Mercurial > repos > rnateam > viennarna_rnalfold

comparison test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps @ 6:c3162757c4cc draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit 36681a08c6e44c663169caaefd964781c43d0d29
author rnateam
date Wed, 20 Dec 2017 08:32:26 -0500
parents
children
comparison
equal deleted inserted replaced
5:0bf7b38022f9 6:c3162757c4cc
1 %!PS-Adobe-3.0 EPSF-3.0
2 %%Title: RNA Dot Plot
3 %%Creator: ViennaRNA-2.2.10
4 %%CreationDate: Tue Dec 19 19:42:58 2017
5 %%BoundingBox: 66 211 518 662
6 %%DocumentFonts: Helvetica
7 %%Pages: 1
8 %%EndComments
9
10 %Options:
11 %
12 %This file contains the square roots of the base pair probabilities in the form
13 % i j sqrt(p(i,j)) ubox
14
15 %%BeginProlog
16 /DPdict 100 dict def
17 DPdict begin
18 /logscale false def
19 /lpmin 1e-05 log def
20
21 /box { %size x y box - draws box centered on x,y
22 2 index 0.5 mul sub % x -= 0.5
23 exch 2 index 0.5 mul sub exch % y -= 0.5
24 3 -1 roll dup rectfill
25 } bind def
26
27 /ubox {
28 logscale {
29 log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
30 } if
31 3 1 roll
32 exch len exch sub 1 add box
33 } bind def
34
35 /lbox {
36 3 1 roll
37 len exch sub 1 add box
38 } bind def
39
40 /drawseq {
41 % print sequence along all 4 sides
42 [ [0.7 -0.3 0 ]
43 [0.7 0.7 len add 0]
44 [-0.3 len sub -0.4 -90]
45 [-0.3 len sub 0.7 len add -90]
46 ] {
47 gsave
48 aload pop rotate translate
49 0 1 len 1 sub {
50 dup 0 moveto
51 sequence exch 1 getinterval
52 show
53 } for
54 grestore
55 } forall
56 } bind def
57
58 /drawgrid{
59 0.01 setlinewidth
60 len log 0.9 sub cvi 10 exch exp % grid spacing
61 dup 1 gt {
62 dup dup 20 div dup 2 array astore exch 40 div setdash
63 } { [0.3 0.7] 0.1 setdash } ifelse
64 0 exch len {
65 dup dup
66 0 moveto
67 len lineto
68 dup
69 len exch sub 0 exch moveto
70 len exch len exch sub lineto
71 stroke
72 } for
73 [] 0 setdash
74 0.04 setlinewidth
75 currentdict /cutpoint known {
76 cutpoint 1 sub
77 dup dup -1 moveto len 1 add lineto
78 len exch sub dup
79 -1 exch moveto len 1 add exch lineto
80 stroke
81 } if
82 0.5 neg dup translate
83 } bind def
84
85 end
86 %%EndProlog
87 DPdict begin
88 %delete next line to get rid of title
89 270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_caro_chrUn_GL343207.trna3_AlaAGC) show
90
91 /sequence { (\
92 GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\
93 ) } def
94 /len { sequence length } bind def
95
96 72 216 translate
97 72 6 mul len 1 add div dup scale
98 /Helvetica findfont 0.95 scalefont setfont
99
100 drawseq
101 0.5 dup translate
102 % draw diagonal
103 0.04 setlinewidth
104 0 len moveto len 0 lineto stroke
105
106 /min { 2 copy gt { exch } if pop } bind def
107
108 /utri{ % i j prob utri
109 gsave
110 1 min 2 div
111 0.85 mul 0.15 add 0.95 0.33
112 3 1 roll % prepare hsb color
113 sethsbcolor
114 % now produce the coordinates for lines
115 exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub
116 moveto lineto lineto closepath fill
117 grestore
118 } bind def
119 /uHmotif{ % i j uHmotif
120 gsave
121 1 min 2 div
122 0.85 mul 0.15 add 0.95 0.99
123 3 1 roll % prepare hsb color
124 sethsbcolor
125 % now produce the coordinates for lines
126 exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub
