Mercurial > repos > rnateam > viennarna_rnalfold
diff test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps @ 6:c3162757c4cc draft default tip
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit 36681a08c6e44c663169caaefd964781c43d0d29
author | rnateam |
---|---|
date | Wed, 20 Dec 2017 08:32:26 -0500 |
parents | |
children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps Wed Dec 20 08:32:26 2017 -0500 @@ -0,0 +1,370 @@ +%!PS-Adobe-3.0 EPSF-3.0 +%%Title: RNA Dot Plot +%%Creator: ViennaRNA-2.2.10 +%%CreationDate: Tue Dec 19 19:42:58 2017 +%%BoundingBox: 66 211 518 662 +%%DocumentFonts: Helvetica +%%Pages: 1 +%%EndComments + +%Options: +% +%This file contains the square roots of the base pair probabilities in the form +% i j sqrt(p(i,j)) ubox + +%%BeginProlog +/DPdict 100 dict def +DPdict begin +/logscale false def +/lpmin 1e-05 log def + +/box { %size x y box - draws box centered on x,y + 2 index 0.5 mul sub % x -= 0.5 + exch 2 index 0.5 mul sub exch % y -= 0.5 + 3 -1 roll dup rectfill +} bind def + +/ubox { + logscale { + log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if + } if + 3 1 roll + exch len exch sub 1 add box +} bind def + +/lbox { + 3 1 roll + len exch sub 1 add box +} bind def + +/drawseq { +% print sequence along all 4 sides +[ [0.7 -0.3 0 ] + [0.7 0.7 len add 0] + [-0.3 len sub -0.4 -90] + [-0.3 len sub 0.7 len add -90] +] { + gsave + aload pop rotate translate + 0 1 len 1 sub { + dup 0 moveto + sequence exch 1 getinterval + show + } for + grestore + } forall +} bind def + +/drawgrid{ + 0.01 setlinewidth + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { + dup dup + 0 moveto + len lineto + dup + len exch sub 0 exch moveto + len exch len exch sub lineto + stroke + } for + [] 0 setdash + 0.04 setlinewidth + currentdict /cutpoint known { + cutpoint 1 sub + dup dup -1 moveto len 1 add lineto + len exch sub dup + -1 exch moveto len 1 add exch lineto + stroke + } if + 0.5 neg dup translate +} bind def + +end +%%EndProlog +DPdict begin +%delete next line to get rid of title +270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_caro_chrUn_GL343207.trna3_AlaAGC) show + +/sequence { (\ +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\ +) } def +/len { sequence length } bind def + +72 216 translate +72 6 mul len 1 add div dup scale +/Helvetica findfont 0.95 scalefont setfont + +drawseq +0.5 dup translate +% draw diagonal +0.04 setlinewidth +0 len moveto len 0 lineto stroke + +/min { 2 copy gt { exch } if pop } bind def + +/utri{ % i j prob utri + gsave + 1 min 2 div + 0.85 mul 0.15 add 0.95 0.33 + 3 1 roll % prepare hsb color + sethsbcolor + % now produce the coordinates for lines + exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub + moveto lineto lineto closepath fill + grestore +} bind def +/uHmotif{ % i j uHmotif + gsave + 1 min 2 div + 0.85 mul 0.15 add 0.95 0.99 + 3 1 roll % prepare hsb color + sethsbcolor + % now