name="constraintsFile" type="data" format="txt" label="Constraints file" argument="--constraint"/>
205 <param name="batch" type="boolean" checked="false" truevalue="--batch" falsevalue="" 192 <param name="batch" type="boolean" checked="false" truevalue="--batch" falsevalue=""
206 label="Use constraints for all alignment records" 193 label="Use constraints for all alignment records"
207 help="Usually, constraints provided from input file are only applied to a single sequence alignment. Therefore, RNAalifold will stop its computation and quit after the first input alignment was processed. Using this switch, RNAfold processes all sequence alignments in the input and applies the same provided constraints to each of them." 194 help="Usually, constraints provided from input file are only applied to a single sequence alignment. Therefore, RNAalifold will stop its computation and quit after the first input alignment was processed. Using this switch, RNAfold processes all sequence alignments in the input and applies the same provided constraints to each of them."
304 </outputs> 291 </outputs>
305 <tests> 292 <tests>
306 <test> 293 <test>
307 <param name="select_fasta" value="true" /> 294 <param name="select_fasta" value="true" />
308 <param name="fasta_input" value="rnafold_input1.fa"/> 295 <param name="fasta_input" value="rnafold_input1.fa"/>
309 <output name="out_file1" file="rnafold_result1.txt"/> 296 <output name="tabular_file" file="rnafold_result1.txt"/>
310 </test> 297 </test>
311 <test> 298 <test>
312 <param name="select_fasta" value="true" /> 299 <param name="select_fasta" value="true" />
313 <param name="fasta_input" value="rnafold_input2.fa"/> 300 <param name="fasta_input" value="rnafold_input2.fa"/>
314 <param name="temperature" value="75"/> 301 <param name="temperature" value="75"/>
315 <output name="out_file1" file="rnafold_result2.txt"/> 302 <output name="tabular_file" file="rnafold_result2.txt"/>
316 </test> 303 </test>
317 <test> 304 <test>
318 <param name="select_fasta" value="false" /> 305 <param name="select_fasta" value="false" />
319 <param name="input_sequence" value="TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA"/> 306 <param name="input_sequence" value="TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA"/>
320 <output name="out_file1" file="rnafold_result3.txt"/> 307 <output name="tabular_file" file="rnafold_result3.txt"/>
321 </test> 308 </test>
322 <test> 309 <test>
323 <param name="select_fasta" value="true" /> 310 <param name="select_fasta" value="true" />
324 <param name="fasta_input" value="sample_3.fa"/> 311 <param name="fasta_input" value="sample_3.fa"/>
325 <conditional name="shapeOption"> 312 <conditional name="shapeOption">
326 <param name="shapeSelector" value="isUsed"/> 313 <param name="shapeSelector" value="isUsed"/>
327 </conditional> 314 </conditional>
328 <param name="shapeFile" value="sample_3.react"/> 315 <param name="shapeFile" value="sample_3.react"/>
329 <output name="out_file1" file="sample_3_result.txt"/> 316 <output name="tabular_file" file="sample_3_result.txt"/>
330 </test> 317 </test>
331 </tests> 318 </tests>
332 <help> 319 <help>
333 <![CDATA[ 320 <![CDATA[
334 **RNAfold** 321 **RNAfold**