127 moveto lineto lineto closepath fill
128 grestore
129 } bind def
130 /lHmotif{ % i j lHmotif
131 gsave
132 1 min 2 div
133 0.85 mul 0.15 add 0.95 0.99
134 3 1 roll % prepare hsb color
135 sethsbcolor
136 % now produce the coordinates for lines
137 dup len exch sub dup 4 -1 roll 1 sub dup 3 1 roll dup len exch sub
138 moveto lineto lineto closepath fill
139 grestore
140 } bind def
141 /uImotif{ % i j k l uImotif
142 gsave
143 1 min 2 div
144 0.85 mul 0.15 add 0.95 0.99
145 3 1 roll % prepare hsb color
146 sethsbcolor
147 % now produce the coordinates for lines
148 1 sub dup 5 1 roll exch len exch sub dup 5 1 roll 3 -1 roll dup
149 5 1 roll exch 4 1 roll 3 1 roll exch 1 sub len exch sub dup 3 1 roll
150 moveto lineto lineto lineto closepath fill
151 grestore
152 } bind def
153 /lImotif{ % i j k l lImotif
154 gsave
155 1 min 2 div
156 0.85 mul 0.15 add 0.95 0.99
157 3 1 roll % prepare hsb color
158 sethsbcolor
159 % now produce the coordinates for lines
160 4 -1 roll 1 sub dup 5 1 roll exch 1 sub len exch sub dup 3 -1 roll exch
161 5 -1 roll len exch sub dup 6 -1 roll dup 3 1 roll 7 4 roll
162 moveto lineto lineto lineto closepath fill
163 grestore
164 } bind def
165
166 %data starts here
167
168 %start of quadruplex data
169
170 %start of Hmotif data
171
172 %start of Imotif data
173
174 %draw the grid
175 drawgrid
176
177 %start of base pair probability data
178 1 71 0.011137621 ubox
179 1 72 0.998618513 ubox
180 2 70 0.011249479 ubox
181 2 71 0.999343269 ubox
182 2 72 0.029380302 ubox
183 3 69 0.016278852 ubox
184 3 70 0.998657995 ubox
185 3 71 0.029349731 ubox
186 3 72 0.013044031 ubox
187 4 68 0.015570075 ubox
188 4 69 0.999660285 ubox
189 4 70 0.006500567 ubox
190 4 71 0.013063530 ubox
191 5 67 0.017184802 ubox
192 5 68 0.995393993 ubox
193 5 70 0.012116272 ubox
194 6 20 0.003683136 ubox
195 6 47 0.007871866 ubox
196 6 67 0.961997835 ubox
197 6 68 0.010641824 ubox
198 7 19 0.003963646 ubox
199 7 22 0.016669769 ubox
200 7 23 0.006395271 ubox
201 7 26 0.010803708 ubox
202 7 45 0.003325342 ubox
203 7 46 0.008388346 ubox
204 7 66 0.889354167 ubox
205 8 18 0.004993356 ubox
206 8 21 0.043576199 ubox
207 8 22 0.009051039 ubox
208 8 23 0.003412982 ubox
209 8 26 0.053349931 ubox
210 8 44 0.006391561 ubox
211 8 45 0.009575801 ubox
212 8 46 0.006511628 ubox
213 8 48 0.044296110 ubox
214 8 66 0.051228716 ubox
215 9 17 0.005076838 ubox
216 9 20 0.044973880 ubox
217 9 47 0.045851242 ubox
218 9 67 0.006907131 ubox
219 10 20 0.031947572 ubox
220 10 25 0.993218795 ubox
221 10 47 0.003684611 ubox
222 10 61 0.005362683 ubox
223 11 18 0.045881626 ubox
224 11 19 0.032788757 ubox
225 11 22 0.010762380 ubox
226 11 24 0.996351171 ubox
227 11 43 0.031784396 ubox
228 11 45 0.044997253 ubox
229 11 46 0.003273388 ubox
230 11 60 0.005393685 ubox
231 12 18 0.028759750 ubox
232 12 19 0.007591504 ubox
233 12 21 0.010602364 ubox
234 12 23 0.996289342 ubox
235 12 42 0.031993047 ubox
236 12 44 0.044989514 ubox
237 12 58 0.005409282 ubox
238 13 18 0.016589428 ubox
239 13 19 0.009128152 ubox
240 13 22 0.996158882 ubox
241 13 41 0.032010508 ubox
242 13 43 0.044839517 ubox
243 13 57 0.005483356 ubox
244 14 20 0.079642667 ubox
245 14 56 0.005446527 ubox
246 15 20 0.129735024 ubox