produce the coordinates for lines + exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub + moveto lineto lineto closepath fill + grestore +} bind def +/lHmotif{ % i j lHmotif + gsave + 1 min 2 div + 0.85 mul 0.15 add 0.95 0.99 + 3 1 roll % prepare hsb color + sethsbcolor + % now produce the coordinates for lines + dup len exch sub dup 4 -1 roll 1 sub dup 3 1 roll dup len exch sub + moveto lineto lineto closepath fill + grestore +} bind def +/uImotif{ % i j k l uImotif + gsave + 1 min 2 div + 0.85 mul 0.15 add 0.95 0.99 + 3 1 roll % prepare hsb color + sethsbcolor + % now produce the coordinates for lines + 1 sub dup 5 1 roll exch len exch sub dup 5 1 roll 3 -1 roll dup + 5 1 roll exch 4 1 roll 3 1 roll exch 1 sub len exch sub dup 3 1 roll + moveto lineto lineto lineto closepath fill + grestore +} bind def +/lImotif{ % i j k l lImotif + gsave + 1 min 2 div + 0.85 mul 0.15 add 0.95 0.99 + 3 1 roll % prepare hsb color + sethsbcolor + % now produce the coordinates for lines + 4 -1 roll 1 sub dup 5 1 roll exch 1 sub len exch sub dup 3 -1 roll exch + 5 -1 roll len exch sub dup 6 -1 roll dup 3 1 roll 7 4 roll + moveto lineto lineto lineto closepath fill + grestore +} bind def + +%data starts here + +%start of quadruplex data + +%start of Hmotif data + +%start of Imotif data + +%draw the grid +drawgrid + +%start of base pair probability data +1 71 0.011137621 ubox +1 72 0.998618513 ubox +2 70 0.011249479 ubox +2 71 0.999343269 ubox +2 72 0.029380302 ubox +3 69 0.016278852 ubox +3 70 0.998657995 ubox +3 71 0.029349731 ubox +3 72 0.013044031 ubox +4 68 0.015570075 ubox +4 69 0.999660285 ubox +4 70 0.006500567 ubox +4 71 0.013063530 ubox +5 67 0.017184802 ubox +5 68 0.995393993 ubox +5 70 0.012116272 ubox +6 20 0.003683136 ubox +6 47 0.007871866 ubox +6 67 0.961997835 ubox +6 68 0.010641824 ubox +7 19 0.003963646 ubox +7 22 0.016669769 ubox +7 23 0.006395271 ubox +7 26 0.010803708 ubox +7 45 0.003325342 ubox +7 46 0.008388346 ubox +7 66 0.889354167 ubox +8 18 0.004993356 ubox +8 21 0.043576199 ubox +8 22 0.009051039 ubox +8 23 0.003412982 ubox +8 26 0.053349931 ubox +8 44 0.006391561 ubox +8 45 0.009575801 ubox +8 46 0.006511628 ubox +8 48 0.044296110 ubox +8 66 0.051228716 ubox +9 17 0.005076838 ubox +9 20 0.044973880 ubox +9 47 0.045851242 ubox +9 67 0.006907131 ubox +10 20 0.031947572 ubox +10 25 0.993218795 ubox +10 47 0.003684611 ubox +10 61 0.005362683 ubox +11 18 0.045881626 ubox +11 19 0.032788757 ubox +11 22 0.010762380 ubox +11 24 0.996351171 ubox +11 43 0.031784396 ubox +11 45 0.044997253 ubox +11 46 0.003273388 ubox +11 60 0.005393685 ubox +12 18 0.028759750 ubox +12 19 0.007591504 ubox +12 21 0.010602364 ubox +12 23 0.996289342 ubox +12 42 0.031993047 ubox +12 44 0.044989514 ubox +12 58 0.005409282 ubox +13 18 0.016589428 ubox +13 19 0.009128152 ubox +13 22 0.996158882 ubox +13 41 0.032010508 ubox +13 43 0.044839517 ubox +13 57 0.005483356 ubox +14 20 0.079642667 ubox +14 56 0.005446527 ubox +15 20 0.129735024 ubox +15 55 0.005085787 ubox +16 20 0.018529841 ubox +16 38 0.051862141 ubox +17 21 0.010497970 ubox +17 26 0.003797728 ubox +17 37 0.052295806 ubox +17 39 0.003520191 ubox +17 42 0.004660118 ubox +17 52 0.004889289 ubox +18 25 0.005375323 ubox +18 36 0.051745231 ubox +18 38 0.003387544 ubox +19 25 0.004215070 ubox +19 36 0.018363451 ubox +19 40 0.005479857 ubox +19 50 0.005352275 ubox +20 24 0.003956630 ubox +20 34 0.049426221 ubox +20 35 0.019676299 ubox +20 39 0.005488315 ubox +20 49 0.005308891 ubox +21 33 0.037607150 ubox +21 38 0.005407841 ubox +22 32 0.023047831 ubox +22 33 0.039236028 ubox +23 32 0.049874318 ubox +23 47 0.036867639 ubox +24 31 0.055184372 ubox +24 47 0.041474959 ubox +25 30 0.055108050 ubox +25 41 0.003625640 ubox +25 45 0.072422399 ubox +25 46 0.047506335 ubox +26 36 0.020612775 ubox +26 40 0.011634581 ubox +26 47 0.044476135 ubox +27 35 0.020631543 ubox +27 39 0.011645626 ubox +27 43 0.992061337 ubox +27 45 0.025461226 ubox +27 46 0.039850990 ubox +28 34 0.019643833 ubox +28 42 0.996960401 ubox +28 44 0.021374269 ubox +28 45 0.024434496 ubox +29 41 0.997917003 ubox +29 43 0.018395309 ubox +29 45 0.003166236 ubox +30 36 0.012434123 ubox +30 40 0.998065717 ubox +30 47 0.007404570 ubox +31 35 0.012393915 ubox +31 39 0.997764981 ubox +31 41 0.005414838 ubox +31 43 0.003645699 ubox +31 46 0.007622516 ubox +32 37 0.068093187 ubox +32 39 0.013599795 ubox +32 42 0.003678913 ubox +32 45 0.007610493 ubox +33 37 0.102337630 ubox +33 39 0.003720007 ubox +33 41 0.003538594 ubox +33 44 0.007538047 ubox +34 38 0.013851913 ubox +36 41 0.007501659 ubox +38 48 0.018700348 ubox +39 47 0.020533473 ubox +40 46 0.020625702 ubox +44 68 0.005576608 ubox +44 70 0.006111196 ubox +45 50 0.003800521 ubox +45 62 0.010043051 ubox +45 65 0.003484260 ubox +45 67 0.009783316 ubox +45 68 0.032579696 ubox +45 69 0.007408521 ubox +46 61 0.010086460 ubox +46 65 0.005780351 ubox +46 67 0.077112938 ubox +46 68 0.006873266 ubox +47 60 0.010092967 ubox +47 64 0.003785455 ubox +47 66 0.084736602 ubox +48 59 0.008724857 ubox +48 67 0.019275395 ubox +49 65 0.998806957 ubox +50 57 0.009062054 ubox +50 64 0.999848265 ubox +51 56 0.007052370 ubox +51 62 0.010700667 ubox +51 63 0.999834583 ubox +52 61 0.014860342 ubox +52 62 0.999778783 ubox +52 63 0.005533111 ubox +53 61 0.998254922 ubox +53 62 0.007658167 ubox +54 59 0.156536412 ubox +55 60 0.324268739 ubox +56 60 0.024269416 ubox +1 72 0.9500000 lbox +2 71 0.9500000 lbox +3 70 0.9500000 lbox +4 69 0.9500000 lbox +5 68 0.9500000 lbox +6 67 0.9500000 lbox +7 66 0.9500000 lbox +10 25 0.9500000 lbox +11 24 0.9500000 lbox +12 23 0.9500000 lbox +13 22 0.9500000 lbox +27 43 0.9500000 lbox +28 42 0.9500000 lbox +29 41 0.9500000 lbox +30 40 0.9500000 lbox +31 39 0.9500000 lbox +49 65 0.9500000 lbox +50 64 0.9500000 lbox +51 63 0.9500000 lbox +52 62 0.9500000 lbox +53 61 0.9500000 lbox +showpage +end +%%EOF