--- a/rnafold.xml	Fri Sep 22 15:57:19 2017 -0400
+++ b/rnafold.xml	Thu Sep 28 16:24:39 2017 -0400
@@ -1,4 +1,4 @@
-<tool id="viennarna_rnafold" name="@EXECUTABLE@" version="@VERSION@.2">
+<tool id="viennarna_rnafold" name="@EXECUTABLE@" version="@VERSION@.3">
     <description>Calculate minimum free energy secondary structures and partition function of RNAs</description>
     <macros>
         <token name="@EXECUTABLE@">RNAfold</token>
@@ -31,15 +31,13 @@
     #if $layout_type ==0
         --layout-type=$general_options.layout_type
     #end if
-    #if $measelect.mea == "yes":
-        --MEA=$measelect.meavalue
-    #if $measelect.pfScale <> 1.07
-        --pfScale=$measelect.pfScale
+    #if $mea:
+        --MEA=$mea
     #end if
-    #else
-        $measelect.pf
-        #if $measelect.pfScale <> 1.07
-            --pfScale=$measelect.pfScale
+    #if $pf
+        $pf
+        #if $pfscale:
+            --pfScale=$pfscale
         #end if
     #end if
     $advancedOptions.noconversion
@@ -134,20 +132,9 @@
             <option value="1" selected="true">Default: Naview layout</option>
             <option value="0">Simple radial layout</option>
         </param>
-        <conditional name="measelect">
-            <param name="mea" type="select" label="Calculate Maximum Expected accuracy" argument="--MEA">
-                <option value="no">No</option>
-                <option value="yes">Yes</option>
-            </param>
-            <when value="yes">
-                <param name="meavalue" type="float" value="1.0" label="Gamma Value"/>
-                <param argument="--pfScale" type="float" value="1.07" label="Scaling factor" help="In the calculation of the pf use scale*mfe as an estimate for the ensemble free energy (used to avoid overflows). The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for long sequences."/>
-            </when>
-            <when value="no">
-                <param name="pf" type="boolean" checked="false" truevalue="--partfunc" falsevalue="" label="Calculate Partition Function" help="--partfunc"/>
-                <param argument="--pfScale" type="float" value="1.07" label="Scaling factor" help="In the calculation of the pf use scale*mfe as an estimate for the ensemble free energy (used to avoid overflows). The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for long sequences."/>
-            </when>
-        </conditional>
+        <param argument="--MEA" name="mea" type="float" value="1.0" optional="true" label="Gamma Value" help="Used for the calculation of the Maximum Expected accuracy"/>
+        <param name="pf" type="boolean" checked="false" truevalue="--partfunc" falsevalue="" label="Calculate Partition Function" help="--partfunc"/>
+        <param name="pfscale" type="float" value="1.07" optional="true" label="Scaling factor" help="In the calculation of the pf use scale*mfe as an estimate for the ensemble free energy (used to avoid overflows). The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for long sequences."/>
         <section name="advancedOptions" title="Advanced options">
             <param name="nops" type="boolean" truevalue="--noPS" falsevalue="" checked="false" label="Do not produce postscript drawing of the mfe structure (reduces run-time)" help="(--noPS)"/>
             <param name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help="(--noLP)"/>
@@ -194,12 +181,12 @@
                     <param name="constraintSelector" type="select" label="Constraints">
                         <!-- <option value="fromInput">The constraints are included in the input file</option> -->
                         <option value="fromFile">The constraints are in a seperate file</option>
-			<option value="inFile">The constraints are in the fasta input file</option>
+			            <option value="inFile">The constraints are in the fasta input file</option>
                         <option value="none" selected="true">Don't use constraints</option>
                     </param>
-                <!--	<when value="fromInput"></when> -->
-                <when value="none"></when>
-		<when value="inFile"></when>
+                    <!--	<when value="fromInput"></when> -->
+                    <when value="none"></when>
+                    <when value="inFile"></when>
                     <when value="fromFile">
                         <param name="constraintsFile" type="data" format="txt" label="Constraints file" argument="--constraint"/>
                         <param name="batch" type="boolean" checked="false" truevalue="--batch" falsevalue=""
@@ -306,18 +293,18 @@
         <test>
             <param name="select_fasta" value="true" />
             <param name="fasta_input" value="rnafold_input1.fa"/>
-            <output name="out_file1" file="rnafold_result1.txt"/>
+            <output name="tabular_file" file="rnafold_result1.txt"/>
         </test>
         <test>
             <param name="select_fasta" value="true" />
             <param name="fasta_input" value="rnafold_input2.fa"/>
             <param name="temperature" value="75"/>
-            <output name="out_file1" file="rnafold_result2.txt"/>
+            <output name="tabular_file" file="rnafold_result2.txt"/>
         </test>
         <test>
             <param name="select_fasta" value="false" />
             <param name="input_sequence" value="TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA"/>
-            <output name="out_file1" file="rnafold_result3.txt"/>
+            <output name="tabular_file" file="rnafold_result3.txt"/>
         </test>
         <test>
             <param name="select_fasta" value="true" />
@@ -326,7 +313,7 @@
               <param name="shapeSelector" value="isUsed"/>
             </conditional>
             <param name="shapeFile" value="sample_3.react"/>
-            <output name="out_file1" file="sample_3_result.txt"/>
+            <output name="tabular_file" file="sample_3_result.txt"/>
         </test>
     </tests>
     <help>