247 15 55 0.005085787 ubox
248 16 20 0.018529841 ubox
249 16 38 0.051862141 ubox
250 17 21 0.010497970 ubox
251 17 26 0.003797728 ubox
252 17 37 0.052295806 ubox
253 17 39 0.003520191 ubox
254 17 42 0.004660118 ubox
255 17 52 0.004889289 ubox
256 18 25 0.005375323 ubox
257 18 36 0.051745231 ubox
258 18 38 0.003387544 ubox
259 19 25 0.004215070 ubox
260 19 36 0.018363451 ubox
261 19 40 0.005479857 ubox
262 19 50 0.005352275 ubox
263 20 24 0.003956630 ubox
264 20 34 0.049426221 ubox
265 20 35 0.019676299 ubox
266 20 39 0.005488315 ubox
267 20 49 0.005308891 ubox
268 21 33 0.037607150 ubox
269 21 38 0.005407841 ubox
270 22 32 0.023047831 ubox
271 22 33 0.039236028 ubox
272 23 32 0.049874318 ubox
273 23 47 0.036867639 ubox
274 24 31 0.055184372 ubox
275 24 47 0.041474959 ubox
276 25 30 0.055108050 ubox
277 25 41 0.003625640 ubox
278 25 45 0.072422399 ubox
279 25 46 0.047506335 ubox
280 26 36 0.020612775 ubox
281 26 40 0.011634581 ubox
282 26 47 0.044476135 ubox
283 27 35 0.020631543 ubox
284 27 39 0.011645626 ubox
285 27 43 0.992061337 ubox
286 27 45 0.025461226 ubox
287 27 46 0.039850990 ubox
288 28 34 0.019643833 ubox
289 28 42 0.996960401 ubox
290 28 44 0.021374269 ubox
291 28 45 0.024434496 ubox
292 29 41 0.997917003 ubox
293 29 43 0.018395309 ubox
294 29 45 0.003166236 ubox
295 30 36 0.012434123 ubox
296 30 40 0.998065717 ubox
297 30 47 0.007404570 ubox
298 31 35 0.012393915 ubox
299 31 39 0.997764981 ubox
300 31 41 0.005414838 ubox
301 31 43 0.003645699 ubox
302 31 46 0.007622516 ubox
303 32 37 0.068093187 ubox
304 32 39 0.013599795 ubox
305 32 42 0.003678913 ubox
306 32 45 0.007610493 ubox
307 33 37 0.102337630 ubox
308 33 39 0.003720007 ubox
309 33 41 0.003538594 ubox
310 33 44 0.007538047 ubox
311 34 38 0.013851913 ubox
312 36 41 0.007501659 ubox
313 38 48 0.018700348 ubox
314 39 47 0.020533473 ubox
315 40 46 0.020625702 ubox
316 44 68 0.005576608 ubox
317 44 70 0.006111196 ubox
318 45 50 0.003800521 ubox
319 45 62 0.010043051 ubox
320 45 65 0.003484260 ubox
321 45 67 0.009783316 ubox
322 45 68 0.032579696 ubox
323 45 69 0.007408521 ubox
324 46 61 0.010086460 ubox
325 46 65 0.005780351 ubox
326 46 67 0.077112938 ubox
327 46 68 0.006873266 ubox
328 47 60 0.010092967 ubox
329 47 64 0.003785455 ubox
330 47 66 0.084736602 ubox
331 48 59 0.008724857 ubox
332 48 67 0.019275395 ubox
333 49 65 0.998806957 ubox
334 50 57 0.009062054 ubox
335 50 64 0.999848265 ubox
336 51 56 0.007052370 ubox
337 51 62 0.010700667 ubox
338 51 63 0.999834583 ubox
339 52 61 0.014860342 ubox
340 52 62 0.999778783 ubox
341 52 63 0.005533111 ubox
342 53 61 0.998254922 ubox
343 53 62 0.007658167 ubox
344 54 59 0.156536412 ubox
345 55 60 0.324268739 ubox
346 56 60 0.024269416 ubox
347 1 72 0.9500000 lbox
348 2 71 0.9500000 lbox
349 3 70 0.9500000 lbox
350 4 69 0.9500000 lbox
351 5 68 0.9500000 lbox
352 6 67 0.9500000 lbox
353 7 66 0.9500000 lbox
354 10 25 0.9500000 lbox
355 11 24 0.9500000 lbox
356 12 23 0.9500000 lbox
357 13 22 0.9500000 lbox
358 27 43 0.9500000 lbox
359 28 42 0.9500000 lbox
360 29 41 0.9500000 lbox
361 30 40 0.9500000 lbox
362 31 39 0.9500000 lbox
363 49 65 0.9500000 lbox
364 50 64 0.9500000 lbox
365 51 63 0.9500000 lbox
366 52 62 0.9500000 lbox
367 53 61 0.9500000 lbox
368 showpage
369 end
370 %%EOF